GENE-39722; No. of pages: 5; 4C: Gene xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
5Q1
Mohammad Amin Honardoost a, Hosein Tabatabaeian b, Mojtaba Akbari c, Mansoor Salehi c,⁎
O
R O
6 7 8
a
9
a r t i c l e
20 10 11 12 13 14
Article history: Received 11 November 2013 Received in revised form 11 May 2014 Accepted 30 May 2014 Available online xxxx
15 16 17 18 19
Keywords: Beta thalassemia Conventional ARMS PCR Sequencing Tetra primer ARMS PCR
P
i n f o
a b s t r a c t
Purpose: Beta thalassemia is one of the most important hematic diseases all around the world and solving the problems caused by this abnormality is strongly dependent on precise detection and reliable screening of high-risk couples. The aim of our study was the investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method comparing with conventional ARMS PCR, based on sequencing technique outcomes for genotyping of IVS-II-I mutation in beta thalassemia patients. Methods: Fifty seven samples including two homozygote, 49 heterozygote and 6 normal specimens were analyzed by Tetra primer ARMS PCR and conventional ARMS PCR methods. DNA was extracted by the standard method of salting out for leukocyte genomic DNA extraction of blood specimens and a high pure PCR template preparation kit was used for DNA purification of CVS samples. The results obtained by Tetra primer ARMS PCR and conventional ARMS PCR methods were compared with gold standard technique, i.e. sequencing. Results: All three parameters including specificity, sensitivity and accuracy were 100% for Tetra primer ARMS PCR method, while they were 100%, 92.45% and 92.7% for conventional ARMS PCR technique respectively. Comparing with Tetra primer ARMS PCR which represented 100% agreement with sequencing method, conventional ARMS PCR technique only showed 47.1% agreement, because of 4 discordant results. Conclusion: Tetra primer ARMS PCR method is an almost reliable, sensitive and accurate technique and it is suggested that it can be used as a complementary method for diagnostic cases instead of conventional ARMS PCR method. This suggestion originated with perfect rate of agreement between outcomes of sequencing method, as a gold standard method of detecting the mutations, and Tetra primer ARMS PCR technique comparing with conventional ARMS PCR method. © 2014 Published by Elsevier B.V.
43 41 40 42
T
N C O
R
R
E
c
Division of Cellular and Molecular Biology, Department of Biology, Faculty of Sciences, University of Isfahan, Isfahan, Iran Genetics Division, Biology Department, Faculty of Sciences, University of Isfahan, Isfahan, Iran School of Medicine, Isfahan University of Medical Science, Isfahan, Iran
C
b
D
3
E
2
F
4
Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR, based on sequencing technique outcomes in IVS-II-I genotyping of beta thalassemia patients
1
1. Introduction
45
Beta-thalassemia syndromes refer to a category of hemoglobin abnormalities caused by mutations in the b-globin gene. These various mutations can result in reduction or loss of b-globin chain synthesis, called β+ mutations and β0 mutations respectively (Galanello and Origa, 2010). Beta-thalassemia, a monogenic autosomal recessive disease, is comparatively prevalent worldwide, but it is regarded rampant
46 47 48 49 50
U
44
Abbreviations: PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; ARMS, amplification refractory mutation system; T-ARMS, Tetra primer ARMS. ⁎ Corresponding author at: Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan 81744-176, Iran. E-mail addresses: [email protected] (M.A. Honardoost), [email protected] (H. Tabatabaeian), [email protected] (M. Akbari), [email protected] (M. Salehi).
in the Middle East, especially Iran. The global average associated with carriers of beta-thalassemia is close to 3%, while it is 5% for Iranian population (Najmabadi et al., 2001). The accurate detection and screening of highrisk couples could lead to improvements of the beta-thalassemia complications. So far, approximately 200 different mutations in the divers regions of the b-globin gene have been reported which are related to onset of the disease (Giardine et al., 2007). Almost 20 different mutations are introduced as common mutations in Iran, with various incidence rates in cities across the country (Derakhshandeh-Peykar et al., 2008; Najmabadi et al., 2001). The frequency of common mutations in Iran was first identified by Najmabadi et al. as the following statistics: 34% for IVS-II-I, 4.76% for FSC-8/9 (+ G), 7.55% for IVS-I-5 (GC), 3% for FSC-36/37 (− T) and 4.76% for IVS-I-110 (GA) (Najmabadi et al., 2001). In 2008, Derakhshandeh-Peykar et al. showed that the incidence rate of
http://dx.doi.org/10.1016/j.gene.2014.05.071 0378-1119/© 2014 Published by Elsevier B.V.
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Q2 39
51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131
F O
132 133 134 135 136 137 138 139 140 141 142 143 144 145 146
After providing written standardized consent and informing patients clearly, blood samples were collected from in-risk couples attended to Genome Clinical Laboratory, Isfahan, Iran (over the course of three years) in order to determine genetic status of their fetuses for beta thalassemia mutations. Moreover, chorionic villus sampling (CVS) method was used to collect samples of fetuses at 10–12 weeks of gestation. We were provided with 94 specimens who were initially candidates to have IVS-II-I mutation based on RFLP screening method, routinely done by Genome laboratory protocol. This protocol is carried out to categorize samples into 8 groups according to common identified beta-thalassemia mutations, by which 94 cases were related to the group comprising normal cases or one of IVS-II-I, Cd-22, Cd-82/83, IVS-I-110 and FSC-8/9 mutations. Generally, this protocol was used to limit samples susceptible to carry IVS-II-I mutation in order to construct statistical population for further analyses by sequencing as a gold standard technique, conventional ARMS PCR and Tetra primer ARMS PCR methods. 5 cm3 of peripheral blood was taken from individuals in blood sampling and then, they were immediately collected in tubes containing EDTA.
147
2.2. DNA extraction
166
The standard method of salting out was used for leukocyte genomic DNA extraction from blood samples (Miller et al., 1988). DNA extraction of CVS samples was completely performed according to high pure PCR template preparation kit instructions (Roche, Germany). After proving the quality and quantity of extracted DNAs using ethidium bromide stained agarose gel electrophoresis and nano-drop instrument (Thermo Scientific, French), the samples were stored in −20 °C.
167 168
2.3. Sequencing method
174
Following PCR amplification, direct sequencing of IVS-II-I mutation was performed using primers including forward: 5′ CTGAGGGTTTGA AGTCCAACTCC3′ and reverse: 5′ CTGTACCCTGTTACTTCTCCCCTTC3′. All sequencing results were visualized and analyzed using Chromas Lite software.
175
2.4. Conventional ARMS PCR method
180
Conventional ARMS PCR technique was conducted by optimized primers (Najmabadi et al., 2001) in a final volume of 25 μl containing 2.5 μl buffer, 0.75 μl MgCl2 (50 mM), 0.5 μl dNTP (10 mM), 0.2 μl Taq DNA polymerase (U) and appropriate amount of primers. The amplification conditions included an initial denaturation for 4 min in 94 °C and 30 cycles consisted of 60 s in 94 °C, 60 s in 67 °C, 90 s in 72 °C followed by final extension of 3 min in 72 °C. The expected product length for amplification of mutant and wild alleles is 800 bp.
181
R O
87 88
2.1. Patient and samples
P
85 86
2. Material and methods
D
83 84
et al., 1992). Recently, we successfully optimized Tetra primer ARMS PCR method for genotyping IVS-II-I mutation (Motovali-Bashi et al., underpublished data). However, there is a little information about sensitivity, specificity and accuracy of this method for detecting IVS-II-I mutation, which is one of the most prevalent beta thalassemia mutations, in comparison with other current in used techniques. In this study, the conventional ARMS PCR and T-ARMS PCR methods were performed for genotyping IVS-II-I (GNA) in different specimens including control, minor and major beta-thalassemia in order to investigate sensitivity, specificity and accuracy of Tetra primer ARMS PCR method; and then, their outcomes were compared with each other and also with sequencing results as a basic and routine technique for detecting beta-thalassemia and determining the kind of mutation.
