Immunology Letters 164 (2015) 94–99
Contents lists available at ScienceDirect
Immunology Letters journal homepage: www.elsevier.com/locate/immlet
Is there any relationship between polymorphism of Heat Shock Protein 70 genes and Pemphigus foliaceus? Amina Toumi a , O. Abida a , M. Ben-Ayed a , A. Masmoudi b , H. Turki b , H. Masmoudi a,∗ a b
Immunology Department, Habib Bourguiba Hospital, University of Sfax, Sfax, Tunisia Dermatology Department, Hédi Chaker University Hospital, Sfax, Tunisia
a r t i c l e
i n f o
Article history: Received 20 November 2014 Received in revised form 16 January 2015 Accepted 23 January 2015 Available online 14 February 2015 Keywords: Pemphigus foliaceus Heat Shock Protein 70 Gene Polymorphism HLA-DR3 Tunisia
a b s t r a c t The human Heat Shock Proteins (HSP70) family plays a key role in up-regulating stress responses. Some studies reported possible associations of single nucleotide polymorphisms in the HSP70 genes with some autoimmune diseases. However, whether HSP70 polymorphisms represent a risk factor for pemphigus foliaceus (PF) is still unkown. We analyzed by PCR-RFLP polymorphisms of HSP70 genes HSA1A, HSPA1B and HSPA1L in 80 Tunisian patients with PF, 160 matched healthy controls and 147 related healthy subjects. There were significant differences between PF patients and controls in the allelic (pc = 5.91 × 10−12 , pc = 1.14 × 10−5 and pc = 0.0089, respectively) and homozygous genotypic frequencies of HSPA1L>T, HSPA1A>C and HSPA1B>G (p = 2.617 × 10−12 , p = 1.017 × 10−5 and p = 0.0058, respectively). Haplotype analysis showed significant differences between PF patients and controls: the CCA, CGA, CCG and CGG haplotypes were significantly over-represented in controls whereas the TCG haplotype was significantly over-represented in patients. However, the significant LD found between the HSP70 and the HLA class II susceptibility alleles together with the multivariant regression analysis data between the two loci could argue against a direct role of the HSP70 polymorphism in the occurrence of PF. © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
1. Introduction The Heat Shock Protein (HSP) is an interesting molecular chaperone essential for the repair or removal of defective proteins and which is thought to assist in the maintenance of cellular integrity and viability [1–3]. Several representative groups of HSPs (small HSP, HSP60, HSP70, HSP90 and HSP100) have been classified according to their different molecular weights [1]. Moreover, the extracellular HSPs play key roles in the induction of cellular immune responses since these proteins seem to be involved in the antigen processing and presentation. In fact, it has been reported that the binding of uncomplexed HSP molecules to their specific receptors on antigen-presenting cells (APC) induces a pro-inflammatory cytokine secretion from monocytes through a CD14-dependant pathway [4]. HSPs may act as carrier molecules
Abbreviations: PF, Pemphigus foliaceus; SNP, single nucleotide polymorphism; MAF, minor allele frequency; HWE, Hardy-Weinberg equilibrium; OR, odds ratios; LD, linkage disequilibrium. ∗ Corresponding author at: Habib Bourguiba Hospital, Immunology Department, 3029 Sfax, Tunisia. Tel.: +216 98413954. E-mail address: [email protected] (H. Masmoudi).
for immunogenic peptides that are presented on APC to cytotoxic T cells or may themselves act as activatory molecules for the innate immune system [5]. They have been also found to act as a recognition structure for natural killer (NK) cells [6]. On the other hand, the proteins HSP can be expressed during heat shock or in response to a variety of other mechanical or chemical stress stimuli including oxy-radicals and toxic metals [7]. In fact, it has been shown that HSP70 has an anti-oxidative action. Thus, intracellular HSPs support the folding and the transport mechanisms of other proteins under physiological conditions and following physical or chemical stress [8]. The importance of HSP70 in protecting cells from stress-induced apoptosis implicates this gene family in disease pathogenesis [9]. In fact, associations between HSP70 variants and the imbalance between oxidation and anti-oxidation have been reported [10]. Oxidative stress seems to be responsible for the onset/aggravation of many human diseases. Actually, it is also considered as one of the several etiopathogenesis factors of pemphigus, especially the pemphigus foliaceus (PF) form [11,12]. PF is a rare autoimmune bullous skin disease characterized by the presence of exclusive skin lesions, a subcorneal cleavage in the upper epidermis, and the production of auto-antibodies directed against desmoglein 1. The disease susceptibility is strongly
http://dx.doi.org/10.1016/j.imlet.2015.01.006 0165-2478/© 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
A. Toumi et al. / Immunology Letters 164 (2015) 94–99
associated with some HLA class II antigens [13], such as HLA-DR4 which was found to be associated with sporadic and endemic forms of PF. Interestingly, the DRB1*03 allele is considered as the main and characteristic susceptibility allele of the endemic Tunisian form [14]. However, the role of other loci of the Major Histocompatibility Complex (MHC) region in the susceptibility to PF is still less investigated. Mapped in the class III region of the MHC, the HSP70 genes includes 3 main genes: HSPA1L, HSPA1A and HSPA1B [3]. The polymorphism of these genes is potentially accounting for variation in their functions and susceptibility to stress tolerance [15,16]. The human HSP 70 family constitute a group of conserved and widely distributed HSPs proteins of average weight of 70 kDa. HSPA1A and HSPA1B encode a similar heat-inducible protein HSP70. HSPA1A is also constitutively expressed at a low level, whereas HSPA1L encodes a not heat inducible protein that shares high homology with the protein products of HSPA1A/HSPA1B. Furthermore, significant association between these HSP70 variants and different levels of mRNA expression which leads to increased levels of serum HSP70 have been largely demonstrated. Genetic studies have suggested the possible association of single nucleotide polymorphisms (SNPs) in the HSP70 genes with many autoimmune diseases such as multiple sclerosis, Crohn’s disease, Alzheimer’s disease, Graves’ disease, Type 1 Diabetis and systemic lupus erythematosus [17,18]. Furthermore, significant association between these HSP70 variants and different levels of mRNA expression which leads to increased levels of serum HSP70 have been largely demonstrated. The aim of the current study is to investigate the association between the Hsp70 genes variants and PF. We analyzed HSPA1L + 2437, HSPA1A + 190 and HSPA1B + 1267 polymorphisms in 80 PF patients compared to 160 matched healthy controls and 147 first degree related healthy individuals. Thereafter, we evaluated the existence of eventual haplotypes with the known HLA class II risk alleles for Tunisian PF (HLA-DRB1*03 and DRB1*04) [14].
95
2. Material and methods 2.1. Study populations In this case-control study, 80 PF patients living in the endemic southern area of Tunisia and matched by age (± 5 years), sex and geographical origin to 160 healthy controls were recruited. We also included 147 first degree healthy relatives to PF patients. All patients with PF, attending the Dermatology Department of the University Hospital of Sfax, were diagnosed on clinical, histological and immunological criteria of PF [19]. All PF patients showed high epidermal acantholysis and positive direct and indirect immunofluorscence. No one of the healthy subjects did suffer from any autoimmune or inflammatory disease or was receiving any treatment. All patients, relatives and healthy controls gave informed consent to participate in the study. This study was approved by the Ethical Committee of the Habib Bourguiba Hospital, Sfax, Tunisia (protocol number of ethical committee, 4/12). 2.2. SNP selection Tagging Single Nucleotide Polymorphism (tagSNP) in the HSPA1L (rs2227956), in the HSPA1A (rs1043618) and in the HSPA1B (rs1061581) genes (Fig. 1A) were selected using the genotyping data from the CEU available from the International Hapmap project. These SNPs were confirmed for the HSPA1L, HSPA1A and HSPA1B from the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/genome/guide/human) based on the validity, heterozygosity and on assay availability. 2.3. Genotyping with restriction fragment length polymorphism (RFLP) The DNA was extracted from the whole blood using the standard method and the HSP genes were genotyped by a polymerase chain
Fig. 1. Overview and linkage disequilibrium (LD) of the human genomic locus containing three Hsp70 genes on chromosome 6. (A) The human susceptibility locus on chromosome 6p21.33 covers a cluster of three Hsp70 genes: Hsp70-hom (HSPA1L), Hsp70.1 (HSPA1A) and Hsp70.2 (HSPA1B). (B) Pairwaise LD analysis of PF susceptibility loci corresponding to the Lewontin.
