Isolation and characterization of porcine circumvallate papillae cells.

G Model ACTHIS-50900; No. of Pages 10

ARTICLE IN PRESS Acta Histochemica xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Acta Histochemica journal homepage: www.elsevier.de/acthis

Isolation and characterization of porcine circumvallate papillae cells Zhi-Qi Zhang a,1 , Gang Shu a,1 , Xiao-Tong Zhu a , Li-Na Wang a , Qiang Fu a , Lian-Jie Hou a , Song-Bo Wang a , Ping Gao a , Qian-Yun Xi a , Yong-Liang Zhang a , Lin Yu b , Ji-Rong Lv b , Qing-Yan Jiang a,∗ a b

College of Animal Science, South China Agricultural University, Guangzhou 510642, China DadHank (Chengdu) Biotech. Corp. Wenjiang Cross-strait Technology Industry Development Park, Chengdu 611130, China

a r t i c l e

i n f o

Article history: Received 5 May 2014 Received in revised form 8 August 2014 Accepted 10 August 2014 Available online xxx Keywords: Intracellular calcium Pig Primary culture Taste receptor cells

a b s t r a c t Animal food intake is primarily controlled by appetite, which is affected by food quality, environment, and the management and status of animal health. Sensing of taste is mediated by taste receptor cells and is central to appetite. Taste receptor cells possess distinctive physiological characteristics that permit the recognition of various stimuli in foods. Thus, cultures of porcine circumvallate papillae cells provide a model for identification of the molecular and functional characteristics of taste receptor cells. In this study, we described the isolation and culture of porcine circumvallate papillae, using tissue explants and enzymatic digestion, and showed continuous viability and expression of pivotal taste marker proteins for more than 9 passages. In addition, cultured cells showed dramatic rises in intracellular calcium upon stimulation with several taste stimuli (sweet, umami, bitter, and fat). These cultures of porcine taste receptor cells provide a useful model for assessing taste preferences of pigs and may elucidate interactions between various taste stimuli. © 2014 Elsevier GmbH. All rights reserved.

Introduction Feeding is a basic physiological process for growth and development of all animals. Pig appetite is determined by taste, smell, texture perceptions of the feed, the nutritional and physiological status of the animal, as well as environmental conditions (Hellekant and Danilova, 1999; Garcia-Bailo et al., 2009). Taste is a reliable and effective platform for recognizing and distinguishing key dietary components that can be used to ensure that pigs choose feeds that are appropriate for their nutritional requirements (Chandrashekar et al., 2006; Roura et al., 2008; Solà-Oriol, 2008). Moreover, taste regulates appetite by interacting with the central nervous system (CNS) and the gastrointestinal (GI) tract (Hagan and Niswender, 2012). Therefore, investigations of porcine taste functions may lead to interventions that stimulate voluntary feed intake and increase the efficiency of pork production. Chemosensory mechanisms of taste depend on taste receptor cells (TRCs) that are located in taste buds, which are predominantly found in fungiform, foliate, and circumvallate papillae (CV) of the oral cavity. Among these, type I cells are involved in

∗ Corresponding author. E-mail address: [email protected] (Q.-Y. Jiang). 1 These authors contributed equally to this work.

neurotransmitter inactivation (Lawton et al., 2000), and type II cells express the G-protein ␣-gustducin, phospholipase C-␤2 (PLC-␤2), and the transient receptor potential channel M5 (TRPM5), which have been associated with the transduction of sweet, umami, and bitter taste responses (Kinnamon, 2009; Clapp et al., 2001; Pérez et al., 2002). Type III cells mediate the perception of sour tastes (Huang et al., 2008), and type IV or basal cells are generally considered taste receptor stem cells that differentiate into other cell types (Sullivan et al., 2010). In addition to the five classic tastes, novel candidate tastes have been identified in CV cells, including fats, and their respective receptors CD36, G protein-coupled receptors 40 (GPR40) and GPR120 (Laugerette et al., 2005; Boughter and Bachmanov, 2007; El-Yassimi et al., 2008; Matsumura et al., 2009; Cartoni et al., 2010; Simons et al., 2011). Taste systems vary among species (Barlow and Northcutt, 1994) and pigs reportedly have higher numbers of taste buds than other species (Chamorro et al., 1993). Accordingly, the posterior area of the pig’s tongue has >10,000 taste buds in CVs, compared with 6000 in CVs of human tongues (Tuckerman, 1888). Recently, isolation and sustained cultures of TRCs have facilitated in vitro studies of taste bud functions in rodents (Ozdener et al., 2006; Qin et al., 2010; Sako et al., 2011) and human taste cells (Ozdener et al., 2011), however, no reports show taste cell functions in pigs. Thus, in the present study, we established an efficient and reproducible protocol for isolating and purifying TRCs from porcine CVs and showed

http://dx.doi.org/10.1016/j.acthis.2014.08.002 0065-1281/© 2014 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Zhang Z-Q, et al. Isolation and characterization of porcine circumvallate papillae cells. Acta Histochemica (2014), http://dx.doi.org/10.1016/j.acthis.2014.08.002