T
81 82
C
79 80
E
77 78
R
75 76
R
73 74
O
72
C
70 71
N
68 69
beta-thalassemia in Isfahan province of Iran caused by IVS-II-I mutation was accounted for 28% of cases which was the most prevalent mutation in this province (Derakhshandeh-Peykar et al., 2008). In 1981, Shander and colleagues showed for the first time that IVS-II-I is a β0 single nucleotide G→A mutation, which occurs in second intervening sequence (IVSII) position 1 of beta globin gene and could completely inactivate IVS-II 5′-splice site; therefore, produce at least two types of abnormally spiced cytoplasmic RNA, neither of them encodes normal beta globin protein (Shander et al., 1981; Treisman et al., 1982). Although there are some methods including RFLP, conventional ARMS PCR and sequencing used for genotyping and also identifying of betathalassemia mutations (Mamotte, 2006; Mueller and Wolfenbarger, 1999; Ragoussis, 2009; Romkes and Buch, 2005), each technique still has conspicuous drawbacks and sore points; thus, finding a technically simple and affordable method benefiting from high sensitivity and accuracy for screening purposes is crucial and one of the challenging problems in genetic diagnostic laboratories. The sequencing method is the most reliable and precise technique for detecting mutations, but it is almost expensive and requires post-PCR multiple steps, i.e. cycle sequencing and gel electrophoresis. The sequencing results are also compulsory to be proved by another method for final detection in clinical laboratories (Cotton, 1993; Wong et al., 1987). RFLP method has various technical limitations such as price, availability of enzymes and also its dependency to restriction sites. Incomplete and/or partial digestion is the other disadvantage of RFLP method resulting in false negative or false positive outcomes. In comparison with RFLP method, conventional ARMS PCR technique is more economical and is emancipated of technical limitations, but generally, the detection of mutations by this procedure is low-accurate. Since mutant and wild type specific primers have only one mismatch nucleotide in 3′ end, these primers can anneal and work interchangeably. This is the main reason for low efficiency of conventional ARMS PCR technique. Other drawbacks of this technique are due to the performance of mutant and wild type PCR reactions in separate vials and also lack of observation of control bond (Newton et al., 1989; Teimourian et al., 2001). The Tetra-primer ARMS-PCR method has been introduced as a combination of certain principles of the Tetra-primer PCR (Ye et al., 1992) and the ARMS technique (Newton et al., 1989). This technique consists of a PCR reaction followed by an electrophoresis analysis on agarose gels. The PCR reaction is characteristic due to performance of amplification in only one vial using 2 pairs of specific primers. One set of primers (inner primers) is designed and specific for polymorphism region, while the other set (outer primers) propagates control bond in PCR reaction. Inner primers, specific for mutant and wild type alleles, are opposite of each other in terms of annealing orientation. Since the PCR reaction is performed in only one vial along with 2 outer and 2 inner primers, different products with different lengths can be made which will be distinguishable based on their size on gel electrophoresis followed by DNA staining. The probable bonds are due to propagation of area between annealing regions of outer primers (outer–outer), or the area between one outer and one inner primer (outer–inner). In contrast to conventional ARMS PCR method which has only one mismatch base, T-ARMS PCR benefits from two inner primers with another mismatch located at 2 nucleotides remained to the 3′ end. The rules for generating the second mismatch nucleotide at desired position in inner primers used in T-ARMS PCR method have been described as: strong mismatches including G/A or C/T at the 3′ end of specific primers should be followed with a feeble second mismatch (C/A or C/T) and conversely, while median mismatches including A/A or C/C or G/G or T/T at 3′ end should be followed by another median second mismatch (Little, 1997). In recent years, T-ARMS PCR method was used routinely for identifying of mutations and polymorphisms resulting in various diseases. Many attempts have been conducted for increasing T-ARMS PCR method preciseness and efficiency in order to genotype diverse mutations in an optimized and validated manner (Hashemi et al., 2012; Lajin et al., 2012; Muñoz et al., 2009; Piccioli et al., 2006; Shariati et al., 2008; Ye
U
66 67
M.A. Honardoost et al. / Gene xxx (2014) xxx–xxx
E
2
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165
169 170 171 172 173
176 177 178 179
182 183 184 185 186 187 188
M.A. Honardoost et al. / Gene xxx (2014) xxx–xxx
2.6. Statistical analysis
200 201
204 205
Analyses were done using Statistical Package for Social Sciences version 20 (SPSS Inc., Chicago, IL, USA) and MedCalc version 10.2.0.0. Measurements of sensitivity, specificity, and accuracy were used for the population sample to determine validity. The Kappa statistics was used for agreement between two methods. P-values less than 0.05 were considered significant.
206
3. Results
207
3.1. Gold standard sequencing for genotyping of IVS-II-I
208 209
Out of 94 candidate samples, 51 cases including 49 heterozygotes (30 couples and 19 fetuses) and 2 homozygotes (all fetuses) were detected to
219
In order to compare specificity, sensitivity and accuracy of conventional and Tetra primer ARMS PCR, these two techniques were used to genotype 57 cases which were selected based on sequencing analysis. According to conventional ARMS PCR method, there were only four discordant results in comparison with sequencing outcomes. This inconsistency was related to 4 out of 6 normal fetal samples mistakenly detected as heterozygote (Table 1). Based on Tetra primer ARMS PCR method, there were no discordant outcomes comparing with sequencing technique (Table 2). The conventional ARMS PCR results of 5 normal, 5 heterozygous and 2 homozygous samples are shown in Fig. 2, in which 2 of 5 control samples (lanes 5–6 and 9–10) represent heterozygous pattern. The T-ARMS PCR results for 5 controls, 5 heterozygous and 2 homozygous samples are illustrated in Fig. 3 without any discordance.
220 221
E T C E R R
202 203
3.2. IVS-II-I genotyping with conventional and Tetra primer ARMS PCR
N C O
195 196
U
194
F
199
192 193
O
197 198
T-ARMS PCR technique was performed using recently optimized primers and conditions in a final volume of 25 μl including 3.5 μl buffer, 3 μl MgCl2 (50 mM), 1.5 μl dNTP (10 mM), 0.4 μl Taq DNA polymerase and adequate amount of primers (Motovali-Bashi et al., underpublished data). The amplification conditions included an initial denaturation for 5 min in 95 °C and 30 cycles consisted of 30 s in 95 °C, 40 s in 68 °C, 60 s in 72 °C followed by final extension of 10 min in 72 °C. The expected PCR product lengths for control, wild type and mutant bands were 391 bp, 268 bp and 172 bp respectively.
210 211
R O
190 191
convey IVS-II-I mutation based on sequencing analysis. Furthermore, there were 6 fetal cases lacking IVS-II-I mutation, while their parents belonged to 49 studied heterozygote group. These 57 cases were analyzed in order to compare specificity, sensitivity and accuracy of conventional and Tetra primer ARMS PCR methods in detecting and genotyping of IVS-II-I mutation. Three different sequencing results of IVS-II-I including control (case number 11 — Fig. 1-A), homozygous (case number 8 — Fig. 1-B) and heterozygous (case number 1 — Fig. 1-C) are shown in Fig. 1.