96
A. Toumi et al. / Immunology Letters 164 (2015) 94–99
Table 1 Summary of the genotyping method and characteristics of the single nucleotide polymorphisms (SNPs) of HSP70-1, HSP70-2 and HSP70-hom. Genes
Primers
SNP name
Location
Enzyme
Amplicon (bp and allele)
HSP70-1
F: GAGAGTGACTCCCGTTGTCC R: GAGTAGGTGGTGCCCAGGT F: CATCGACTTCTACACGTCCA R: CAAAGTCCTTGAGTCCCAAC F: GGACAAGTCTGAGAAGGTACAG R: GTAACTTAGATTCAGGTCTGG
rs1043618
5 UTR
BsrBI
117/73 (G) 216 (C)
rs1061581
Exon 3
Pst I
1097 (A) 905/192 (G)
rs2227956
Exon 2
NcoI
551/327 (T) 878 (C)
HSP70-2
HSP70-hom
SNPrs no. were taken from NCBI dbSNP (http://www.ncbi.nlm.nih.gov/SNP).
reaction (PCR) under modified conditions according to a previously reported method [20], as shown in Table 1. The PCR products were digested with the specific restriction enzymes, run on 1.5% agarose gels and stained with ethidium bromide.
of 33 years. For the family study, we have genotyped 147 related individuals, 86 women and 58 men with 40 years of average age.
2.4. Statistical analysis
3.2.1. Case–control study Genotype frequency of the three SNPs HSPA1L, HSPA1A and HSPA1B were consistent with those expected from the HWE (p = 0.171, p = 0.725 and p = 0.84; respectively) in controls subjects. Table 3 illustrates genotypes and alleles frequencies of HSPA1L, HSPA1A and HSPA1B (Fig. 1A) (in the sens from the telomere to centromere) and the P-values resulting after statistical analysis of the single SNPs in the patients and unrelated healthy subjects. The HSPA1L>T, HSPA1A>C and HSP HSPA1B>G allele’s frequencies exhibited a marked increase in PF patients (94.4%, 58.1% and 58.11%, respectively) compared with controls (64.7%, 35.9% and 43.8%; respectively) and allelic association analysis confirmed a significant association with the disease (OR = 9.16, 95% confidence interval [CI] = [4.5- 18.868], OR = 2.47, 95% CI [1.678 -3.648], and OR = 1.87 95% CI [1.216-2.624]; respectively). We also found significant differences for HSPA1L (p = 2.62 × 10−12 ), HSPA1A (p = 5.26 × 10−6 ; OR = 4.69) and HSPA1B (p = 5.8 × 10−3 ) global genotypes in PF group compared to the control group. In fact, the homozygous HSPA1L-TT (p = 3.83 × 10−13 ; OR = 12.15), the HSPA1A-CC (p = 1.34 × 10−6 ; OR = 4.69) and the HSPA1B-GG genotypes (p = 4.0 × 10−3 ; OR = 2.6) were significantly more frequent in patients with PF (88.7%, 38.75% and 37.5%, respectively) than their matched controls (39.4%, 11.9% and 18.75%, respectively), indicating a susceptible role of these genotypes in the occurrence of PF.
Differences in the alleles and genotypes frequencies of the HSP polymorphisms between the patients and controls were calculated using Odds ratios (OR) with 95% confidence intervals (95% CI). Hardy–Weinberg equilibrium (HWE) at each polymorphism was examinated by a 2 test with one degree of freedom. Haplotype analysis and the linkage disequilibrium (LD) coefficients D = D/Dmax and r2 -values for the pair of the most common alleles at each site were carried out using SHEsis program (http://analysis.bio-x.cn) [21,22] (High values of LD were defined as r2 > 0.33 and D > 0.7). The logistic regression analysis was done using SPSS version 18.0 software (SPSS Inc., Chicago, IL, USA). The family-based association test (FBAT) was performed with FBAT program v1.5.1. The FBAT program uses generalized score statistics to perform a variety of transmission disequilibrium tests (TDT), including haplotype analyses. Differences were considered to be statistically significant if the p-value was ≤0.05. 3. Results 3.1. Study populations In this study; 80 PF patients, 160 matched healthy subjects and 147 related individuals were genotyped. The clinical and demographic data for our Tunisian study populations are shown in Table 2. The demographic features of our PF patients were associated with an important sex ratio disequilibrium (female/male, 9/1) and a low mean age of disease onset (34 years). The healthy controls (n = 160) consisted of 152 women and 8 men with a mean age Table 2 PF patients, related and unrelated healthy subjects epidemiological characteristic’s. Features
PF
Relatives
Control
Number Age (years) Sex F/M Origin
80 33.82 [18–65] 76/4 Endemic region in the south of Tunisia High temperature, desert, poverty 80 80 mainly IgG4
147 40 [20–69] 86/58
160 33 [18–65] 152/8
0 32 IgG2
0 10 IgG2
Risk factors DIF positif Anti-Dsg1
DIF, direct immunofluorescence; Anti-Dsg1, anti-desmogleine 1 auto-antibodies detected by ELISA.
3.2. Single SNP analysis
3.2.2. Family study The allelic and genotypic analyses performed with FBAT program confirmed the case-controls study results only for HSPA1A gene (Table 4). Inspite of the limited significance found with the HSPA1A>C allele (Z = 1.872, P = 0.06), the HSPA1A-CC genotype seems to be significantly transmitted with the disease (Z = 3.08, P = 0.002). On the other hand, the haplotype analysis confirmed that the TCG haplotype is significantly transmitted with the disease (Z = 1.999, P = 0.045). 3.3. HSP 70 genes and HLA class II association study by logistic regression The correlation was performed for all PF patients and only the 116 healthy controls that have been genotyped for HLA polymorphisms in our previous study [16]. In this study, we have shown DRB1*03 and DRB1*04 as susceptibility alleles of the Tunisian endemic PF. It is thus questionable if the association, which we
A. Toumi et al. / Immunology Letters 164 (2015) 94–99
97
Table 3 Genotypes and allele frequencies of HSP70-hom, HSP70-1 and HSP70-2 polymorphisms and their associations to Tunisian PF. Variables
rs2227956
rs1043618
rs1061581
Genotype
Allele T TT TC CC Allele C CC GC GG Allele G GG AG AA
EPF cases
Controls
N = 80
F(%)
N = 160
F(%)
151 71 9 0 93 31 31 18 93 30 33 17
94.4 88.7 11.3 0 58.1 38.75 38.75 22.5 58.11 37.5 41.25 21.25
207 63 81 16 115 19 77 64 140 30 80 50
64.7 39.4 50.6 10 35.9 11.9 48.1 40 43.8 18.75 50 31.25
OR
95% CI
2
P
Pc
9.16
4.5–18.868
49.59
1.97 × 10−12
5.91 × 10−12
53.33
2.62 × 10−12
7.86 × 10−12
21.38
3.82 × 10−06
1.14 × 10−05
24.31
5.26 × 10−06
1.58 × 10−05
8.82
2.97 × 10−03
8.91 × 10−03
5.8 × 10−03
1.74 × 10−02
2.47
1.678–3.648
1.78
1.216–2.624
10.27
CI, confidence interval; F, frequency of alleles or genotypes; n, number of alleles or genotypes; OR, odds ratio. Pc: Statistically significant p after Bonferroni adjustment < 0.05 (p value xnumber of alleles or genotypes).