ARTICLE IN PRESS Z.-Q. Zhang et al. / Acta Histochemica xxx (2014) xxx–xxx

2

molecular and physiological properties that are consistent with those in previously described mature taste cells. In addition, cytosolic calcium responses to individual taste stimuli were shown. The present methods provide the basis for the development of porcine taste cell models that can be used to investigate taste papillae in pigs, and may permit the development of more palatable diets that enhance pig health and productivity. Materials and methods Isolation and primary cell culture Animal slaughter experiments were conducted in accordance with the guidelines of Guangdong Province and the Review of Welfare and Ethics of Laboratory Animals, and were approved by the Guangdong Province Administration Office of Laboratory Animals (GPAOLA). All animal procedures were conducted under the protocol SCAU-AEC-2010-0416, which was approved by The Institutional Animal Care and Use Committee (IACUC) of South China Agricultural University. Landrace pigs, 5–7 days old, were euthanized using intraperitoneal injections of pentobarbital sodium (50 mg/kg body weight) followed by exsanguination. Tongues were dissected and CVs were obtained according to previous rodent and human studies (Ozdener et al., 2006, 2011). Briefly, CVs were gently peeled from the underlying muscle layer using ophthalmic forceps and were transferred into Iscove’s modified Dulbecco’s medium (IMDM, Life Technologies, Grand Island, New York, NY) containing 10% fetal bovine serum (FBS, Life Technologies, Stoughton, MA, USA), a 1:5 ratio of MCDB153 (Sigma-Aldrich, St. Louis, MO, USA), 10 ng/mL insulin, and antibiotics (100,000 U/L penicillin sodium and 100 mg/L streptomycin sulfate). Non-taste epithelial membranes, which comprise ␣-gustducin-negative epithelial cells wrapped around putative chemoreceptive cells, were gently peeled from the tissue and CVs were cut into small pieces using ophthalmic forceps. Samples of each CV were seeded in serum drops onto 35-mm-round plates coated with soluble 1 mg/mL rat tail collagen type I in 0.1 M acetic acid (Sigma-Aldrich) or poly-d-lysine at 37 ◦ C under a humidified atmosphere containing 5% CO2 . Serum was replenished with fresh IMDM after 4 h. Alternatively, CV samples were treated with digestion solution containing 0.2% type II collagenase for 2 h at 37 ◦ C in a shaking water bath. Digests were filtered through 70 ␮m of sterile nylon mesh filters and were then centrifuged at 800 rpm for 10 min. Cells were rinsed and centrifuged at 800 rpm for 5 min, were resuspended in 15 mL of IMEM and plated in 35-mm-round plates coated with rat tail collagen type I or poly-d-lysine, and were maintained at 37 ◦ C in a humidified atmosphere containing 5% CO2 . Culture medium was replaced after 48 h, and upon reaching full confluence after 6 days culture, cells were harvested using EDTA/trypsin and were reseeded in T75 culture flasks (Corning, NY, USA) coated with rat tail collagen type I (passage 1). Cultured porcine CVs cells were maintained in T75 flasks for up to 9 passages, and cell stocks were frozen at −80 ◦ C for subsequent experiments. Cell viability was assessed by staining with 0.04% Trypan Blue (Sigma-Aldrich). Quantitative PCR After thawing, cryopreserved TRCs of the 9th passages were lysed in 6-well plates using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Subsequently, genomic DNA was digested using RNase-free DNase I (Takara Bio., Shiga, Japan). Following this, 2 ␮g of total RNA was reverse transcribed using the random primer N10 and murine moloney leukemia virus reverse transcriptase (MMLV, Promega, Madison, WI, USA). PCR primers for selected genes (Table 1) were designed

using Primer Premier 5. SYBR Green Real-time PCR Master Mix reagents (Toyobo Co., Osaka, Japan) and sense and antisense primers (200 nM for each gene) were used for quantitative polymerase chain reaction (PCR) analyses at a final volume of 20 ␮L, and ␤-actin mRNA was used as an internal control. Real-time PCR reactions were performed using a Mx3005p instrument (Stratagene, La Jolla, CA, USA), and thermal cycling was performed as follows: 95 ◦ C for 1 min, followed by 40 cycles of denaturation at 95 ◦ C for 15 s, annealing at various temperatures for 15 s, and extension at 72 ◦ C for 40 s. Western blotting Porcine circumvallate papillae, foliate papillae, and cryopreserved TRCs of the 9th passages were extracted using radio immunoprecipitation assay lysis buffer (Beyotime, Shanghai, China) containing protease inhibitor cocktail (Roche, Basel, Switzerland). Homogenates were centrifuged at 12,000 rpm for 5 min at 4 ◦ C, and protein concentrations were determined in supernatants using BCA protein assay reagent kits (Pierce, Rockford, IL, USA). Protein samples were subjected to 20% SDS (Beyotime, Shanghai, China) and were degenerated for 10 min at 99 ◦ C. Subsequently, 30 ␮g of protein samples were separated by electrophoresis at 110 V for 75 min using running buffer containing 0.025 M Tris base, 0.192 M glycine, and 0.1% SDS, (pH 8.3). Prestained molecular weight markers (Invitrogen, Carlsbad, CA, USA) were used to determine the molecular weights of the protein bands. Proteins were subsequently electrotransferred onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA) using transfer buffer containing 25 mM Tris base, 192 mM glycine, and 10% methanol at pH 8.1–8.3. Membranes were blocked for 1.5 h using 5% (v/v) non-fat milk at room temperature and were then incubated overnight at 4 ◦ C with polyclonal rabbit anti-gustducin (Gagust, I20; sc-395, diluted 1:500, Santa Cruz Biotechnology, Santa Cruz, CA, USA), polyclonal rabbit anti-PLC␤-2 (Q-15; sc-206, dilution 1:500, Santa Cruz Biotechnology), polyclonal rabbit anti-GPCR TAS1R2 (ab79229, dilution 1:1000, Abcam, Cambridge, UK), polyclonal rabbit anti-GPR40 (FL-300; sc-32905, dilution 1:500, Santa Cruz Biotechnology), polyclonal rabbit anti-GPR120 (H155; sc99105, dilution 1:500, Santa Cruz Biotechnology), or anti-CD36 antibodies (ab137320, dilution 1:1000, Abcam). Membranes were then washed five times for 3 min in Tris-buffered saline containing Tween-20, followed by incubation for 1 h with horseradish peroxidase-labeled goat anti-rabbit IgG (Santa Cruz Biotechnology) at a dilution of 1:1000. Finally, chemiluminescent bands were visualized on membranes using a FluorChemTM M System (Santa Clara, CA, USA). Immunocytochemistry Porcine circumvallate papillae were fixed in 4% paraformaldehyde (PFA) in phosphate buffered saline (PBS; pH 7.0) overnight at 4 ◦ C, were immersed overnight in PBS containing 30% sucrose, and were then frozen in liquid nitrogen. Subsequently, 9–10 mm of sample sections were cut. Cryopreserved TRCs of the 9th passages were washed in PBS and fixed with 4% PFA for 30 min at room temperature. Cells were permeabilized using 0.5% Triton-X 100 (Sigma-Aldrich, St. Louis, MO, USA) in PBS for 30 min and were rinsed twice in 0.01 M citric acid buffer for 5 min in a microwave on high heat. After rinsing three times in PBS for 5 min, cells were blocked using 10% goat serum (Invitrogen, Carlsbad, CA, USA) for 30 min and were incubated overnight with primary antibodies, according to the above procedure at 4 ◦ C. Cells were then washed three times in PBS and were incubated with the corresponding Cy3-conjugated goat anti-rabbit IgG (Abcam, Cambridge, UK) at a dilution of 1:300 for 1 h at room temperature. Finally, cells were