P
2.5. Tetra primer ARMS PCR method
D
189
3
Fig. 1. Results of sequencing of IVS-II-I mutation for three different individual including control case (1-A), homozygous (1-B) and heterozygous (1-C). The presence of two picks at mutation site (red box) indicates the heterozygous sample (1-C), while one pick represents normal and mutant homozygous samples (1-A and 1-B).
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
212 213 214 215 216 217 218
222 223 224 225 226 227 228 229 230 231 232 233
4 t1:1 t1:2 t1:3 t1:4
M.A. Honardoost et al. / Gene xxx (2014) xxx–xxx
Table 1 Comparison of IVS II-I mutation genotyping results of sequencing and conventional ARMS PCR methods for 57 selected samples. There were 4 discordant cases in conventional ARMS PCR results related to 4 out of 6 normal fetal samples mistakenly detected as heterozygote. Diagnostic test
Conventional ARMS PCR
t1:5 t1:6 t1:7 t1:8 t1:9
Gold standard sequencing
Heterozygote Homozygote (mutant) Homozygote (normal)
Total
Heterozygote
Homozygote (mutant)
Homozygote (normal)
49 0 4 53
0 2 0 2
0 0 2 2
49 2 6 57
234 235
3.3. Statistical comparison of specificity, sensitivity and accuracy of conventional and Tetra primer ARMS PCR methods
236
246
Conventional ARMS PCR and T-ARMS PCR results were compared with sequencing outcomes separately and specificity, sensitivity and accuracy were statistically measured for each of the methods. Although conventional ARMS PCR and T-ARMS PCR methods showed the same specificity (100%), sensitivity and accuracy were different in a way that conventional ARMS PCR represented 92.45% sensitivity and 92.7% accuracy, while both criteria were 100% in T-ARMS PCR method (Table 3). Furthermore, Kappa test showed an almost perfect agreement between T-ARMS PCR and gold standard methods (κ = 1), whereas there was a moderate agreement between conventional ARMS PCR and sequencing results (κ = 0.471).
247
4. Discussion
248 249
270 271
Beta thalassemia, an autosomal recessive disorder, is considered as one of the most prevalent genetic diseases, especially in Iran. Approximately 200 different mutations, related to onset of the disease, have been identified in the various regions of the β-globin gene since a national screening platform has started to control the marriage of highrisk couples and birth of β0/β0 fetuses (Giardine et al., 2007). Around 20 different mutations have been introduced as the common mutations in Iran, with different rates in diverse cities across the country. As it is reported by Najmabadi et al., IVS-II-I mutation is the most rampant mutation in Iran, especially in central areas with prevalence of 34% (Najmabadi et al., 2001). Furthermore, another study conducted by Derakhshandeh-Peykar et al. in Isfahan population reported prevalence of 28% for IVS-II-I mutation introduced it as the most prevalent mutation in this province (Derakhshandeh-Peykar et al., 2008). Currently, detection and screening of high risk couples and fetuses should be performed in the genetic laboratories across the country, based on national screening platform. This platform clearly emphasizes on detection of any β-globin mutation by at least two molecular methods which has to be followed by third technique in a condition that former methods show different results. RFLP-PCR, conventional ARMS PCR and sequencing methods are currently using molecular techniques for genotyping of beta-thalassemia mutations in most of genetic laboratories; however each technique still has its own disadvantages and sore points. Although sequencing is the most reliable and precise
t2:1 t2:2 t2:3
Table 2 Comparison of IVS II-I mutation genotyping results of sequencing and Tetra primer ARMS PCR methods for 57 selected samples. No discordance was observed using tetra primer ARMS PCR methods.
256 257 258 259 260 261 262 263 264 265 266 267 268 269
t2:4
F
O
R O
P
D
Diagnostic test
Tetra primer ARMS PCR
t2:5 t2:6 t2:7 t2:8 t2:9
E
T
C
254 255
E
252 253
R
250 251
R
244 245
O
242 243
C
241
N
239 240
U
237 238
method for detecting mutations, it is not costly effective and also it requires post-PCR multiple steps, i.e. cycle sequencing and gel electrophoresis. Furthermore, sequencing results are also compulsory to be approved by another method for final detection in clinical laboratories. RFLP-PCR method is accurate but expensive and in contrast, conventional ARMS PCR method is regarded as low-cost but not markedly accurate method. Consequently, finding a technically simple and affordable method possessing high sensitivity and accuracy for screening purposes is crucially desirable of all genetic laboratories. Recently, we optimized Tetra primer ARMS-PCR for genotyping IVS II-I mutation in beta thalassemia patients. We conducted this study to investigate sensitivity, specificity and accuracy of Tetra primer ARMSPCR method compared with conventional ARMS PCR based on sequencing, as a gold standard method. Among 57 selected cases according to sequencing results, consisting of 49 heterozygote, 2 homozygote and 6 normal samples, only four discordances between conventional and Tetra primer ARMS PCR method outcomes were observed. All of the discordant results were related to the 6 normal cases, in which conventional ARMS PCR method was only able to detect two of them correctly, while another 4 cases were incorrectly identified as heterozygote and showed lower specificity of conventional ARMS PCR comparing with Tetra primer ARMS-PCR which detected all 6 normal cases correctly. These results clearly show that conventional ARMS PCR method has lower sensitivity and accuracy in comparison with Tetra primer ARMSPCR, specifically to distinguish normal and heterozygote cases. However, there was not any difference between specificity of methods used in this study. Interestingly, all of these 6 normal specimens were fetus cases with high-risk parents; therefore, it is suggested that false detections obtained by conventional ARMS PCR method might lead to detrimental consequences and serious problems for both parents and national health care system. There are various challenges in extraction of DNA from CVS samples comparing with extraction of DNA from blood specimens and there is the possibility of maternal contamination in extracted DNA form CVS samples, The defect of conventional ARMS PCR method in detection of normal and heterozygote cases in fetuses cannot be due to the unwanted maternal DNA contamination as heterozygous status was not detected by sequencing method in these cases. Therefore, the only probable reason for observed discordance is emanated from lower sensitivity and preciseness of conventional ARMS PCR method which is due to only one mismatch base at 3′ of primers. In fact, this single mispaired base is not adequately efficient to distinguish mutant and normal alleles
Gold standard sequencing
Heterozygote Homozygote (mutant) Homozygote (normal)
Total
Heterozygote
Homozygote (mutant)
Homozygote (normal)
49 0 0 49
0 2 0 2
0 0 6 6
49 2 6 57
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313
M.A. Honardoost et al. / Gene xxx (2014) xxx–xxx
5
Fig. 2. Conventional ARMS PCR results of 5 controls, 5 heterozygous and 2 homozygous samples. From left to right, the first 10 lanes contain PCR products of control samples, followed by samples of heterozygous patients (lanes 10 to 20) and finally 4 last lanes belong to two homozygous samples based on sequencing results. The last lane is allotted to 100 bp marker. Each two adjacent lanes stand for one sample due to performing PCR in two vials with normal and mutant forward primers respectively. Lanes 5–6 and 9–10 belonging to control cases (red arrows) have shown heterozygous pattern with two false bands. Two similar discordant between conventional ARMS PCR and sequencing results were also observed (not shown).