Table 4 Allele frequencies of HSP70-1, HSP70-2 and HSP70-hom polymorphisms and their associations to the risk of Tunisian PF in PF families. Marker
Genotype
afreq
Z
P
rs2227956
Allele T Allele C TT TC CC
0.075 0.925 0.851 0.149 0
1.412 −1.412 1.133 −1.065 −0.712
NS
Allele C Allele G CC GC GG
0.530 0.470 0.216 0.629 0.155
1.872 −1.872 3.08 −2.754 0.069
0.06
Allele A Allele G GG AG AA
0.445 0.555 0.183 0.743 0.073
−1.359 1.359 1.644 −1.287 −0.304
NS
rs1043618
rs1061581
NS NS NS
0.002 0.0058 NS
NS NS NS
found in the current data with the HSP70 genes, is due to disequilibrium with these HLA class II alleles or to the direct contribution of these polymorphisms of the HSP genes in the occurrence of PF. The logistic regression analysis indicated that only the association with the HLA-DRB1*03 allele (p < 0.0001 and OR = 21 95% CI [8.9 -52.39]) and the HSPA1A gene (p = 0.025 and OR = 2.7 95% CI [1.136.43]) remain significant, which could argue that the HLA class II loci and the HSP70 genes are dependently associated with the disease. These findings allow us concluding that HSP70 genes polymorphisms could contribute secondary in the susceptibility and/or the protection to PF in Tunisia. 3.4. Haplotypes analysis On the basis of information provided by the HapMap database, we selected eight haplotype-tagging SNPs to define haplotypes
with more than 1% frequency and with high LD depicted in the LD plot. Significant differences between PF patients and healthy controls were observed when comparing the distribution of CCA, CGA, CGG and TCG haplotypes, these differences remained significant after Bonferroni’s correction (Table 5). The CCA, CGG and especially the CGA haplotypes were more significantly expressed in controls (17.23%, 54.85% and 27%, respectively) compared to patients (0%, 7.88% and 1.12%, respectively) which could argue in favor of their protector role. Whereas, the TCG haplotype was found positively associated with PF (p = 3.77 × 10−10 and OR = 4.017 95% CI [2.62–6.16]). On the other hand, significant haplotypes were found between the HSP70 and the DRB1 loci (Table 6). These haplotypes spring from the combination of susceptibility and/or protection haplotypes of the two loci. In fact, the HSP70TCG-DRB1*04-DQB1*03:02 and the HSP70TCG-DRB1*03-DQB1*02 haplotypes were more present in patients (5.1% and 19.6% in patients vs0% and 2.5% in controls; respectively). The expression of these haplotypes seems to confer susceptibility to PF (p = 0.0032 and p = 1.7 × 10−6 , OR = 8 95% CI [3–20.6]; respectively). Whereas, the expression of the HSP70CGA-DRB1*07-DQB1*02 and the HSP70CGA-DRB1*15DQB1*06 haplotypes were limited to controls only (3% and 5.1%, respectively).
3.5. Pairwise linkage disequilibrium analysis LD analysis among patients group was performed by pairwise comparison of the 3 HSP70 polymorphisms studied. LD analysis among patients group was performed by pairwise comparison of these 3 HSP70 polymorphisms (Fig. 1B). LD values measured by D revealed evidence for LD between the HSPA1B and the HSPA1A with the HSPA1L (D = 0.99 and D = 0.75, respectively), indicating that the associations observed for each SNP are indeed dependent of the HSPA1L signal.
Table 5 Haplotypeanalysislocichosen for hap-analysis: HSP70-Hom, HSP70-1and HSP70-2.
1 2 3 4 5 6 7 8
Haplotype
Case (%)
Control (%)
2
P
Odds ratio 95% CI
CCA CGA CCG C GG TCA TGA TCG T GG
0 (0) 7.88 (4.9) 0 (0) 1.12 (0.7) 21.13 (13.2) 37.99 (23.7) 71.87 (44.9) 20.01 (12.5)
17.23 (5.4) 54.85 (17.1) 13.91 (4.3) 27.00 (8.4) 29.86 (9.3) 78.06 (24.4) 54.00 (16.9) 45.08 (14.1)
8.004 14.014 7.164 11.581 1.689 0.025 43.356 0.227
0.0374 0.0014 0.0596 0.0053 0.193664 0.875091 3.77 × 10−10 0.633625
0.000 [0.000∼0.003] 0.250 [0.116∼0.542] 0.077 [0.011∼0.511] 1.479 [0.818∼2.675] 0.965 [0.619∼1.505] 4.017 [2.620–6.159] 0.872 [0.496∼1.533]
Significant haplotypes were shown in bold.
98
A. Toumi et al. / Immunology Letters 164 (2015) 94–99
Table 6 Haplotype analysis loci chosen for hap-analysis: HSP70 and DRB1/DQB1 loci. Haplotype
Case (%)
Control (%)
2
P
Odds ratio 95% CI
TCG-DRB1*03-DQB1* 02 TCG -DRB1*04-DQB1* 03:02 CGA-DRB107-DQB1*02 CGA-DRB1*15-DQB1*06
31.36 (19.6) 8.09 (5.1) 0 (0) 0 (0)
5.74 (2.5) 0 (0) 7.02 (3) 11.78 (5.1)
22 8.64 7.15 12.32
1.76 10–6 0.0032 0.007 0.00045
8 [3–20.6] – – –
On the other hand, the pairwise LD mapping showed significant linkage disequilibrium between the HSPA1AL and the HLA class II alleles especially with the DR3 allele (HSPA1L vs DRB1*03, D = 0.85; HSPA1L vs DQB1*0302, D = 0.71).
4. Discussion In this data, we take into account the entire Hsp70 locus on 6p21.33 with respect to the underlying LD [23,24] and we performed different approach: case control study, family study and haplotypes analysis to test the selected three Tags SNPs. To our knowledge, this is the first genetic association study on HSP70 genes with PF. Our data show a significant and interesting association of HSPA1L>T/T, HSPA1A>C/C and HSPA1B>G/G genotypes with increased risk of PF. A significant susceptible effect for the HSPA1L>T allele was found in our population. This interesting finding was previously reported in other data [25], which observed a significant association between the C-allele of HSPA1L + 2437 and increased levels of serum HSP70. It has been reported that the neutrality of the Thr residue (T allele) may affect the efficiency of the HSPA1L protein by lowering the strength of hydrophobic interactions between the chaperone and target protein. On the other hand, the HSPA1A>CC and the HSPA1B>GG genotypes were found to play a susceptible role in the occurrence of PF. Previous studies has shown that different genotypes of the HSPA1B gene are associated with different levels of mRNA expression; the AA genotype having the highest level of mRNA expression whereas the HSP70-2 GG genetic variation is associated with low inducibility of HSP70 [26,27]. In such a case, the cell response of G/G subjects to stress would be impaired. Moreover, the 2 highly conserved HSPA1A and HSPA1B genes share a similar heat shock element, which suggests that they have similar affinities for heat shock factors [3,28]. Thus, decreased serum and mRNA levels of HSP70 because of the T-allele of HSPA1L + 2437 and the HSPA1B>GG genotype, respectively, may have an effect on epidermis under heat or UV radiation exposure and the HSPA1L>T/T, HSPA1A>C/C and HSPA1B>G/G genotypes found in our present study as associated with PF, may be related to the disease through similar mechanisms. Such alteration may impair their ability to assemble and transport some newly synthesized proteins within cells, as well as to remove denatured proteins that may be formed as a result of damage like in PF disease which can lead to the intracellular accumulation of denaturalised proteins or peptides transporting defects affecting self tolerance and may cause autoimmunity by molecular mimicry. This lower production of HSP70 proteins could, in addition to other markers or inductors of this disease already discovered, induce or exacerbate immune response in PF disease. According to these findings, the lower production of HSP70 proteins could explain in part the frequency of this endemic form of PF in these south regions of Tunisia recognized by temperature and UV radiation intensity particularly high. An interaction between environmental and genetic predisposing factors is thought to be involved in the etiology of PF. Indeed, environmental factors may induce processes in the skin which promotes the exposure of self-antigens and the development of subsequent and progressive humoral autoimmunity.