3

Table 1 Primers and conditions used for detecting taste-specific molecules. Genes

GenBank no.

Sequence(5 –3 )

Expected size (bp)

␤-actin

DQ452569.1

185

Alpha-gustducin

XM 003130228.1

PLC-␤2

XM 003480407.1

T1R3

NM 001113288.1

GPR120

HQ662564.1

CD36

NM 001044622.1

F: 5 CCACGAAACTACCTTCAACTC 3 R: 5 TGATCTCCTTCTGCATCCTGT 3 F: 5 GAATGTTCGATGTAGGTGGG 3 R: 5 GATAGAATGGAGGTGGTTGC 3 F: 5 ACCCTTTCTATTACGGTGATATCTG 3 R: GGCATCAAGATCTTCTCAAAGAC 3 F: 5 GCTGTGGAGGAAATCAACAAC 3 R: 5 GGTACTGCGTGTAGTCGCAG 3 F: 5 CTCTTCCTGCTCATGATCTCCTTC 3 R: 5 GTGACATGTTGTAGAGAATGGGGTT 3 F: 5 AACAGGCACGGAAGTTTACAG 3 R: 5 CATTGGGCTGTAGGAAAGAGAC 3

exposed to 4 ,6-diamino-2-phenylindole (DAPI) at a dilution of 1:1000 in the blocking solution for 10 min at room temperature. Negative controls were established using PBS and a non-specific IgG instead of primary antibodies. Antibody-stained cells were then examined under a Leica TCSSP2 spectral confocal microscope (Leica Microsystems, Wetzlar, Germany) (Ozdener et al., 2011).

208 191 169 178 206

corresponding fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG-FITC (Sigma-Aldrich) at a dilution of 1:200 in solution B. Cells were then washed twice in PBS and were centrifuged at 250 × g for 5 min Flow cytometry analysis were performed using an FACS Calibur cytometer (BD Biosciences, San Jose, CA, USA). Intracellular Ca2+ responses to chemical stimuli

Flow cytometry analysis Cell-specific antigen expression of the guanine nucleotidebinding protein (G protein) alpha subunit, which plays an important role in transduction of bitter, sweet, and umami taste, was examined in porcine circumvallate TRCs using flow cytometry analyses (FACS). Fix & Perm® cell permeabilization kit reagents (Caltag Laboratories, San Francisco, CA, USA) were used to fix (reagent A) and permeabilize (reagent B) the suspended cells and stain the cytoplasmic antigens ␣-gustducin. Cryopreserved TRCs of the 9th passages were harvested using 0.125% trypsin–EDTA solution, and 1 × 106 cells were added to the fluorescence-activated cell sorter (FACS) tubes. Cells were then centrifuged for 5 min at 250 × g and were washed once in PBS for 5 min at 250 × g. Cells were then incubated at room temperature for 15 min in 100 ␮L of reagent A from the Fix & Perm kit in the dark, and were washed once in reagent B from the Fix & Perm reagent kit for 10 min at 250 × g. Cells were then incubated at room temperature for 15 min in the dark with 100 ␮L of reagent B, and then for 30 min at room temperature in the dark with rabbit anti-␣-gustducin antibody (LS-C166554; Lifespan Biosciences, Seattle, WA, USA) in reagent B. Cells were then washed twice in PBS and were centrifuged at 250 × g for 5 min. Subsequently, cells were incubated with the

Changes in intracellular calcium concentrations ([Ca2+ ]i) were measured using Fluo-3 AM (dissolved in DMSO, 0.2% v/v in Ca2+ free HBSS) as a Ca2+ indicator, and were expressed as relative fluorescence intensity. Cryopreserved TRCs of the 9th passages were grown for 2–4 days in a confocal imaging special glass bottom plate, and were then incubated with 2 ␮M of Fluo-3 AM and 0.02% Pluronic F127 (to dissolve Fluo-3 and prevent aggregation) at 37 ◦ C for 30 min. Stimuli included 2 mM denatonium, 1 mM sucralose, 3 mM sodium glutamate, or 300 ␮M oleic acid (pre-complexed with 60 ␮M FA-free bovine serum albumin), and they were dissolved in Ca2+ -free HBSS that was adjusted for pH and osmolality when necessary. After washing, cells were treated with different stimuli, and changes in cellular [Ca2+ ]i concentrations were detected using a Leica TCS-SP2 spectral confocal microscope (Leica Microsystems, Wetzlar, Germany) as described above. Scanning was performed at 1-s intervals using a 488-nm excitation argon laser, and changes in the fluorescence intensity were monitored in real time and plotted. Subsequently, cell responses were analyzed using custom software to identify cells with significant changes in intracellular calcium as described previously (Ozdener et al., 2011). All flow cytometry analyses were performed using a CytomicsTM FC500 Flow Cytometer (Beckman Coulter, Brea, CA, USA) with

Fig. 1. Attachment and morphology of cultured porcine taste receptor cells in tissue explant culture. Primary cell cultures from the tissue explant culture method were grown on collagen type I-coated plates and were imaged after 2 (A), 3 (B), 6 (C), and 9 days (D). Scale bars = 50 ␮m.