325 326 327 328 329 330 331 332 333 334 335 336
391 bp 268 bp 172 bp
N C O
R
R
337 338 Q3
U
Fig. 3. Tetra Primer ARMS PCR results of five controls, five heterozygous and two homozygous samples. From left to right, first 5 lanes belong to control cases, followed by five lanes of heterozygous samples and two last lanes of homozygous samples based on sequencing results. The last lane contains 100 bp markers. All genotyping results with T-ARMS PCR method were consistent with results of sequencing method. Four cases which represented false mutant band when they were genotyped with conventional ARMS PCR method (from left to right lanes 2, 3, 4 and 5 in this figure) did not show false mutant bands genotyping whit T-AMRS PCR method. t3:1 t3:2 t3:3 t3:4
Table 3 Statistical analysis of accuracy, sensitivity, specificity and kappa agreement coefficient of Tetra primer ARMS PCR and conventional ARMS PCR methods' results based on gold standard sequencing method for genotyping of IVS II-I mutation in beta globin gene.
t3:5
Parameters
Tetra primer ARMS PCR
Conventional ARMS PCR
t3:6 t3:7 t3:8 t3:9
Accuracy (%) Sensitivity (%) Specificity (%) Kappa agreement coefficienta
100 100 100 1
92.7 92.45 100 0.471
t3:10
a
Kappa agreement coefficient was calculated with confidence interval (CI) of 95%.
F
346
R O
O
References
Cotton, R., 1993. Current methods of mutation detection. Mutat. Res. Fundam. Mol. Mech. Mutagen. 285, 125–144. Derakhshandeh-Peykar, P., Hourfar, H., Heidari, M., Kheirollahi, M., Miryounesi, M., 2008. The spectrum of β-thalassemia mutations in Isfahan Province of Iran. Iran. J. Public Health 37. Galanello, R., Origa, R., 2010. Review: beta-thalassemia. Orphanet J. Rare Dis. 5. Giardine, B., van Baal, S., Kaimakis, P., Riemer, C., Miller, W., Samara, M., Kollia, P., Anagnou, N.P., Chui, D.H., Wajcman, H., 2007. HbVar database of human hemoglobin variants and thalassemia mutations: 2007 update. Hum. Mutat. 28, 206-206. Hashemi, M., Moazeni-roodi, A., Bahari, A., Taheri, M., 2012. A tetra-primer amplification refractory mutation system-polymerase chain reaction for the detection of rs8099917 IL28B genotype. Nucleosides Nucleotides Nucleic Acids 31, 55–60. Lajin, B., Alachkar, A., Alhaj Sakur, A., 2012. Triplex tetra-primer ARMS-PCR method for the simultaneous detection of MTHFR c. 677CNT and c. 1298ANC, and MTRR c. 66ANG polymorphisms of the folate–homocysteine metabolic pathway. Mol. Cell. Probes 26, 16–20. Little, S., 1997. ARMS Analysis of Point Mutations. Laboratory Methods for the Detection of Mutations and Polymorphisms in DNA. pp. 45–51. Mamotte, C.D., 2006. Genotyping of single nucleotide substitutions. Clin. Biochem. Rev. 27, 63. Miller, S., Dykes, D., Polesky, H., 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16, 1215. Mueller, U.G., Wolfenbarger, L.L., 1999. AFLP genotyping and fingerprinting. Trends Ecol. Evol. 14, 389–394. Muñoz, C., Gómez Talquenca, S., Volpe, M.L., 2009. Tetra primer ARMS-PCR for identification of SNP in β-tubulin of Botrytis cinerea responsible of resistance to benzimidazole. J. Microbiol. Methods 78, 245–246. Najmabadi, H., Karimi-Nejad, R., Sahebjam, S., Pourfarzad, F., Teimourian, S., Sahebjam, F., Amirizadeh, N., Karimi-Nejad, M.H., 2001. The β-thalassemia mutation spectrum in the Iranian population. Hemoglobin 25, 285–296. Newton, C., Graham, A., Heptinstall, L., Powell, S., Summers, C., Kalsheker, N., Smith, J., Markham, A., 1989. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res. 17, 2503–2516. Piccioli, P., Serra, M., Gismondi, V., Pedemonte, S., Loiacono, F., Lastraioli, S., Bertario, L., De Angioletti, M., Varesco, L., Notaro, R., 2006. Multiplex tetra-primer amplification refractory mutation system PCR to detect 6 common germline mutations of the MUTYH gene associated with polyposis and colorectal cancer. Clin. Chem. 52, 739–743. Ragoussis, J., 2009. Genotyping technologies for genetic research. Annu. Rev. Genomics Hum. Genet. 10, 117–133. Romkes, M., Buch, S.C., 2005. Genotyping Technologies, Molecular Toxicology Protocols. Springer, pp. 399–414. Shander, M., Vande Woude, S., Proudfoot, N., Maniatis, T., 1981. Molecular basis of genetic defects in human globin genes. J. Supramol. Struct. Cell. Biochem. (Suppl. 5), 229. Shariati, S.A.M., Behmanesh, M., Galehdari, H., Fathian, A., 2008. Multiplex tetra-primer amplification refractory mutation system polymerase chain reaction to genotype SNP8NRG221533 of Neuregulin-1 gene. Iran. J. Biotechnol. IJB 6. Teimourian, S., Khatibi, T., Pourfarzad, F., Jalil-Nejad, S., Azad, M., 2001. Amplification Refractory Mutation System (ARMS) and reverse hybridization in the detection of beta-thalassemia mutations. Arch. Iran. Med. 4, 165. Treisman, R., Proudfoot, N.J., Shander, M., Maniatis, T., 1982. A single-base change at a splice site in a β0−thalassemic gene causes abnormal RNA splicing. Cell 29, 903–911. Wong, C., Dowling, C.E., Saiki, R.K., Higuchi, R.G., Erlich, H.A., Kazazian, H.H., 1987. Characterization of β-thalassaemia mutations using direct genomic sequencing of amplified single copy DNA. Nature 330, 384–386. Ye, S., Humphries, S., Green, F., 1992. Allele specific amplification by tetra-primer PCR. Nucleic Acids Res. 20, 1152-1152.
P
323 324
340
D
321 322
This study was performed at the Genome laboratory and financially supported by the Vice-Chancellery for Education Office of the Medical University of Isfahan; we would like to sincerely appreciate Mrs. Farzaneh Hoseini and Miss Negin Ghazavi from the Genome laboratory for their comprehensive assistance in collecting the samples and the related information.
E
319 320
339
Acknowledgment
T
317 318
C
316
especially in the presence of maternal DNA contamination, while discrimination of alleles in Tetra primer ARMSPCR method is based on two mismatched bases (one at 3′ end and another extra mismatch at −2 position of 3′ end of primers) that make this approach more accurate and sensitive. Currently, instead of RFLP, most of the genetic laboratories prefer to use conventional ARMS PCR method as a second approach for genotyping beta-thalassemia mutations; however this technique still has some drawbacks including lacking of control band which is important for confirming the correct conditions of PCR, and difficulties of performing reactions in two separated vials. In addition, our results clearly showed for the first time that compared to Tetra primer ARMS-PCR method, conventional ARMS PCR has poorer specificity in recognizing and distinguishing normal and heterozygote samples in genotyping of IVSII-I mutation. In conclusion, to our knowledge and for the first time, we compared specificity, sensitivity and accuracy of conventional ARMS PCR with Tetra primer ARMS PCR method for genotyping IVS II-I mutation of beta thalassemia based on sequencing method results. Our results clearly revealed poorer sensitivity and accuracy of conventional ARMS PCR method, specifically for discriminating normal and heterozygote specimens, in comparison with Tetra primer ARMS PCR technique. Therefore, it is strongly suggested that conventional ARMS PCR method could be replaced by optimized Tetra primer ARMS-PCR technique for genotyping of IVS-II-I mutation in beta thalassemia patients.