It has been proposed that haplotype blocks are useful in the sequence variation analysis to increase study power by 15–50%, compared with single SNP analysis [29,30]. Therefore, haplotype may be more effective in explaining the relationship between genotype and phenotype. Our results showed that HSPA1L>T-HSPA1A>G-HSPA1B>C haplotype pairs are significantly overrepresented in PF patients indicating that they may contribute to the susceptibility to skin damage induced by exposure to environment stress such as high temperature. In contrast, the CAC, CAG and CGG haplotypes which were over-represented in healthy subjects could protect from the disease. HSP70 proteins may be particularly interesting group of proteins involved in disease susceptibility [15]. In this context, we found a strong association of TCG haplotype especially with HLA alleles already reported associated to PF, HLA-DRB1*03 and DQB1*0302 (p = 1.79 × 10−9 and p = 0.0059, respectively). Furthermore, association with HSP genes follows an increasing gradient from the HSPA1B (pc = 0.00891), HSPA1A (pc = 1.14 × 10−05 ) until HSPA1L (pc = 5.91 × 10−12 ) where it reaches its maximum. According to the LD analysis, the HSPA1A and HSPA1B genes are in disequilibrium with the HSPA1L locus, which is already in strong linkage disequilibrium with the class II loci, especially DR3 allele (Fig. 1B). These findings suggest that HSP70 genes are dependent of HLA-DR/DQ loci in governing susceptibility to PF. The multivariant regression analysis confirms this hypothesis. Conflict of interest None declared. Acknowledgments This work was supported by a grant from the “Ministère de l’enseignement supérieur et de la Recherche scientifique” of Tunisia. References [1] Linquist S. The heat shock response. Annu Rev Biochem 1986;55:1151–91. [2] Gething MJ, Sambrook J. Protein folding in the cell. Nature 1992;355:33–45. [3] Milner CM, Campbell RD. Structure and expression of the three MHC linked HSP70 genes. Immunogenetics 1990;32:242–51. [4] Asea A, Kraeft SK, Kurt-Jones EA, Chen LB, Finberg RW, Koo GC, et al. HSP70 stimulates cytokine production through a CD14-dependant pathway, demonstrating its dual role as a chaperone and cytokine. Nat Med 2000;6:435–42. [5] Srivastava PK, Udono H, Blachere NE, Li Z. Heat shock proteins transfer peptides during antigen processing and CTL priming. Immunogenetics 1994;39:93–8. [6] Multhoff G. Activation of natural killer cells by heat shock protein 70. Int J Hyperth 2002;18:576–85. [7] Kiang JG, Tsokos GC. Heat shock protein 70 kDa: molecular biology, biochemistry, and physiology. Pharmacol Ther 1998;80:183–201. [8] Matouschek A. Protein unfolding - an important process in vivo. Curr Opin Struct Biol 2003;13:98–109. [9] Baroni A, Buomimino E, Paoletti I, Orlando O, Ruocco E, Ruocco V. Pemphigus serum and captopril induce heat shock protein 70 and inducible nitric oxide synthase overexpression, triggering apoptosis in human keratinocytes. Br J Dermatol 2004;150:1070–80. [10] Ridker PM, Hennekens CH, Buring JE, Rifai N. C-reactive protein and other markers of inflammation in the prediction of cardiovascular disease in women. N Engl J Med 2000;342:836–43. [11] Abida O, Ben Mansour R, Gargouri B, Ben Ayed M, Masmoudi A, TurkiH, et al. Catalase and lipid peroxidation values in serum of Tunisian patients with pemphigus vulgaris and foliaceus. Biol Trace Elem Res 2012;150:74–80.
A. Toumi et al. / Immunology Letters 164 (2015) 94–99 [12] Abida O, Gargouri B, Ben Mansour R, Mseddi-Djemal M, Masmoudi A, Ben Ayed M, et al. Biomarkers of oxidative stress in epidermis of Tunisian pemphigus foliaceus patients. J Eur Acad Dermatol Venereol 2012. [13] Tron F, Gilbert D, Mouquet H, Joly P, Drouot L, Makni S, et al. Genetic factors in pemphigus. J Autoimmun 2005;24:319–28. [14] Abida O, Zitouni M, Kallel-Sellami M, Mahfoudh N, Kammoun A, Ben Ayed M, et al. Tunisian endemic pemphigus foliaceus is associated with the HLA-DR3 gene: anti-desmoglein 1 antibody-positive healthy subjects bear protective alleles. Br J Dermatol 2009;161:522–7. [15] Favatier F, Bornman L, Hightower LE, Gunther E, Polla BS. Variation in hsp gene expression and Hsp polymorphism: do they contribute to differential disease susceptibility and stress tolerance? Cell Stress Chaperones 1997;2:141–55. [16] Wu YR, Wang CK, Chen CM, Hsu Y, Lin SJ, Lin YY, et al. Analysis of heat-shock protein 70 gene polymorphisms and the risk of Parkinson’s disease. Hum Genet 2004;114:236–41. [17] Ramachandran S, Bell RB. Heat shock protein 70 gene polymorphisms and multiple sclerosis. Tissue Antigens 1995;46:140–1. [18] Pablos JL, Carreira PE, Martín-Villa JM, Montalvo G, Arnaiz-Villena A, GomezReino JJ. Polymorphism of the heat shock protein gene HSP 70-2 in systemic lupus erythematosus. Br J Rheumatol 1995;34:721–3. [19] Jarzabek-Chorzelska M, Jablonska S, Kolacinska-Strasz Z, Sulej I. Immunopathological diagnosis of pemphigus foliaceus. Dermatology 2002;205:413–5. [20] Vinasco J, Beraun Y, Nieto A, Fraile A, Pareja E, Mataran L, et al. Heat shock protein 70 gene polymorphisms in rheumatoid arthritis. Tissue Antigens 1997;50:71–3. [21] Shi YY, He L. SHEs is, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 2005;15:97–8.
99
[22] Li G, Lu X. Comments on: a review on empirical likelihood methods for regression. Test (Madr) 2009;18:463–7. ˜ [23] Vargas-Alarcón G, Granados J, Martínez-Laso J, Gómez-Casado E, Zuniga J, Salgado N, et al. Lack of association between the polymorphism at the heat-shock protein (HSP70-2) gene and systemic lupus erythematosus (SLE) in the Mexican mestizo population. Genes Immun 2000;1:367–70. [24] Partanen J, Milner C, Campbell RD, Maki M, Lipsanen V, Koskimies S. HLA-linked heat-shock protein 70 (HSP70–2) gene polymorphism and celiac disease. Tissue Antigens 1993;41:15–9. [25] Afzal AR, Mandal K, Nyamweya S, Foteinos G, Poloniecki J, Camm AJ, et al. Association of Met439Thr substitution in heat shock protein 70 gene with postoperative atrial fibrillation and serum HSP70 protein levels. Cardiology 2007;110:45–52. [26] Fekete A, Treszl A, Toth-Heyn P, Vannay A, Tordai A, Tulassay T. Association between heat shock protein 72 gene polymorphism and acute renal failure in premature neonates. Pediatr Res 2003;54:452–5. [27] Pociot F, Rønningen KS, Nerup J. Polymorphic analysis of the human MHC-linked heat shock protein 70 (HSP70-2) and HSP70-Hom genes in insulin-dependent diabetes mellitus (IDDM). Scand J Immunol 1993;38: 491–5. [28] Milner CM, Campbell RD. Polymorphic analysis of the three MHC-linked HSP70 genes. Immunogenetics 1992;36:357–62. [29] Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, et al. The structure of haplotype blocks in the human genome. Science 2002;296: 2225–9. [30] Thomas DC, Stram DO, Conti D, Molitor J, Marjoram P. Bayesian spatial modeling of haplotype associations. Hum Hered 2003;56:32–40.