4

Fig. 2. Attachment and morphology of cultured porcine taste receptor cells after enzymatic digestion. Cells were isolated using enzymatic digestion, and primary cultures were grown on collagen type I-coated plates and were imaged after 3 (A), 4–6 (B, C and D), and 9–12 days (E and F). Spindle cells were interspersed with small numbers of non-taste cells (G) that had differing digestion rates (H). Subcultured cell populations were grown on collagen type I-coated plates and were imaged after 1 (I), 2 (J), 4 (K), and 8 days (L). Cryopreserved cells had appropriate morphology after thawing and subsequent culture. Scale bars = 50 ␮m.

a 15 mW argon laser at 488 nm. The instrument was set up to measure forward angle scattered light (FS), side angle scattered light (SS), and Fluo-3 (FL1) chemiluminescence. Correlated histograms and list mode data were collected for the logarithmically amplified signals FS, SS, and Fluo-3. Results Isolation and primary culture of porcine TRCs TRCs were successfully isolated from tissue explants and enzyme digests of porcine CVs. TRCs did not adhere to plates coated with poly-d-lysine, but rapidly adhered to plates coated with collagen type I. Using the tissue explant culture method, small pieces of porcine CVs tissues adhered to the bottom of the culture flask within 4 h of culture, and multipolar cells proliferated outward from the pieces in the first 2 d, reaching 80%

confluence in 3–6 days (Fig. 1A–C) and complete confluence in 9 days (Fig. 1D). Cells from enzyme digests began to adhere by day 3 (Fig. 2A), small colonies gradually increased in number after 6–9 days (Fig. 2B–E), and cultures typically reached confluence by day 12 (Fig. 2F). Cell cultures contained small numbers of nontaste cells (Fig. 2G), which were separated according to digestion rates (Fig. 2H). Cells derived from either isolation method maintained proliferative activity for 9 passages, and cryopreserved cells had similar morphology to cells of primary cultures (Fig. 2I–L). Staining with Trypan Blue showed 96–98% viability for over 9 passages. Taste specific marker gene expression in porcine TRCs Porcine TRCs were identified using real-time PCR and Western blot analyses of several taste-specific markers. In these experiments, cryopreserved porcine TRCs of the 9th passages expressed

Fig. 3. Expression of flavor related mRNAs in cultured porcine taste receptor cells. Transcription of ␤-actin, ␣-gustducin (G␣), phospholipase C-␤2 (PLC-␤2 ), T1R3, GPR120, and CD36 was determined using PCR (A), and relative mRNA expression in cultured porcine circumvallate taste receptor cells was calculated (B). After transcription from total RNA, cDNA was amplified using intron-spanning specific primers. PCR products had expected sizes and were confirmed by sequencing; Lane 1, negative control; lane 2, ␤-actin; lane 3, target genes; M—Marker 2000.




5

Immunocytochemical identification of taste cell markers in porcine TRCs Porcine circumvallate papillae tissue and TRCs isolated from them were examined for the presence of specific taste cell markers using standard immunocytochemical techniques. Staining circumvallate papillae tissue with ␣-gustducin and PLC-␤2 antibodies indicated the presence of both proteins (Fig. 5A and B, respectively), and the typical type II taste signaling molecules ␣-gustducin (Fig. 6A) and PLC-␤2 (Fig. 6B) were detectable in cryopreserved porcine TRCs until the 9th passage. The sweet receptor T1R2, and lipid sensor proteins GPR40, GPR120, and CD36 (Fig. 6C–F) were also expressed in TRCs, and no reactivity was observed when primary antibodies were substituted with PBS or nonspecific IgG. These data demonstrate that the present TRCs can be cultured for several months without loss of mature taste cell markers. Fig. 4. Protein expressions of specific taste markers in cultured porcine taste receptor cells. Western blot analyses showed expressions of ␣-gustducin (G␣), PLC␤2 , T1R2 (Sweet receptor), GPR40, GPR120, and CD36 (lipid sensors) proteins in freshly isolated porcine tongue foliate and circumvallate tissue (B). Similar results were observed in cultured porcine taste receptor cells (TRCs) (A) but not in non-taste lingual epithelium (B); F—foliate papillae; V—circumvallate papillae; NTE—nontaste lingual epithelium.

taste receptor subunits (T1R3), the type II taste cell markers ␣gustducin and PLC-␤2 , and the lipid sensor proteins GPR120 and CD36 (Fig. 3A1 and A2). Furthermore, the taste-signaling components, ␣-gustducin and PLC-␤2 , and the proteins T1R2, GPR40, GPR120, and CD36 were simultaneously detected in isolated TRCs (Fig. 4A), which is consistent with that in porcine circumvallate and foliate papillae tissues, but not in non-taste lingual epithelium (Fig. 4B).

Assessment of ˛-gustducin-positive cell purity in porcine TRCs Isolated porcine TRCs were interspersed with small numbers of non-taste cells. However, the purity of porcine TRCs was markedly improved by exploiting differential digestion rates of taste and non-taste cells. Subsequently, cell populations were identified based on their properties using forward scatter (FSC)/side scatter (SSC) plots (Fig. 7A), and interference from negative cells was eliminated (Fig. 7B). These flow cytometry experiments showed that ␣-gustducin-positive cells comprised 99.34% of isolated TRCs (Fig. 7C). Intracellular Ca2+ responses to chemical stimuli Responses of cryopreserved porcine TRCs until the 9th passage were tested using stimuli that correspond to bitter (denatonium), sweet (sucralose), umami (sodium glutamate), and fat

Fig. 5. Immunostaining of taste cell-specific biomarkers in porcine circumvallate papillae. Images were acquired using a Leica TCS-SP2 confocal laser scanning microscope. Immunoreactivity was observed for ␣-gustducin (G␣) (red in (A)) and PLC-␤2 (red in (B)) in circumvallate papillae. Scale bars = 50 ␮m; blue fluorescence indicates nuclei.