E
314 315
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
341 Q4 342 343 344 345
347 348 349 350 351 352 353 Q5 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 Q6 402
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
5Q1
Mohammad Amin Honardoost a, Hosein Tabatabaeian b, Mojtaba Akbari c, Mansoor Salehi c,⁎
O
R O
6 7 8
a
9
a r t i c l e
20 10 11 12 13 14
Article history: Received 11 November 2013 Received in revised form 11 May 2014 Accepted 30 May 2014 Available online xxxx
15 16 17 18 19
Keywords: Beta thalassemia Conventional ARMS PCR Sequencing Tetra primer ARMS PCR
P
i n f o
a b s t r a c t
Purpose: Beta thalassemia is one of the most important hematic diseases all around the world and solving the problems caused by this abnormality is strongly dependent on precise detection and reliable screening of high-risk couples. The aim of our study was the investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method comparing with conventional ARMS PCR, based on sequencing technique outcomes for genotyping of IVS-II-I mutation in beta thalassemia patients. Methods: Fifty seven samples including two homozygote, 49 heterozygote and 6 normal specimens were analyzed by Tetra primer ARMS PCR and conventional ARMS PCR methods. DNA was extracted by the standard method of salting out for leukocyte genomic DNA extraction of blood specimens and a high pure PCR template preparation kit was used for DNA purification of CVS samples. The results obtained by Tetra primer ARMS PCR and conventional ARMS PCR methods were compared with gold standard technique, i.e. sequencing. Results: All three parameters including specificity, sensitivity and accuracy were 100% for Tetra primer ARMS PCR method, while they were 100%, 92.45% and 92.7% for conventional ARMS PCR technique respectively. Comparing with Tetra primer ARMS PCR which represented 100% agreement with sequencing method, conventional ARMS PCR technique only showed 47.1% agreement, because of 4 discordant results. Conclusion: Tetra primer ARMS PCR method is an almost reliable, sensitive and accurate technique and it is suggested that it can be used as a complementary method for diagnostic cases instead of conventional ARMS PCR method. This suggestion originated with perfect rate of agreement between outcomes of sequencing method, as a gold standard method of detecting the mutations, and Tetra primer ARMS PCR technique comparing with conventional ARMS PCR method. © 2014 Published by Elsevier B.V.
43 41 40 42
T
N C O
R
R
E
c
Division of Cellular and Molecular Biology, Department of Biology, Faculty of Sciences, University of Isfahan, Isfahan, Iran Genetics Division, Biology Department, Faculty of Sciences, University of Isfahan, Isfahan, Iran School of Medicine, Isfahan University of Medical Science, Isfahan, Iran
C
b
D
3
E
2
F
4
Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR, based on sequencing technique outcomes in IVS-II-I genotyping of beta thalassemia patients
1
1. Introduction
45
Beta-thalassemia syndromes refer to a category of hemoglobin abnormalities caused by mutations in the b-globin gene. These various mutations can result in reduction or loss of b-globin chain synthesis, called β+ mutations and β0 mutations respectively (Galanello and Origa, 2010). Beta-thalassemia, a monogenic autosomal recessive disease, is comparatively prevalent worldwide, but it is regarded rampant
46 47 48 49 50
U
44
Abbreviations: PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; ARMS, amplification refractory mutation system; T-ARMS, Tetra primer ARMS. ⁎ Corresponding author at: Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan 81744-176, Iran. E-mail addresses: [email protected] (M.A. Honardoost), [email protected] (H. Tabatabaeian), [email protected] (M. Akbari), [email protected] (M. Salehi).
in the Middle East, especially Iran. The global average associated with carriers of beta-thalassemia is close to 3%, while it is 5% for Iranian population (Najmabadi et al., 2001). The accurate detection and screening of highrisk couples could lead to improvements of the beta-thalassemia complications. So far, approximately 200 different mutations in the divers regions of the b-globin gene have been reported which are related to onset of the disease (Giardine et al., 2007). Almost 20 different mutations are introduced as common mutations in Iran, with various incidence rates in cities across the country (Derakhshandeh-Peykar et al., 2008; Najmabadi et al., 2001). The frequency of common mutations in Iran was first identified by Najmabadi et al. as the following statistics: 34% for IVS-II-I, 4.76% for FSC-8/9 (+ G), 7.55% for IVS-I-5 (GC), 3% for FSC-36/37 (− T) and 4.76% for IVS-I-110 (GA) (Najmabadi et al., 2001). In 2008, Derakhshandeh-Peykar et al. showed that the incidence rate of
http://dx.doi.org/10.1016/j.gene.2014.05.071 0378-1119/© 2014 Published by Elsevier B.V.
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Q2 39
51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131
F O
132 133 134 135 136 137 138 139 140 141 142 143 144 145 146
After providing written standardized consent and informing patients clearly, blood samples were collected from in-risk couples attended to Genome Clinical Laboratory, Isfahan, Iran (over the course of three years) in order to determine genetic status of their fetuses for beta thalassemia mutations. Moreover, chorionic villus sampling (CVS) method was used to collect samples of fetuses at 10–12 weeks of gestation. We were provided with 94 specimens who were initially candidates to have IVS-II-I mutation based on RFLP screening method, routinely done by Genome laboratory protocol. This protocol is carried out to categorize samples into 8 groups according to common identified beta-thalassemia mutations, by which 94 cases were related to the group comprising normal cases or one of IVS-II-I, Cd-22, Cd-82/83, IVS-I-110 and FSC-8/9 mutations. Generally, this protocol was used to limit samples susceptible to carry IVS-II-I mutation in order to construct statistical population for further analyses by sequencing as a gold standard technique, conventional ARMS PCR and Tetra primer ARMS PCR methods. 5 cm3 of peripheral blood was taken from individuals in blood sampling and then, they were immediately collected in tubes containing EDTA.
147
2.2. DNA extraction
166
The standard method of salting out was used for leukocyte genomic DNA extraction from blood samples (Miller et al., 1988). DNA extraction of CVS samples was completely performed according to high pure PCR template preparation kit instructions (Roche, Germany). After proving the quality and quantity of extracted DNAs using ethidium bromide stained agarose gel electrophoresis and nano-drop instrument (Thermo Scientific, French), the samples were stored in −20 °C.
167 168
2.3. Sequencing method
174
Following PCR amplification, direct sequencing of IVS-II-I mutation was performed using primers including forward: 5′ CTGAGGGTTTGA AGTCCAACTCC3′ and reverse: 5′ CTGTACCCTGTTACTTCTCCCCTTC3′. All sequencing results were visualized and analyzed using Chromas Lite software.
175
2.4. Conventional ARMS PCR method
180
Conventional ARMS PCR technique was conducted by optimized primers (Najmabadi et al., 2001) in a final volume of 25 μl containing 2.5 μl buffer, 0.75 μl MgCl2 (50 mM), 0.5 μl dNTP (10 mM), 0.2 μl Taq DNA polymerase (U) and appropriate amount of primers. The amplification conditions included an initial denaturation for 4 min in 94 °C and 30 cycles consisted of 60 s in 94 °C, 60 s in 67 °C, 90 s in 72 °C followed by final extension of 3 min in 72 °C. The expected product length for amplification of mutant and wild alleles is 800 bp.
181
R O
87 88
2.1. Patient and samples
P
85 86
2. Material and methods
D
83 84
et al., 1992). Recently, we successfully optimized Tetra primer ARMS PCR method for genotyping IVS-II-I mutation (Motovali-Bashi et al., underpublished data). However, there is a little information about sensitivity, specificity and accuracy of this method for detecting IVS-II-I mutation, which is one of the most prevalent beta thalassemia mutations, in comparison with other current in used techniques. In this study, the conventional ARMS PCR and T-ARMS PCR methods were performed for genotyping IVS-II-I (GNA) in different specimens including control, minor and major beta-thalassemia in order to investigate sensitivity, specificity and accuracy of Tetra primer ARMS PCR method; and then, their outcomes were compared with each other and also with sequencing results as a basic and routine technique for detecting beta-thalassemia and determining the kind of mutation.