Contents lists available at ScienceDirect
Immunology Letters journal homepage: www.elsevier.com/locate/immlet
Is there any relationship between polymorphism of Heat Shock Protein 70 genes and Pemphigus foliaceus? Amina Toumi a , O. Abida a , M. Ben-Ayed a , A. Masmoudi b , H. Turki b , H. Masmoudi a,∗ a b
Immunology Department, Habib Bourguiba Hospital, University of Sfax, Sfax, Tunisia Dermatology Department, Hédi Chaker University Hospital, Sfax, Tunisia
a r t i c l e
i n f o
Article history: Received 20 November 2014 Received in revised form 16 January 2015 Accepted 23 January 2015 Available online 14 February 2015 Keywords: Pemphigus foliaceus Heat Shock Protein 70 Gene Polymorphism HLA-DR3 Tunisia
a b s t r a c t The human Heat Shock Proteins (HSP70) family plays a key role in up-regulating stress responses. Some studies reported possible associations of single nucleotide polymorphisms in the HSP70 genes with some autoimmune diseases. However, whether HSP70 polymorphisms represent a risk factor for pemphigus foliaceus (PF) is still unkown. We analyzed by PCR-RFLP polymorphisms of HSP70 genes HSA1A, HSPA1B and HSPA1L in 80 Tunisian patients with PF, 160 matched healthy controls and 147 related healthy subjects. There were significant differences between PF patients and controls in the allelic (pc = 5.91 × 10−12 , pc = 1.14 × 10−5 and pc = 0.0089, respectively) and homozygous genotypic frequencies of HSPA1L>T, HSPA1A>C and HSPA1B>G (p = 2.617 × 10−12 , p = 1.017 × 10−5 and p = 0.0058, respectively). Haplotype analysis showed significant differences between PF patients and controls: the CCA, CGA, CCG and CGG haplotypes were significantly over-represented in controls whereas the TCG haplotype was significantly over-represented in patients. However, the significant LD found between the HSP70 and the HLA class II susceptibility alleles together with the multivariant regression analysis data between the two loci could argue against a direct role of the HSP70 polymorphism in the occurrence of PF. © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
1. Introduction The Heat Shock Protein (HSP) is an interesting molecular chaperone essential for the repair or removal of defective proteins and which is thought to assist in the maintenance of cellular integrity and viability [1–3]. Several representative groups of HSPs (small HSP, HSP60, HSP70, HSP90 and HSP100) have been classified according to their different molecular weights [1]. Moreover, the extracellular HSPs play key roles in the induction of cellular immune responses since these proteins seem to be involved in the antigen processing and presentation. In fact, it has been reported that the binding of uncomplexed HSP molecules to their specific receptors on antigen-presenting cells (APC) induces a pro-inflammatory cytokine secretion from monocytes through a CD14-dependant pathway [4]. HSPs may act as carrier molecules
Abbreviations: PF, Pemphigus foliaceus; SNP, single nucleotide polymorphism; MAF, minor allele frequency; HWE, Hardy-Weinberg equilibrium; OR, odds ratios; LD, linkage disequilibrium. ∗ Corresponding author at: Habib Bourguiba Hospital, Immunology Department, 3029 Sfax, Tunisia. Tel.: +216 98413954. E-mail address: [email protected] (H. Masmoudi).
for immunogenic peptides that are presented on APC to cytotoxic T cells or may themselves act as activatory molecules for the innate immune system [5]. They have been also found to act as a recognition structure for natural killer (NK) cells [6]. On the other hand, the proteins HSP can be expressed during heat shock or in response to a variety of other mechanical or chemical stress stimuli including oxy-radicals and toxic metals [7]. In fact, it has been shown that HSP70 has an anti-oxidative action. Thus, intracellular HSPs support the folding and the transport mechanisms of other proteins under physiological conditions and following physical or chemical stress [8]. The importance of HSP70 in protecting cells from stress-induced apoptosis implicates this gene family in disease pathogenesis [9]. In fact, associations between HSP70 variants and the imbalance between oxidation and anti-oxidation have been reported [10]. Oxidative stress seems to be responsible for the onset/aggravation of many human diseases. Actually, it is also considered as one of the several etiopathogenesis factors of pemphigus, especially the pemphigus foliaceus (PF) form [11,12]. PF is a rare autoimmune bullous skin disease characterized by the presence of exclusive skin lesions, a subcorneal cleavage in the upper epidermis, and the production of auto-antibodies directed against desmoglein 1. The disease susceptibility is strongly
http://dx.doi.org/10.1016/j.imlet.2015.01.006 0165-2478/© 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
A. Toumi et al. / Immunology Letters 164 (2015) 94–99
associated with some HLA class II antigens [13], such as HLA-DR4 which was found to be associated with sporadic and endemic forms of PF. Interestingly, the DRB1*03 allele is considered as the main and characteristic susceptibility allele of the endemic Tunisian form [14]. However, the role of other loci of the Major Histocompatibility Complex (MHC) region in the susceptibility to PF is still less investigated. Mapped in the class III region of the MHC, the HSP70 genes includes 3 main genes: HSPA1L, HSPA1A and HSPA1B [3]. The polymorphism of these genes is potentially accounting for variation in their functions and susceptibility to stress tolerance [15,16]. The human HSP 70 family constitute a group of conserved and widely distributed HSPs proteins of average weight of 70 kDa. HSPA1A and HSPA1B encode a similar heat-inducible protein HSP70. HSPA1A is also constitutively expressed at a low level, whereas HSPA1L encodes a not heat inducible protein that shares high homology with the protein products of HSPA1A/HSPA1B. Furthermore, significant association between these HSP70 variants and different levels of mRNA expression which leads to increased levels of serum HSP70 have been largely demonstrated. Genetic studies have suggested the possible association of single nucleotide polymorphisms (SNPs) in the HSP70 genes with many autoimmune diseases such as multiple sclerosis, Crohn’s disease, Alzheimer’s disease, Graves’ disease, Type 1 Diabetis and systemic lupus erythematosus [17,18]. Furthermore, significant association between these HSP70 variants and different levels of mRNA expression which leads to increased levels of serum HSP70 have been largely demonstrated. The aim of the current study is to investigate the association between the Hsp70 genes variants and PF. We analyzed HSPA1L + 2437, HSPA1A + 190 and HSPA1B + 1267 polymorphisms in 80 PF patients compared to 160 matched healthy controls and 147 first degree related healthy individuals. Thereafter, we evaluated the existence of eventual haplotypes with the known HLA class II risk alleles for Tunisian PF (HLA-DRB1*03 and DRB1*04) [14].
95
2. Material and methods 2.1. Study populations In this case-control study, 80 PF patients living in the endemic southern area of Tunisia and matched by age (± 5 years), sex and geographical origin to 160 healthy controls were recruited. We also included 147 first degree healthy relatives to PF patients. All patients with PF, attending the Dermatology Department of the University Hospital of Sfax, were diagnosed on clinical, histological and immunological criteria of PF [19]. All PF patients showed high epidermal acantholysis and positive direct and indirect immunofluorscence. No one of the healthy subjects did suffer from any autoimmune or inflammatory disease or was receiving any treatment. All patients, relatives and healthy controls gave informed consent to participate in the study. This study was approved by the Ethical Committee of the Habib Bourguiba Hospital, Sfax, Tunisia (protocol number of ethical committee, 4/12). 2.2. SNP selection Tagging Single Nucleotide Polymorphism (tagSNP) in the HSPA1L (rs2227956), in the HSPA1A (rs1043618) and in the HSPA1B (rs1061581) genes (Fig. 1A) were selected using the genotyping data from the CEU available from the International Hapmap project. These SNPs were confirmed for the HSPA1L, HSPA1A and HSPA1B from the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/genome/guide/human) based on the validity, heterozygosity and on assay availability. 2.3. Genotyping with restriction fragment length polymorphism (RFLP) The DNA was extracted from the whole blood using the standard method and the HSP genes were genotyped by a polymerase chain
Fig. 1. Overview and linkage disequilibrium (LD) of the human genomic locus containing three Hsp70 genes on chromosome 6. (A) The human susceptibility locus on chromosome 6p21.33 covers a cluster of three Hsp70 genes: Hsp70-hom (HSPA1L), Hsp70.1 (HSPA1A) and Hsp70.2 (HSPA1B). (B) Pairwaise LD analysis of PF susceptibility loci corresponding to the Lewontin.