G Model ACTHIS-50900; No. of Pages 10 6


Fig. 6. Immunostaining of taste cell-specific biomarkers in cultured cells. Images were acquired using a Leica TCS-SP2 confocal laser scanning microscope. Immunoreactivity was observed for ␣-gustducin (G␣) (red in (A)) and for phospholipase C-␤2 (PLC-␤2 ) (red in (B)) in cultured cells. T1R2 (red in (C)), CD36 (red in (D)), GPR40 (red in (E)), and GPR120 (red in (F)) proteins were also observed in taste receptor cells. Scale bars = 50 ␮m; blue fluorescence indicates nuclei. Immunostaining with non-specific IgG demonstrated the absence of non-specific immunoreactivity.

(oleic acid) flavors using the intracellular Ca2+ -sensitive dye Fura-3 AM. Cultured cells exhibited increased [Ca2+ ]i levels in response to all stimuli. Overall response frequencies were similar for all independent culture preparations, and the highest frequency of responses was elicited by 3 mM sodium glutamate (2.22%; Table 2). A representative trace of the sodium

glutamate inducing transient increases in [Ca2+ ]i is shown in Fig. 8A. Treatments with 3 mM denatonium (Fig. 8B) and 0.3 mM oleic acid (Fig. 8C) increased [Ca2+ ]i responses in 1.67% and 1.19% of tested cells, respectively (Table 2), whereas the artificial sweetener sucralose (1 mM; Fig. 8D) increased [Ca2+ ]i responses in only 0.7% of tested cells (Table 2).




7

Fig. 7. Identification of ␣-gustducin-positive cells using flow cytometry. (A) Cell populations were identified using forward scatter (FSC)/side scatter (SSC) plots. (B) Interference from negative cells was eliminated. (C) Target cells expressed ␣-gustducin.

However, representative traces of transient increases in [Ca2+ ]i were obtained following stimulation with denatonium (bitter), sucralose (sweet), sodium glutamate (umami), or oleic acid (fat; Fig. 8E).

Discussion Animals choose appropriate foods for nutritional requirements using taste (Chandrashekar et al., 2006; Roura et al., 2008; Solà-

Fig. 8. Cultured taste cells respond to bitter, sweet, umami, and fatty acid stimuli. Changes in intracellular calcium levels ([Ca2+ ]i) in cultured porcine circumvallate papillae taste receptor cells were measured using Fura-3 AM. Fluorescence intensity was recorded at excitation and emission wavelengths of 488 and 526 nm, respectively. Graphs show changes in [Ca2+ ]i levels in representative cells during exposure to (A) umami (3 mM sodium glutamate), (B) bitter (2 mM denatonium), (C) fatty acid (0.3 mM oleic acid) and (D) sweet (1 mM sucralose). [Ca2+ ]i responses were not seen in all cells with all stimuli (E).




8

Table 2 Frequencies of cultured porcine circumvallate taste cell responses to chemical stimuli. Stimuli

Response frequency(%)

3 mM Sodium glutamate 2 mM Denatonium 0.3 mM Oleic acid 1 mM Sucralose

2.22 1.67 1.19 0.7

Positive cells/total cellsa 144/6485 116/6957 202/16,913 98/9686

Responses of Fluo-3 AM stained taste receptor cells to bitter (denatonium), sweet (sucralose), umami (sodium glutamate), and fatty acid (oleic acid) were determined using CytomicsTM FC500 flow cytometry with a 15 mW argon laser tuned at 488 nm. The instrument was set up to measure forward-angle scattered light (FS), side-angle scattered light (SS), and Fluo-3 (FL1). Correlated histograms and list mode data were collected for the logarithmically amplified signals FS, SS, and Fluo-3. a Positive taste cells on behalf of taste cells that responded to chemical stimuli.

Oriol, 2008). Hence, long-term culture of TRCs that respond to various stimuli is an important cytological tool for flavor studies. Tissue block primary cultures of rodent CVs TRCs (Ozdener et al., 2006; Qin et al., 2010) and human fungiform papillae TRCs have been successfully isolated and studied (Ozdener et al., 2011). CVs in mammals contain reportedly few taste buds at birth and increasing numbers with age (Harada and Kanemaru, 2005). Moreover, lower rates of cell turnover were observed in taste cells of newborn and juvenile rats compared with taste cells of adult rats, indicating longer life spans of taste cells in juveniles than in adults (Bigiani et al., 2002). Additionally, CVs were evident in 1–3-day-old rats, and corresponding taste buds were comparable to those of adult animals after 1 week of post-natal life (Sbarbati et al., 1999). In the present study, we isolated TRCs from pigs at 5 days using tissue block cultures and enzyme digests of two CVs that were found in the caudal third and dorsum of the tongue (Kumar and Bate, 2004). Enzymatic digestion was more effective than tissue block cultures, and attachment efficiency of tissue blocks varied from 30% to 50%. Moreover, cells were sometimes unable to grow outward from the tissue pieces due to mechanical damage during isolation and plating. Accordingly, effective multipassage cell culture of porcine TRCs was dependent on microenvironmental features, and primary culture taste cells lost various constituents that are present in intact taste buds, such as growth factors and epithelial cells (Ruiz et al., 2001; Ozdener et al., 2006, 2011). In agreement with previous studies (Ozdener et al., 2006, 2011), IMDM supplemented with 20% MCDB 153, 10% FBS, and 10 ng/mL insulin was sufficient for porcine TRC growth to partial maturity. Rat TRCs reportedly adhere to plates coated with poly-d-lysine (Ozdener et al., 2006). However, we found that porcine TRCs only adhered onto plates coated with rat type I collagen, potentially reflecting differences between TRCs from pigs and other animals. Several types of cells have been described in mammalian taste buds, including type I, II, III, and basal cells, which can be distinguished by their molecular characteristics (Delay et al., 1986). In the present study, these cells were interspersed with small numbers of non-taste cells, which are more sensitive to digestion. Thus, we successfully purified isolated porcine TRCs using differential digestion. Isolated cells exhibited functional properties of typical type II cell features, including the expression of signaling molecules, such as ␣-gustducin and PLC-␤2, which have been implicated in the transduction of sweet, umami, and bitter taste responses (Clapp et al., 2001; Pérez et al., 2002; Kinnamon, 2009). During signal transduction, triggered taste receptors cooperate with ␣-gustducin to activate PLC-␤2 and second messengers such as diacylglycerol (DAG) and IP3 are produced (McLaughlin and McKinnon, 1992; Dotson et al., 2005). Finally, intracellular calcium concentrations are increased by the actions of DAG and IP3, and they mediate sensory responses in TRCs. Previous reports show the presence of ␣-gustducin (Laugerette et al., 2005) and PLC-␤2 (Matsumura