T
81 82
C
79 80
E
77 78
R
75 76
R
73 74
O
72
C
70 71
N
68 69
beta-thalassemia in Isfahan province of Iran caused by IVS-II-I mutation was accounted for 28% of cases which was the most prevalent mutation in this province (Derakhshandeh-Peykar et al., 2008). In 1981, Shander and colleagues showed for the first time that IVS-II-I is a β0 single nucleotide G→A mutation, which occurs in second intervening sequence (IVSII) position 1 of beta globin gene and could completely inactivate IVS-II 5′-splice site; therefore, produce at least two types of abnormally spiced cytoplasmic RNA, neither of them encodes normal beta globin protein (Shander et al., 1981; Treisman et al., 1982). Although there are some methods including RFLP, conventional ARMS PCR and sequencing used for genotyping and also identifying of betathalassemia mutations (Mamotte, 2006; Mueller and Wolfenbarger, 1999; Ragoussis, 2009; Romkes and Buch, 2005), each technique still has conspicuous drawbacks and sore points; thus, finding a technically simple and affordable method benefiting from high sensitivity and accuracy for screening purposes is crucial and one of the challenging problems in genetic diagnostic laboratories. The sequencing method is the most reliable and precise technique for detecting mutations, but it is almost expensive and requires post-PCR multiple steps, i.e. cycle sequencing and gel electrophoresis. The sequencing results are also compulsory to be proved by another method for final detection in clinical laboratories (Cotton, 1993; Wong et al., 1987). RFLP method has various technical limitations such as price, availability of enzymes and also its dependency to restriction sites. Incomplete and/or partial digestion is the other disadvantage of RFLP method resulting in false negative or false positive outcomes. In comparison with RFLP method, conventional ARMS PCR technique is more economical and is emancipated of technical limitations, but generally, the detection of mutations by this procedure is low-accurate. Since mutant and wild type specific primers have only one mismatch nucleotide in 3′ end, these primers can anneal and work interchangeably. This is the main reason for low efficiency of conventional ARMS PCR technique. Other drawbacks of this technique are due to the performance of mutant and wild type PCR reactions in separate vials and also lack of observation of control bond (Newton et al., 1989; Teimourian et al., 2001). The Tetra-primer ARMS-PCR method has been introduced as a combination of certain principles of the Tetra-primer PCR (Ye et al., 1992) and the ARMS technique (Newton et al., 1989). This technique consists of a PCR reaction followed by an electrophoresis analysis on agarose gels. The PCR reaction is characteristic due to performance of amplification in only one vial using 2 pairs of specific primers. One set of primers (inner primers) is designed and specific for polymorphism region, while the other set (outer primers) propagates control bond in PCR reaction. Inner primers, specific for mutant and wild type alleles, are opposite of each other in terms of annealing orientation. Since the PCR reaction is performed in only one vial along with 2 outer and 2 inner primers, different products with different lengths can be made which will be distinguishable based on their size on gel electrophoresis followed by DNA staining. The probable bonds are due to propagation of area between annealing regions of outer primers (outer–outer), or the area between one outer and one inner primer (outer–inner). In contrast to conventional ARMS PCR method which has only one mismatch base, T-ARMS PCR benefits from two inner primers with another mismatch located at 2 nucleotides remained to the 3′ end. The rules for generating the second mismatch nucleotide at desired position in inner primers used in T-ARMS PCR method have been described as: strong mismatches including G/A or C/T at the 3′ end of specific primers should be followed with a feeble second mismatch (C/A or C/T) and conversely, while median mismatches including A/A or C/C or G/G or T/T at 3′ end should be followed by another median second mismatch (Little, 1997). In recent years, T-ARMS PCR method was used routinely for identifying of mutations and polymorphisms resulting in various diseases. Many attempts have been conducted for increasing T-ARMS PCR method preciseness and efficiency in order to genotype diverse mutations in an optimized and validated manner (Hashemi et al., 2012; Lajin et al., 2012; Muñoz et al., 2009; Piccioli et al., 2006; Shariati et al., 2008; Ye
U
66 67
M.A. Honardoost et al. / Gene xxx (2014) xxx–xxx
E
2
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165
169 170 171 172 173
176 177 178 179
182 183 184 185 186 187 188
M.A. Honardoost et al. / Gene xxx (2014) xxx–xxx
2.6. Statistical analysis
200 201
204 205
Analyses were done using Statistical Package for Social Sciences version 20 (SPSS Inc., Chicago, IL, USA) and MedCalc version 10.2.0.0. Measurements of sensitivity, specificity, and accuracy were used for the population sample to determine validity. The Kappa statistics was used for agreement between two methods. P-values less than 0.05 were considered significant.
206
3. Results
207
3.1. Gold standard sequencing for genotyping of IVS-II-I
208 209
Out of 94 candidate samples, 51 cases including 49 heterozygotes (30 couples and 19 fetuses) and 2 homozygotes (all fetuses) were detected to
219
In order to compare specificity, sensitivity and accuracy of conventional and Tetra primer ARMS PCR, these two techniques were used to genotype 57 cases which were selected based on sequencing analysis. According to conventional ARMS PCR method, there were only four discordant results in comparison with sequencing outcomes. This inconsistency was related to 4 out of 6 normal fetal samples mistakenly detected as heterozygote (Table 1). Based on Tetra primer ARMS PCR method, there were no discordant outcomes comparing with sequencing technique (Table 2). The conventional ARMS PCR results of 5 normal, 5 heterozygous and 2 homozygous samples are shown in Fig. 2, in which 2 of 5 control samples (lanes 5–6 and 9–10) represent heterozygous pattern. The T-ARMS PCR results for 5 controls, 5 heterozygous and 2 homozygous samples are illustrated in Fig. 3 without any discordance.
220 221
E T C E R R
202 203
3.2. IVS-II-I genotyping with conventional and Tetra primer ARMS PCR
N C O
195 196
U
194
F
199
192 193
O
197 198
T-ARMS PCR technique was performed using recently optimized primers and conditions in a final volume of 25 μl including 3.5 μl buffer, 3 μl MgCl2 (50 mM), 1.5 μl dNTP (10 mM), 0.4 μl Taq DNA polymerase and adequate amount of primers (Motovali-Bashi et al., underpublished data). The amplification conditions included an initial denaturation for 5 min in 95 °C and 30 cycles consisted of 30 s in 95 °C, 40 s in 68 °C, 60 s in 72 °C followed by final extension of 10 min in 72 °C. The expected PCR product lengths for control, wild type and mutant bands were 391 bp, 268 bp and 172 bp respectively.
210 211
R O
190 191
convey IVS-II-I mutation based on sequencing analysis. Furthermore, there were 6 fetal cases lacking IVS-II-I mutation, while their parents belonged to 49 studied heterozygote group. These 57 cases were analyzed in order to compare specificity, sensitivity and accuracy of conventional and Tetra primer ARMS PCR methods in detecting and genotyping of IVS-II-I mutation. Three different sequencing results of IVS-II-I including control (case number 11 — Fig. 1-A), homozygous (case number 8 — Fig. 1-B) and heterozygous (case number 1 — Fig. 1-C) are shown in Fig. 1.