96
A. Toumi et al. / Immunology Letters 164 (2015) 94–99
Table 1 Summary of the genotyping method and characteristics of the single nucleotide polymorphisms (SNPs) of HSP70-1, HSP70-2 and HSP70-hom. Genes
Primers
SNP name
Location
Enzyme
Amplicon (bp and allele)
HSP70-1
F: GAGAGTGACTCCCGTTGTCC R: GAGTAGGTGGTGCCCAGGT F: CATCGACTTCTACACGTCCA R: CAAAGTCCTTGAGTCCCAAC F: GGACAAGTCTGAGAAGGTACAG R: GTAACTTAGATTCAGGTCTGG
rs1043618
5 UTR
BsrBI
117/73 (G) 216 (C)
rs1061581
Exon 3
Pst I
1097 (A) 905/192 (G)
rs2227956
Exon 2
NcoI
551/327 (T) 878 (C)
HSP70-2
HSP70-hom
SNPrs no. were taken from NCBI dbSNP (http://www.ncbi.nlm.nih.gov/SNP).
reaction (PCR) under modified conditions according to a previously reported method [20], as shown in Table 1. The PCR products were digested with the specific restriction enzymes, run on 1.5% agarose gels and stained with ethidium bromide.
of 33 years. For the family study, we have genotyped 147 related individuals, 86 women and 58 men with 40 years of average age.
2.4. Statistical analysis
3.2.1. Case–control study Genotype frequency of the three SNPs HSPA1L, HSPA1A and HSPA1B were consistent with those expected from the HWE (p = 0.171, p = 0.725 and p = 0.84; respectively) in controls subjects. Table 3 illustrates genotypes and alleles frequencies of HSPA1L, HSPA1A and HSPA1B (Fig. 1A) (in the sens from the telomere to centromere) and the P-values resulting after statistical analysis of the single SNPs in the patients and unrelated healthy subjects. The HSPA1L>T, HSPA1A>C and HSP HSPA1B>G allele’s frequencies exhibited a marked increase in PF patients (94.4%, 58.1% and 58.11%, respectively) compared with controls (64.7%, 35.9% and 43.8%; respectively) and allelic association analysis confirmed a significant association with the disease (OR = 9.16, 95% confidence interval [CI] = [4.5- 18.868], OR = 2.47, 95% CI [1.678 -3.648], and OR = 1.87 95% CI [1.216-2.624]; respectively). We also found significant differences for HSPA1L (p = 2.62 × 10−12 ), HSPA1A (p = 5.26 × 10−6 ; OR = 4.69) and HSPA1B (p = 5.8 × 10−3 ) global genotypes in PF group compared to the control group. In fact, the homozygous HSPA1L-TT (p = 3.83 × 10−13 ; OR = 12.15), the HSPA1A-CC (p = 1.34 × 10−6 ; OR = 4.69) and the HSPA1B-GG genotypes (p = 4.0 × 10−3 ; OR = 2.6) were significantly more frequent in patients with PF (88.7%, 38.75% and 37.5%, respectively) than their matched controls (39.4%, 11.9% and 18.75%, respectively), indicating a susceptible role of these genotypes in the occurrence of PF.
Differences in the alleles and genotypes frequencies of the HSP polymorphisms between the patients and controls were calculated using Odds ratios (OR) with 95% confidence intervals (95% CI). Hardy–Weinberg equilibrium (HWE) at each polymorphism was examinated by a 2 test with one degree of freedom. Haplotype analysis and the linkage disequilibrium (LD) coefficients D = D/Dmax and r2 -values for the pair of the most common alleles at each site were carried out using SHEsis program (http://analysis.bio-x.cn) [21,22] (High values of LD were defined as r2 > 0.33 and D > 0.7). The logistic regression analysis was done using SPSS version 18.0 software (SPSS Inc., Chicago, IL, USA). The family-based association test (FBAT) was performed with FBAT program v1.5.1. The FBAT program uses generalized score statistics to perform a variety of transmission disequilibrium tests (TDT), including haplotype analyses. Differences were considered to be statistically significant if the p-value was ≤0.05. 3. Results 3.1. Study populations In this study; 80 PF patients, 160 matched healthy subjects and 147 related individuals were genotyped. The clinical and demographic data for our Tunisian study populations are shown in Table 2. The demographic features of our PF patients were associated with an important sex ratio disequilibrium (female/male, 9/1) and a low mean age of disease onset (34 years). The healthy controls (n = 160) consisted of 152 women and 8 men with a mean age Table 2 PF patients, related and unrelated healthy subjects epidemiological characteristic’s. Features
PF
Relatives
Control
Number Age (years) Sex F/M Origin
80 33.82 [18–65] 76/4 Endemic region in the south of Tunisia High temperature, desert, poverty 80 80 mainly IgG4
147 40 [20–69] 86/58
160 33 [18–65] 152/8
0 32 IgG2
0 10 IgG2
Risk factors DIF positif Anti-Dsg1
DIF, direct immunofluorescence; Anti-Dsg1, anti-desmogleine 1 auto-antibodies detected by ELISA.
3.2. Single SNP analysis
3.2.2. Family study The allelic and genotypic analyses performed with FBAT program confirmed the case-controls study results only for HSPA1A gene (Table 4). Inspite of the limited significance found with the HSPA1A>C allele (Z = 1.872, P = 0.06), the HSPA1A-CC genotype seems to be significantly transmitted with the disease (Z = 3.08, P = 0.002). On the other hand, the haplotype analysis confirmed that the TCG haplotype is significantly transmitted with the disease (Z = 1.999, P = 0.045). 3.3. HSP 70 genes and HLA class II association study by logistic regression The correlation was performed for all PF patients and only the 116 healthy controls that have been genotyped for HLA polymorphisms in our previous study [16]. In this study, we have shown DRB1*03 and DRB1*04 as susceptibility alleles of the Tunisian endemic PF. It is thus questionable if the association, which we
A. Toumi et al. / Immunology Letters 164 (2015) 94–99
97
Table 3 Genotypes and allele frequencies of HSP70-hom, HSP70-1 and HSP70-2 polymorphisms and their associations to Tunisian PF. Variables
rs2227956
rs1043618
rs1061581
Genotype
Allele T TT TC CC Allele C CC GC GG Allele G GG AG AA
EPF cases
Controls
N = 80
F(%)
N = 160
F(%)
151 71 9 0 93 31 31 18 93 30 33 17
94.4 88.7 11.3 0 58.1 38.75 38.75 22.5 58.11 37.5 41.25 21.25
207 63 81 16 115 19 77 64 140 30 80 50
64.7 39.4 50.6 10 35.9 11.9 48.1 40 43.8 18.75 50 31.25
OR
95% CI
2
P
Pc
9.16
4.5–18.868
49.59
1.97 × 10−12
5.91 × 10−12
53.33
2.62 × 10−12
7.86 × 10−12
21.38
3.82 × 10−06
1.14 × 10−05
24.31
5.26 × 10−06
1.58 × 10−05
8.82
2.97 × 10−03
8.91 × 10−03
5.8 × 10−03
1.74 × 10−02
2.47
1.678–3.648
1.78
1.216–2.624
10.27
CI, confidence interval; F, frequency of alleles or genotypes; n, number of alleles or genotypes; OR, odds ratio. Pc: Statistically significant p after Bonferroni adjustment < 0.05 (p value xnumber of alleles or genotypes).