et al., 2009) in TRCs throughout taste buds. Moreover, in accordance with previous studies of human and rat TRCs (DeFazio et al., 2006; Ozdener et al., 2006, 2011), the present RT-PCR, Western blotting, and immunochemical analyses showed high expression of both ␣-gustducin and PLC-␤2 in cryopreserved TRCs until the 9th passage. TRCs in taste buds generally comprise 50% type I cells (Paran et al., 1975), 25% type II cells (McLaughlin and McKinnon, 1992; Pérez et al., 2002) and 15% type III cells (Huang et al., 2008). However, the percentages of type II taste cells were increased in the present cultured TRCs. In a previous report, approximately 60% of cultured human fungiform cells expressed ␣-gustducin and were identified as type II taste cells. In comparison, the present flow cytometric analyses demonstrated that 99.34% of porcine TRCs expressed ␣-gustducin. This high percentage of type II cells may reflect their high adherence and low relative digestion rates. Type II cells respond to taste stimuli, and several studies have demonstrated that transient increases in intracellular calcium reflect important physiological properties of dissociated taste cells (Zhao et al., 2002) from taste bud sections (Caicedo et al., 2000; Zhao et al., 2002), cultured rodent TRCs (Ozdener et al., 2006; ElYassimi et al., 2008), and cultured human TRCs (Ozdener et al., 2011). Similarly, primary porcine TRCs expressed these signaling molecules, and showed typical [Ca2+ ]i responses to denatonium, sucralose, and sodium glutamate. These observations indicate that the present primary porcine TRCs were physiologically mature type II taste cells that can be used as a cell model in further functional studies. In addition to primary flavors, fat has recently been considered as the flavor for dietary lipids, which have high nutritional energy density and provide essential fatty acids and fat-soluble vitamins. Dietary lipids were traditionally thought to be detected only by trigeminal (texture perception) and retronasal olfactory cues (Mela, 1988). However, several recent studies have strongly suggested that gustation significantly affects lipid perception, particularly that of long-chain fatty acids (Baillie et al., 1996; Gilbertson, 1998; Takeda et al., 2001; Fukuwatari et al., 2003; Hiraoka et al., 2003; Kawai et al., 2003; Zhang et al., 2003; Gaillard et al., 2008). Furthermore, it has been shown that taste buds express CD36, GPR120, and GPR40, which mediate taste preferences for fats (Matsumura et al., 2009; Cartoni et al., 2010). In circumvallate papillae, CD36 and GPR40 were mainly localized to the pores of taste buds (Laugerette et al., 2005; Cartoni et al., 2010; Simons et al., 2011), and similar to ␣-gustducin and PLC-␤2, GPR120 was widely distributed in circumvallate papillae (Matsumura et al., 2009). The differing locations of these proteins might reflect diverse roles in the sensing of dietary lipids. Moreover, the lipid sensors CD36, GPR120, and GPR40 were all expressed in porcine TRCs at both mRNA and protein levels, and CD36, GPR120, and GPR40 expressing type II cells were dominant among isolated porcine TRCs. However, a previous study showed that GPR40 is expressed mainly in type I cells in mice (Cartoni et al., 2010). Similarly, primary porcine TRCs also expressed these lipid sensors and showed typical increases in [Ca2+ ]i following stimulation with oleic acid, as shown previously in mice (El-Yassimi et al., 2008; Gaillard et al., 2008). However, further studies are needed to determine whether these fat receptors colocalize with other taste receptors in type II cells, and how porcine TRC sensors mediate lipid taste perceptions. Animal appetite depends on single taste preferences and on interactions of different tastes. Sweet is a well-known hedonic taste in pigs (Roura et al., 2008), and early reports showed that pigs fed ad libitum consistently preferred sucrose and glucose (higher than 90%) in long- and short-term double-choice tests (Kennedy and Baldwin, 1972). In addition, recent studies demonstrate interactions between fat and other tastes. For example, linoleic acid increases preferences for monosodium glutamate and elevates




responses of chorda tympani nerves in rats (Stratford et al., 2008). Pittman et al. (2006) demonstrated that addition of linoleic and oleic acids increases licking responses to sweet solutions and decreases licking responses to sour and bitter solutions. These observations indicate that lipid sensors may enhance the intensity or palatability of sweet and fatty food ingredients, and thus increase the hedonic perceptions of food (Delay et al., 2007). The present data show simultaneous expression of various taste receptors in primary porcine TRCs and associated physiological responses to taste stimuli, providing an in vitro model of taste preferences and their potential interactions. In conclusion, the present cell isolation protocols permit sustained primary culture of cells from porcine circumvallate papillae. The present cells exhibited appropriate functional and molecular characteristics, and they may provide a model system for evaluating taste stimuli and their interactions in pigs. Such studies may elucidate nutrition regulation pathways that can be exploited to improve the health and productivity of domestic pigs.