P
2.5. Tetra primer ARMS PCR method
D
189
3
Fig. 1. Results of sequencing of IVS-II-I mutation for three different individual including control case (1-A), homozygous (1-B) and heterozygous (1-C). The presence of two picks at mutation site (red box) indicates the heterozygous sample (1-C), while one pick represents normal and mutant homozygous samples (1-A and 1-B).
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
212 213 214 215 216 217 218
222 223 224 225 226 227 228 229 230 231 232 233
4 t1:1 t1:2 t1:3 t1:4
M.A. Honardoost et al. / Gene xxx (2014) xxx–xxx
Table 1 Comparison of IVS II-I mutation genotyping results of sequencing and conventional ARMS PCR methods for 57 selected samples. There were 4 discordant cases in conventional ARMS PCR results related to 4 out of 6 normal fetal samples mistakenly detected as heterozygote. Diagnostic test
Conventional ARMS PCR
t1:5 t1:6 t1:7 t1:8 t1:9
Gold standard sequencing
Heterozygote Homozygote (mutant) Homozygote (normal)
Total
Heterozygote
Homozygote (mutant)
Homozygote (normal)
49 0 4 53
0 2 0 2
0 0 2 2
49 2 6 57
234 235
3.3. Statistical comparison of specificity, sensitivity and accuracy of conventional and Tetra primer ARMS PCR methods
236
246
Conventional ARMS PCR and T-ARMS PCR results were compared with sequencing outcomes separately and specificity, sensitivity and accuracy were statistically measured for each of the methods. Although conventional ARMS PCR and T-ARMS PCR methods showed the same specificity (100%), sensitivity and accuracy were different in a way that conventional ARMS PCR represented 92.45% sensitivity and 92.7% accuracy, while both criteria were 100% in T-ARMS PCR method (Table 3). Furthermore, Kappa test showed an almost perfect agreement between T-ARMS PCR and gold standard methods (κ = 1), whereas there was a moderate agreement between conventional ARMS PCR and sequencing results (κ = 0.471).
247
4. Discussion
248 249
270 271
Beta thalassemia, an autosomal recessive disorder, is considered as one of the most prevalent genetic diseases, especially in Iran. Approximately 200 different mutations, related to onset of the disease, have been identified in the various regions of the β-globin gene since a national screening platform has started to control the marriage of highrisk couples and birth of β0/β0 fetuses (Giardine et al., 2007). Around 20 different mutations have been introduced as the common mutations in Iran, with different rates in diverse cities across the country. As it is reported by Najmabadi et al., IVS-II-I mutation is the most rampant mutation in Iran, especially in central areas with prevalence of 34% (Najmabadi et al., 2001). Furthermore, another study conducted by Derakhshandeh-Peykar et al. in Isfahan population reported prevalence of 28% for IVS-II-I mutation introduced it as the most prevalent mutation in this province (Derakhshandeh-Peykar et al., 2008). Currently, detection and screening of high risk couples and fetuses should be performed in the genetic laboratories across the country, based on national screening platform. This platform clearly emphasizes on detection of any β-globin mutation by at least two molecular methods which has to be followed by third technique in a condition that former methods show different results. RFLP-PCR, conventional ARMS PCR and sequencing methods are currently using molecular techniques for genotyping of beta-thalassemia mutations in most of genetic laboratories; however each technique still has its own disadvantages and sore points. Although sequencing is the most reliable and precise
t2:1 t2:2 t2:3
Table 2 Comparison of IVS II-I mutation genotyping results of sequencing and Tetra primer ARMS PCR methods for 57 selected samples. No discordance was observed using tetra primer ARMS PCR methods.
256 257 258 259 260 261 262 263 264 265 266 267 268 269
t2:4
F
O
R O
P
D
Diagnostic test
Tetra primer ARMS PCR
t2:5 t2:6 t2:7 t2:8 t2:9
E
T
C
254 255
E
252 253
R
250 251
R
244 245
O
242 243
C
241
N
239 240
U
237 238
method for detecting mutations, it is not costly effective and also it requires post-PCR multiple steps, i.e. cycle sequencing and gel electrophoresis. Furthermore, sequencing results are also compulsory to be approved by another method for final detection in clinical laboratories. RFLP-PCR method is accurate but expensive and in contrast, conventional ARMS PCR method is regarded as low-cost but not markedly accurate method. Consequently, finding a technically simple and affordable method possessing high sensitivity and accuracy for screening purposes is crucially desirable of all genetic laboratories. Recently, we optimized Tetra primer ARMS-PCR for genotyping IVS II-I mutation in beta thalassemia patients. We conducted this study to investigate sensitivity, specificity and accuracy of Tetra primer ARMSPCR method compared with conventional ARMS PCR based on sequencing, as a gold standard method. Among 57 selected cases according to sequencing results, consisting of 49 heterozygote, 2 homozygote and 6 normal samples, only four discordances between conventional and Tetra primer ARMS PCR method outcomes were observed. All of the discordant results were related to the 6 normal cases, in which conventional ARMS PCR method was only able to detect two of them correctly, while another 4 cases were incorrectly identified as heterozygote and showed lower specificity of conventional ARMS PCR comparing with Tetra primer ARMS-PCR which detected all 6 normal cases correctly. These results clearly show that conventional ARMS PCR method has lower sensitivity and accuracy in comparison with Tetra primer ARMSPCR, specifically to distinguish normal and heterozygote cases. However, there was not any difference between specificity of methods used in this study. Interestingly, all of these 6 normal specimens were fetus cases with high-risk parents; therefore, it is suggested that false detections obtained by conventional ARMS PCR method might lead to detrimental consequences and serious problems for both parents and national health care system. There are various challenges in extraction of DNA from CVS samples comparing with extraction of DNA from blood specimens and there is the possibility of maternal contamination in extracted DNA form CVS samples, The defect of conventional ARMS PCR method in detection of normal and heterozygote cases in fetuses cannot be due to the unwanted maternal DNA contamination as heterozygous status was not detected by sequencing method in these cases. Therefore, the only probable reason for observed discordance is emanated from lower sensitivity and preciseness of conventional ARMS PCR method which is due to only one mismatch base at 3′ of primers. In fact, this single mispaired base is not adequately efficient to distinguish mutant and normal alleles
Gold standard sequencing
Heterozygote Homozygote (mutant) Homozygote (normal)
Total
Heterozygote
Homozygote (mutant)
Homozygote (normal)
49 0 0 49
0 2 0 2
0 0 6 6
49 2 6 57
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313
M.A. Honardoost et al. / Gene xxx (2014) xxx–xxx
5
Fig. 2. Conventional ARMS PCR results of 5 controls, 5 heterozygous and 2 homozygous samples. From left to right, the first 10 lanes contain PCR products of control samples, followed by samples of heterozygous patients (lanes 10 to 20) and finally 4 last lanes belong to two homozygous samples based on sequencing results. The last lane is allotted to 100 bp marker. Each two adjacent lanes stand for one sample due to performing PCR in two vials with normal and mutant forward primers respectively. Lanes 5–6 and 9–10 belonging to control cases (red arrows) have shown heterozygous pattern with two false bands. Two similar discordant between conventional ARMS PCR and sequencing results were also observed (not shown).