Table 4 Allele frequencies of HSP70-1, HSP70-2 and HSP70-hom polymorphisms and their associations to the risk of Tunisian PF in PF families. Marker
Genotype
afreq
Z
P
rs2227956
Allele T Allele C TT TC CC
0.075 0.925 0.851 0.149 0
1.412 −1.412 1.133 −1.065 −0.712
NS
Allele C Allele G CC GC GG
0.530 0.470 0.216 0.629 0.155
1.872 −1.872 3.08 −2.754 0.069
0.06
Allele A Allele G GG AG AA
0.445 0.555 0.183 0.743 0.073
−1.359 1.359 1.644 −1.287 −0.304
NS
rs1043618
rs1061581
NS NS NS
0.002 0.0058 NS
NS NS NS
found in the current data with the HSP70 genes, is due to disequilibrium with these HLA class II alleles or to the direct contribution of these polymorphisms of the HSP genes in the occurrence of PF. The logistic regression analysis indicated that only the association with the HLA-DRB1*03 allele (p < 0.0001 and OR = 21 95% CI [8.9 -52.39]) and the HSPA1A gene (p = 0.025 and OR = 2.7 95% CI [1.136.43]) remain significant, which could argue that the HLA class II loci and the HSP70 genes are dependently associated with the disease. These findings allow us concluding that HSP70 genes polymorphisms could contribute secondary in the susceptibility and/or the protection to PF in Tunisia. 3.4. Haplotypes analysis On the basis of information provided by the HapMap database, we selected eight haplotype-tagging SNPs to define haplotypes
with more than 1% frequency and with high LD depicted in the LD plot. Significant differences between PF patients and healthy controls were observed when comparing the distribution of CCA, CGA, CGG and TCG haplotypes, these differences remained significant after Bonferroni’s correction (Table 5). The CCA, CGG and especially the CGA haplotypes were more significantly expressed in controls (17.23%, 54.85% and 27%, respectively) compared to patients (0%, 7.88% and 1.12%, respectively) which could argue in favor of their protector role. Whereas, the TCG haplotype was found positively associated with PF (p = 3.77 × 10−10 and OR = 4.017 95% CI [2.62–6.16]). On the other hand, significant haplotypes were found between the HSP70 and the DRB1 loci (Table 6). These haplotypes spring from the combination of susceptibility and/or protection haplotypes of the two loci. In fact, the HSP70TCG-DRB1*04-DQB1*03:02 and the HSP70TCG-DRB1*03-DQB1*02 haplotypes were more present in patients (5.1% and 19.6% in patients vs0% and 2.5% in controls; respectively). The expression of these haplotypes seems to confer susceptibility to PF (p = 0.0032 and p = 1.7 × 10−6 , OR = 8 95% CI [3–20.6]; respectively). Whereas, the expression of the HSP70CGA-DRB1*07-DQB1*02 and the HSP70CGA-DRB1*15DQB1*06 haplotypes were limited to controls only (3% and 5.1%, respectively).
3.5. Pairwise linkage disequilibrium analysis LD analysis among patients group was performed by pairwise comparison of the 3 HSP70 polymorphisms studied. LD analysis among patients group was performed by pairwise comparison of these 3 HSP70 polymorphisms (Fig. 1B). LD values measured by D revealed evidence for LD between the HSPA1B and the HSPA1A with the HSPA1L (D = 0.99 and D = 0.75, respectively), indicating that the associations observed for each SNP are indeed dependent of the HSPA1L signal.
Table 5 Haplotypeanalysislocichosen for hap-analysis: HSP70-Hom, HSP70-1and HSP70-2.
1 2 3 4 5 6 7 8
Haplotype
Case (%)
Control (%)
2
P
Odds ratio 95% CI
CCA CGA CCG C GG TCA TGA TCG T GG
0 (0) 7.88 (4.9) 0 (0) 1.12 (0.7) 21.13 (13.2) 37.99 (23.7) 71.87 (44.9) 20.01 (12.5)
17.23 (5.4) 54.85 (17.1) 13.91 (4.3) 27.00 (8.4) 29.86 (9.3) 78.06 (24.4) 54.00 (16.9) 45.08 (14.1)
8.004 14.014 7.164 11.581 1.689 0.025 43.356 0.227
0.0374 0.0014 0.0596 0.0053 0.193664 0.875091 3.77 × 10−10 0.633625
0.000 [0.000∼0.003] 0.250 [0.116∼0.542] 0.077 [0.011∼0.511] 1.479 [0.818∼2.675] 0.965 [0.619∼1.505] 4.017 [2.620–6.159] 0.872 [0.496∼1.533]
Significant haplotypes were shown in bold.
98
A. Toumi et al. / Immunology Letters 164 (2015) 94–99
Table 6 Haplotype analysis loci chosen for hap-analysis: HSP70 and DRB1/DQB1 loci. Haplotype
Case (%)
Control (%)
2
P
Odds ratio 95% CI
TCG-DRB1*03-DQB1* 02 TCG -DRB1*04-DQB1* 03:02 CGA-DRB107-DQB1*02 CGA-DRB1*15-DQB1*06
31.36 (19.6) 8.09 (5.1) 0 (0) 0 (0)
5.74 (2.5) 0 (0) 7.02 (3) 11.78 (5.1)
22 8.64 7.15 12.32
1.76 10–6 0.0032 0.007 0.00045
8 [3–20.6] – – –
On the other hand, the pairwise LD mapping showed significant linkage disequilibrium between the HSPA1AL and the HLA class II alleles especially with the DR3 allele (HSPA1L vs DRB1*03, D = 0.85; HSPA1L vs DQB1*0302, D = 0.71).
4. Discussion In this data, we take into account the entire Hsp70 locus on 6p21.33 with respect to the underlying LD [23,24] and we performed different approach: case control study, family study and haplotypes analysis to test the selected three Tags SNPs. To our knowledge, this is the first genetic association study on HSP70 genes with PF. Our data show a significant and interesting association of HSPA1L>T/T, HSPA1A>C/C and HSPA1B>G/G genotypes with increased risk of PF. A significant susceptible effect for the HSPA1L>T allele was found in our population. This interesting finding was previously reported in other data [25], which observed a significant association between the C-allele of HSPA1L + 2437 and increased levels of serum HSP70. It has been reported that the neutrality of the Thr residue (T allele) may affect the efficiency of the HSPA1L protein by lowering the strength of hydrophobic interactions between the chaperone and target protein. On the other hand, the HSPA1A>CC and the HSPA1B>GG genotypes were found to play a susceptible role in the occurrence of PF. Previous studies has shown that different genotypes of the HSPA1B gene are associated with different levels of mRNA expression; the AA genotype having the highest level of mRNA expression whereas the HSP70-2 GG genetic variation is associated with low inducibility of HSP70 [26,27]. In such a case, the cell response of G/G subjects to stress would be impaired. Moreover, the 2 highly conserved HSPA1A and HSPA1B genes share a similar heat shock element, which suggests that they have similar affinities for heat shock factors [3,28]. Thus, decreased serum and mRNA levels of HSP70 because of the T-allele of HSPA1L + 2437 and the HSPA1B>GG genotype, respectively, may have an effect on epidermis under heat or UV radiation exposure and the HSPA1L>T/T, HSPA1A>C/C and HSPA1B>G/G genotypes found in our present study as associated with PF, may be related to the disease through similar mechanisms. Such alteration may impair their ability to assemble and transport some newly synthesized proteins within cells, as well as to remove denatured proteins that may be formed as a result of damage like in PF disease which can lead to the intracellular accumulation of denaturalised proteins or peptides transporting defects affecting self tolerance and may cause autoimmunity by molecular mimicry. This lower production of HSP70 proteins could, in addition to other markers or inductors of this disease already discovered, induce or exacerbate immune response in PF disease. According to these findings, the lower production of HSP70 proteins could explain in part the frequency of this endemic form of PF in these south regions of Tunisia recognized by temperature and UV radiation intensity particularly high. An interaction between environmental and genetic predisposing factors is thought to be involved in the etiology of PF. Indeed, environmental factors may induce processes in the skin which promotes the exposure of self-antigens and the development of subsequent and progressive humoral autoimmunity.