Acknowledgements This work was supported by the National Natural Science Foundation of China (31272447), the Natural Science Foundation of Guangdong Province of China (S2012020011048), and a Research Fund for the Doctoral Program of Higher Education (20124404130001). We acknowledge the support and helpful discussions from Yusuf and Xian-Bo Deng, and the technical assistance from Na-Na Xiang, Can-Jun Zhu, Bin Zheng, and Fei Gao. Author contributions: ZQ-Z, GS, and QY-J designed the study and wrote the manuscript. ZQ-Z, XT-Z, LN-W, QF, LJ-H, SB-W, and PG performed the experiments. QY-X, YL-Z, LY, and JR-L contributed to reagents, materials and analytical tools.

References Baillie A, Coburn C, Abumrad N. Reversible binding of long-chain fatty acids to purified FAT, the adipose CD36 homolog. J Membrane Biol 1996;153:75–81. Barlow LA, Northcutt RG. Analysis of the embryonic lineage of vertebrate taste buds. Chem Senses 1994;19:715–24. Bigiani A, Cristiani R, Fieni F, Ghiaroni V, Bagnoli P, Pietra P. Postnatal development of membrane excitability in taste cells of the mouse vallate papilla. J Neurosci 2002;22:493–504. Boughter J, Bachmanov A. Behavioral genetics and taste. BMC Neurosci 2007;8:S3. Caicedo A, Jafri MS, Roper SD. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J Neurosci 2000;20:7978–85. Cartoni C, Yasumatsu K, Ohkuri T, et al. Taste preference for fatty acids is mediated by GPR40 and GPR120. J Neurosci 2010;30:8376–82. Chamorro C, De Paz P, Fernández J, Anel L. Fungiform papillae of the pig and the wild boar analyzed by scanning electron microscopy. Scan Microsc 1993;7:313–20. Chandrashekar J, Hoon MA, Ryba NJ, Zuker CS. The receptors and cells for mammalian taste. Nature 2006;444:288–94. Clapp TR, Stone LM, Margolskee RF, Kinnamon SC. Immunocytochemical evidence for co-expression of Type III IP3 receptor with signaling components of bitter taste transduction. BMC Neurosci 2001;2:6. DeFazio RA, Dvoryanchikov G, Maruyama Y, et al. Separate populations of receptor cells and presynaptic cells in mouse taste buds. J Neurosci 2006;26:3971–80.

9

Delay E, Mitzelfelt J, Westburg Ä, Gross N, Duran B, Eschle B. Comparison of l-monosodium glutamate and l-amino acid taste in rats. J Neurosci 2007;148:266–78. Delay RJ, Roper SD, Kinnamon JC. Ultrastructure of mouse vallate taste buds: II cell types and cell lineage. J Comp Neurol 1986;253:242–52. Dotson CD, Roper SD, Spector AC. PLC␤2-independent behavioral avoidance of prototypical bitter-tasting ligands. Chem Senses 2005;30:593–600. El-Yassimi A, Hichami A, Besnard P, Khan NA. Linoleic acid induces calcium signaling Src kinase phosphorylation, and neurotransmitter release in mouse CD36-positive gustatory cells. J Biol Chem 2008;283:12949–59. Fukuwatari T, Shibata K, Iguchi K, Saeki T, Iwata A, Tani K, et al. Role of gustation in the recognition of oleate and triolein in anosmic rats. Physiol Behav 2003;78:579–83. Gaillard D, Laugerette F, Darcel N, El-Yassimi A, Passilly-Degrace P, Hichami A, et al. The gustatory pathway is involved in CD36mediated orosensory perception of long-chain fatty acids in the mouse. FASEB J 2008;22:1458–68. Garcia-Bailo B, Toguri C, Eny KM, El-Sohemy A. Genetic variation in taste and its influence on food selection. OMICS 2009;13:69–80. Gilbertson TA. Gustatory mechanisms for the detection of fat. Curr Opin Neurobiol 1998;8:447–52. Hagan S, Niswender KD. Neuroendocrine regulation of food intake. Pediatr Blood Cancer 2012;58:149–53. Harada S, Kanemaru N. Developmental changes of the taste sensation depending on the maturation of the taste bud and its distribution in mammals. Chem Senses 2005;30: 56–7. Hellekant G, Danilova V. Taste in domestic pig Sus scrofa. J Anim Physiol Anim Nutr 1999;82:8–24. Hiraoka T, Fukuwatari T, Imaizumi M, Fushiki T. Effects of oral stimulation with fats on the cephalic phase of pancreatic enzyme secretion in esophagostomized rats. Physiol Behav 2003;79:713–7. Huang YA, Maruyama Y, Stimac R, Roper SD. Presynaptic (Type III) cells in mouse taste buds sense sour (acid) taste. J Physiol 2008;586:2903–12. Kawai T, Fushiki T. Importance of lipolysis in oral cavity for orosensory detection of fat. Am J Physiol-Reg I 2003;285:447–54. Kennedy J, Baldwin B. Taste preferences in pigs for nutritive and non-nutritive sweet solutions. Anim Behav 1972;20:706–18. Kinnamon SC. Umami taste transduction mechanisms. Am J Clin Nutr 2009;90:753–5. Kumar S, Bate LA. Scanning electron microscopy of the tongue papillae in the pig (Sus scrofa). Microsc Res Tech 2004;63:253–8. Laugerette F, Passilly-Degrace P, Patris B, Niot I, Febbraio M, Montmayeur JP, et al. CD36 involvement in orosensory detection of dietary lipids, spontaneous fat preference, and digestive secretions. J Clin Invest 2005;115:3177–84. Lawton DM, Furness DN, Lindemann B, Hackney CM. Localization of the glutamate–aspartate transporter GLAST, in rat taste buds. Eur J Neurosci 2000;12:3163–71. Matsumura S, Eguchi A, Mizushige T, Kitabayashi N, Tsuzuki S, Inoue K, et al. Colocalization of GPR120 with phospholipase-Cbeta2 and alpha-gustducin in the taste bud cells in mice. Neurosci Lett 2009;450:186–90. McLaughlin SK, McKinnon PJ. Gustducin is a taste-cellspecific G protein closely related to the transducins. Nature 1992;357:563–9. Mela DJ. Sensory assessment of fat content in fluid dairy products. Appetite 1988;10:37–44. Ozdener MH, Yee KK, Cao J, Brand JG, Teeter JH, Rawson NE. Characterization and long-term maintenance of rat taste cells in culture. Chem Senses 2006;31:279–90.