325 326 327 328 329 330 331 332 333 334 335 336
391 bp 268 bp 172 bp
N C O
R
R
337 338 Q3
U
Fig. 3. Tetra Primer ARMS PCR results of five controls, five heterozygous and two homozygous samples. From left to right, first 5 lanes belong to control cases, followed by five lanes of heterozygous samples and two last lanes of homozygous samples based on sequencing results. The last lane contains 100 bp markers. All genotyping results with T-ARMS PCR method were consistent with results of sequencing method. Four cases which represented false mutant band when they were genotyped with conventional ARMS PCR method (from left to right lanes 2, 3, 4 and 5 in this figure) did not show false mutant bands genotyping whit T-AMRS PCR method. t3:1 t3:2 t3:3 t3:4
Table 3 Statistical analysis of accuracy, sensitivity, specificity and kappa agreement coefficient of Tetra primer ARMS PCR and conventional ARMS PCR methods' results based on gold standard sequencing method for genotyping of IVS II-I mutation in beta globin gene.
t3:5
Parameters
Tetra primer ARMS PCR
Conventional ARMS PCR
t3:6 t3:7 t3:8 t3:9
Accuracy (%) Sensitivity (%) Specificity (%) Kappa agreement coefficienta
100 100 100 1
92.7 92.45 100 0.471
t3:10
a
Kappa agreement coefficient was calculated with confidence interval (CI) of 95%.
F
346
R O
O
References
Cotton, R., 1993. Current methods of mutation detection. Mutat. Res. Fundam. Mol. Mech. Mutagen. 285, 125–144. Derakhshandeh-Peykar, P., Hourfar, H., Heidari, M., Kheirollahi, M., Miryounesi, M., 2008. The spectrum of β-thalassemia mutations in Isfahan Province of Iran. Iran. J. Public Health 37. Galanello, R., Origa, R., 2010. Review: beta-thalassemia. Orphanet J. Rare Dis. 5. Giardine, B., van Baal, S., Kaimakis, P., Riemer, C., Miller, W., Samara, M., Kollia, P., Anagnou, N.P., Chui, D.H., Wajcman, H., 2007. HbVar database of human hemoglobin variants and thalassemia mutations: 2007 update. Hum. Mutat. 28, 206-206. Hashemi, M., Moazeni-roodi, A., Bahari, A., Taheri, M., 2012. A tetra-primer amplification refractory mutation system-polymerase chain reaction for the detection of rs8099917 IL28B genotype. Nucleosides Nucleotides Nucleic Acids 31, 55–60. Lajin, B., Alachkar, A., Alhaj Sakur, A., 2012. Triplex tetra-primer ARMS-PCR method for the simultaneous detection of MTHFR c. 677CNT and c. 1298ANC, and MTRR c. 66ANG polymorphisms of the folate–homocysteine metabolic pathway. Mol. Cell. Probes 26, 16–20. Little, S., 1997. ARMS Analysis of Point Mutations. Laboratory Methods for the Detection of Mutations and Polymorphisms in DNA. pp. 45–51. Mamotte, C.D., 2006. Genotyping of single nucleotide substitutions. Clin. Biochem. Rev. 27, 63. Miller, S., Dykes, D., Polesky, H., 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16, 1215. Mueller, U.G., Wolfenbarger, L.L., 1999. AFLP genotyping and fingerprinting. Trends Ecol. Evol. 14, 389–394. Muñoz, C., Gómez Talquenca, S., Volpe, M.L., 2009. Tetra primer ARMS-PCR for identification of SNP in β-tubulin of Botrytis cinerea responsible of resistance to benzimidazole. J. Microbiol. Methods 78, 245–246. Najmabadi, H., Karimi-Nejad, R., Sahebjam, S., Pourfarzad, F., Teimourian, S., Sahebjam, F., Amirizadeh, N., Karimi-Nejad, M.H., 2001. The β-thalassemia mutation spectrum in the Iranian population. Hemoglobin 25, 285–296. Newton, C., Graham, A., Heptinstall, L., Powell, S., Summers, C., Kalsheker, N., Smith, J., Markham, A., 1989. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res. 17, 2503–2516. Piccioli, P., Serra, M., Gismondi, V., Pedemonte, S., Loiacono, F., Lastraioli, S., Bertario, L., De Angioletti, M., Varesco, L., Notaro, R., 2006. Multiplex tetra-primer amplification refractory mutation system PCR to detect 6 common germline mutations of the MUTYH gene associated with polyposis and colorectal cancer. Clin. Chem. 52, 739–743. Ragoussis, J., 2009. Genotyping technologies for genetic research. Annu. Rev. Genomics Hum. Genet. 10, 117–133. Romkes, M., Buch, S.C., 2005. Genotyping Technologies, Molecular Toxicology Protocols. Springer, pp. 399–414. Shander, M., Vande Woude, S., Proudfoot, N., Maniatis, T., 1981. Molecular basis of genetic defects in human globin genes. J. Supramol. Struct. Cell. Biochem. (Suppl. 5), 229. Shariati, S.A.M., Behmanesh, M., Galehdari, H., Fathian, A., 2008. Multiplex tetra-primer amplification refractory mutation system polymerase chain reaction to genotype SNP8NRG221533 of Neuregulin-1 gene. Iran. J. Biotechnol. IJB 6. Teimourian, S., Khatibi, T., Pourfarzad, F., Jalil-Nejad, S., Azad, M., 2001. Amplification Refractory Mutation System (ARMS) and reverse hybridization in the detection of beta-thalassemia mutations. Arch. Iran. Med. 4, 165. Treisman, R., Proudfoot, N.J., Shander, M., Maniatis, T., 1982. A single-base change at a splice site in a β0−thalassemic gene causes abnormal RNA splicing. Cell 29, 903–911. Wong, C., Dowling, C.E., Saiki, R.K., Higuchi, R.G., Erlich, H.A., Kazazian, H.H., 1987. Characterization of β-thalassaemia mutations using direct genomic sequencing of amplified single copy DNA. Nature 330, 384–386. Ye, S., Humphries, S., Green, F., 1992. Allele specific amplification by tetra-primer PCR. Nucleic Acids Res. 20, 1152-1152.
P
323 324
340
D
321 322
This study was performed at the Genome laboratory and financially supported by the Vice-Chancellery for Education Office of the Medical University of Isfahan; we would like to sincerely appreciate Mrs. Farzaneh Hoseini and Miss Negin Ghazavi from the Genome laboratory for their comprehensive assistance in collecting the samples and the related information.
E
319 320
339
Acknowledgment
T
317 318
C
316
especially in the presence of maternal DNA contamination, while discrimination of alleles in Tetra primer ARMSPCR method is based on two mismatched bases (one at 3′ end and another extra mismatch at −2 position of 3′ end of primers) that make this approach more accurate and sensitive. Currently, instead of RFLP, most of the genetic laboratories prefer to use conventional ARMS PCR method as a second approach for genotyping beta-thalassemia mutations; however this technique still has some drawbacks including lacking of control band which is important for confirming the correct conditions of PCR, and difficulties of performing reactions in two separated vials. In addition, our results clearly showed for the first time that compared to Tetra primer ARMS-PCR method, conventional ARMS PCR has poorer specificity in recognizing and distinguishing normal and heterozygote samples in genotyping of IVSII-I mutation. In conclusion, to our knowledge and for the first time, we compared specificity, sensitivity and accuracy of conventional ARMS PCR with Tetra primer ARMS PCR method for genotyping IVS II-I mutation of beta thalassemia based on sequencing method results. Our results clearly revealed poorer sensitivity and accuracy of conventional ARMS PCR method, specifically for discriminating normal and heterozygote specimens, in comparison with Tetra primer ARMS PCR technique. Therefore, it is strongly suggested that conventional ARMS PCR method could be replaced by optimized Tetra primer ARMS-PCR technique for genotyping of IVS-II-I mutation in beta thalassemia patients.
E
314 315
Please cite this article as: Honardoost, M.A., et al., Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.071
341 Q4 342 343 344 345
347 348 349 350 351 352 353 Q5 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 Q6 402