It has been proposed that haplotype blocks are useful in the sequence variation analysis to increase study power by 15–50%, compared with single SNP analysis [29,30]. Therefore, haplotype may be more effective in explaining the relationship between genotype and phenotype. Our results showed that HSPA1L>T-HSPA1A>G-HSPA1B>C haplotype pairs are significantly overrepresented in PF patients indicating that they may contribute to the susceptibility to skin damage induced by exposure to environment stress such as high temperature. In contrast, the CAC, CAG and CGG haplotypes which were over-represented in healthy subjects could protect from the disease. HSP70 proteins may be particularly interesting group of proteins involved in disease susceptibility [15]. In this context, we found a strong association of TCG haplotype especially with HLA alleles already reported associated to PF, HLA-DRB1*03 and DQB1*0302 (p = 1.79 × 10−9 and p = 0.0059, respectively). Furthermore, association with HSP genes follows an increasing gradient from the HSPA1B (pc = 0.00891), HSPA1A (pc = 1.14 × 10−05 ) until HSPA1L (pc = 5.91 × 10−12 ) where it reaches its maximum. According to the LD analysis, the HSPA1A and HSPA1B genes are in disequilibrium with the HSPA1L locus, which is already in strong linkage disequilibrium with the class II loci, especially DR3 allele (Fig. 1B). These findings suggest that HSP70 genes are dependent of HLA-DR/DQ loci in governing susceptibility to PF. The multivariant regression analysis confirms this hypothesis. Conflict of interest None declared. Acknowledgments This work was supported by a grant from the “Ministère de l’enseignement supérieur et de la Recherche scientifique” of Tunisia. References [1] Linquist S. The heat shock response. Annu Rev Biochem 1986;55:1151–91. [2] Gething MJ, Sambrook J. Protein folding in the cell. Nature 1992;355:33–45. [3] Milner CM, Campbell RD. Structure and expression of the three MHC linked HSP70 genes. Immunogenetics 1990;32:242–51. [4] Asea A, Kraeft SK, Kurt-Jones EA, Chen LB, Finberg RW, Koo GC, et al. HSP70 stimulates cytokine production through a CD14-dependant pathway, demonstrating its dual role as a chaperone and cytokine. Nat Med 2000;6:435–42. [5] Srivastava PK, Udono H, Blachere NE, Li Z. Heat shock proteins transfer peptides during antigen processing and CTL priming. Immunogenetics 1994;39:93–8. [6] Multhoff G. Activation of natural killer cells by heat shock protein 70. Int J Hyperth 2002;18:576–85. [7] Kiang JG, Tsokos GC. Heat shock protein 70 kDa: molecular biology, biochemistry, and physiology. Pharmacol Ther 1998;80:183–201. [8] Matouschek A. Protein unfolding - an important process in vivo. Curr Opin Struct Biol 2003;13:98–109. [9] Baroni A, Buomimino E, Paoletti I, Orlando O, Ruocco E, Ruocco V. Pemphigus serum and captopril induce heat shock protein 70 and inducible nitric oxide synthase overexpression, triggering apoptosis in human keratinocytes. Br J Dermatol 2004;150:1070–80. [10] Ridker PM, Hennekens CH, Buring JE, Rifai N. C-reactive protein and other markers of inflammation in the prediction of cardiovascular disease in women. N Engl J Med 2000;342:836–43. [11] Abida O, Ben Mansour R, Gargouri B, Ben Ayed M, Masmoudi A, TurkiH, et al. Catalase and lipid peroxidation values in serum of Tunisian patients with pemphigus vulgaris and foliaceus. Biol Trace Elem Res 2012;150:74–80.
A. Toumi et al. / Immunology Letters 164 (2015) 94–99 [12] Abida O, Gargouri B, Ben Mansour R, Mseddi-Djemal M, Masmoudi A, Ben Ayed M, et al. Biomarkers of oxidative stress in epidermis of Tunisian pemphigus foliaceus patients. J Eur Acad Dermatol Venereol 2012. [13] Tron F, Gilbert D, Mouquet H, Joly P, Drouot L, Makni S, et al. Genetic factors in pemphigus. J Autoimmun 2005;24:319–28. [14] Abida O, Zitouni M, Kallel-Sellami M, Mahfoudh N, Kammoun A, Ben Ayed M, et al. Tunisian endemic pemphigus foliaceus is associated with the HLA-DR3 gene: anti-desmoglein 1 antibody-positive healthy subjects bear protective alleles. Br J Dermatol 2009;161:522–7. [15] Favatier F, Bornman L, Hightower LE, Gunther E, Polla BS. Variation in hsp gene expression and Hsp polymorphism: do they contribute to differential disease susceptibility and stress tolerance? Cell Stress Chaperones 1997;2:141–55. [16] Wu YR, Wang CK, Chen CM, Hsu Y, Lin SJ, Lin YY, et al. Analysis of heat-shock protein 70 gene polymorphisms and the risk of Parkinson’s disease. Hum Genet 2004;114:236–41. [17] Ramachandran S, Bell RB. Heat shock protein 70 gene polymorphisms and multiple sclerosis. Tissue Antigens 1995;46:140–1. [18] Pablos JL, Carreira PE, Martín-Villa JM, Montalvo G, Arnaiz-Villena A, GomezReino JJ. Polymorphism of the heat shock protein gene HSP 70-2 in systemic lupus erythematosus. Br J Rheumatol 1995;34:721–3. [19] Jarzabek-Chorzelska M, Jablonska S, Kolacinska-Strasz Z, Sulej I. Immunopathological diagnosis of pemphigus foliaceus. Dermatology 2002;205:413–5. [20] Vinasco J, Beraun Y, Nieto A, Fraile A, Pareja E, Mataran L, et al. Heat shock protein 70 gene polymorphisms in rheumatoid arthritis. Tissue Antigens 1997;50:71–3. [21] Shi YY, He L. SHEs is, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 2005;15:97–8.
99
[22] Li G, Lu X. Comments on: a review on empirical likelihood methods for regression. Test (Madr) 2009;18:463–7. ˜ [23] Vargas-Alarcón G, Granados J, Martínez-Laso J, Gómez-Casado E, Zuniga J, Salgado N, et al. Lack of association between the polymorphism at the heat-shock protein (HSP70-2) gene and systemic lupus erythematosus (SLE) in the Mexican mestizo population. Genes Immun 2000;1:367–70. [24] Partanen J, Milner C, Campbell RD, Maki M, Lipsanen V, Koskimies S. HLA-linked heat-shock protein 70 (HSP70–2) gene polymorphism and celiac disease. Tissue Antigens 1993;41:15–9. [25] Afzal AR, Mandal K, Nyamweya S, Foteinos G, Poloniecki J, Camm AJ, et al. Association of Met439Thr substitution in heat shock protein 70 gene with postoperative atrial fibrillation and serum HSP70 protein levels. Cardiology 2007;110:45–52. [26] Fekete A, Treszl A, Toth-Heyn P, Vannay A, Tordai A, Tulassay T. Association between heat shock protein 72 gene polymorphism and acute renal failure in premature neonates. Pediatr Res 2003;54:452–5. [27] Pociot F, Rønningen KS, Nerup J. Polymorphic analysis of the human MHC-linked heat shock protein 70 (HSP70-2) and HSP70-Hom genes in insulin-dependent diabetes mellitus (IDDM). Scand J Immunol 1993;38: 491–5. [28] Milner CM, Campbell RD. Polymorphic analysis of the three MHC-linked HSP70 genes. Immunogenetics 1992;36:357–62. [29] Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, et al. The structure of haplotype blocks in the human genome. Science 2002;296: 2225–9. [30] Thomas DC, Stram DO, Conti D, Molitor J, Marjoram P. Bayesian spatial modeling of haplotype associations. Hum Hered 2003;56:32–40.