G Model ACTHIS-50900; No. of Pages 10 10


Ozdener MH, Brand JG, Spielman AI, et al. Characterization of human fungiform papillae cells in culture. Chem Senses 2011;36:601–12. Paran N, Mattern CF, Henkin RI. Ultrastructure of the taste bud of the human fungiform papilla. Cell Tissue Res 1975;161: 1–10. Pérez CA, Huang L, Rong M, et al. A transient receptor potential channel expressed in taste receptor cells. Nat Neurosci 2002;5:1169–76. Pittman DW, Labban CE, Anderson AA, O’Connor HE. Linoleic and oleic acids alter the licking responses to sweet, salt, sour, and bitter tastants in rats. Chem Senses 2006;31: 835–43. Qin YM, Shi JQ, Zhang GH, Deng SP, Wang TH. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem 2010;112:107–12. Roura E, Humphrey B, Tedó G, Ipharraguerre I. Unfolding the codes of short-term feed appetence in farm and companion animals. A comparative oronasal nutrient sensing biology review. Can J Anim Sci 2008;88:535–58. Ruiz CJ, Stone LM, McPheeters M, et al. Maintenance of rat taste buds in primary culture. Chem Senses 2001;26:861–73. Sako H, Hori M, Masuho I, Saitoh O, Okada A, Tomooka Y. Establishment of clonal cell lines of taste buds from a p53 (−/−) mouse tongue. In Vitro Cell Dev Biol—Anim 2011;47:333–40. Sbarbati A, Crescimanno C, Bernardi P, Osculati F. ␣-Gustducinimmunoreactive solitary chemosensory cells in the developing

chemoreceptorial epithelium of the rat vallate papilla. Chem Senses 1999;24:469–72. Simons PJ, Kummer JA, Luiken J, Boon L. Apical CD36 immunolocalization in human and porcine taste buds from circumvallate and foliate papillae. Acta Histochem 2011;113:839–43. Solà-Oriol D. Quantitative evaluation of the palatability of feed ingredients in swine. Bellaterra, Spain: Universitat Autònoma de Barcelona; 2008, PhD diss. Stratford JM, Curtis KS, Contreras RJ. Linoleic acid increases chorda tympani nerve responses to and behavioral preferences for monosodium glutamate by male and female rats. Am J PhysiolReg I 2008;295:764–72. Sullivan JM, Borecki AA, Oleskevich S. Stem and progenitor cell compartments within adult mouse taste buds. Eur J Neurosci 2010;31:1549–60. Takeda M, Sawano S, Imaizumi M, Fushiki T. Preference for corn oil in olfactory-blocked mice in the conditioned place preference test and the two-bottle choice test. Life Sci 2001;69:847–54. Tuckerman F. Note on the papillae foliata and other taste areas of the pig. Anat Anz 1888;3:69–73. Zhang X, Fitzsimmons RL, Cleland LG, et al. CD36/fatty acid translocase in rats: distribution, isolation from hepatocytes, and comparison with the scavenger receptor SR-B1. Lab Invest 2003;83:317–32. Zhao F-L, Lu S-G, Herness S. Dual actions of caffeine on voltagedependent currents and intracellular calcium in taste receptor cells. Am J Physiol-Reg I 2002;283:115–29.


Preparation and isolation of a taste bud-derived fraction from bovine circumvallate papillae.

Expression of Prostatic Acid Phosphatase in Rat Circumvallate Papillae.

Characterization and isolation of highly purified porcine satellite cells.

Characterization of fractions from taste bud and non-taste bud-enriched filtrates from and around bovine circumvallate papillae.

Distribution of taste buds on fungiform and circumvallate papillae of bovine tongue.

Isolation and characterization of porcine beta-casein.

The isolation and characterization of porcine enteroviruses.

Degeneration of fungiform and circumvallate papillae following molar extraction in rats.

Pax7neg interstitial cells: isolation, characterization, and long-term culture.

Isolation and characterization of chicken mesangial cells.

Isolation and characterization of antithrombin III from human, porcine and rabbit plasma, and rat serum.

Isolation and partial characterization of serine- and threonine-rich porcine gastric mucus glycopeptides.

Isolation and characterization of porcine somatotropin containing a succinimide residue in place of aspartate129.

Isolation and characterization of multiply antibiotic-resistant Clostridum perfringens strains from porcine feces.

Isolation and characterization of a novel peptide amide from porcine brain.

Isolation and characterization of two peptides with prolactin release-inhibiting activity from porcine hypothalami.

Isolation and characterization of a Korean porcine epidemic diarrhea virus strain KNU-141112.

Isolation and characterization of hepatocytes and Kupffer cells.

Method of isolation and characterization of Girardia tigrina stem cells.

Denver Papillae Protocol for Objective Analysis of Fungiform Papillae.

HDlive imaging of circumvallate placenta.

Approaches to isolation and molecular characterization of disseminated tumor cells.

Isolation and characterization of adult rat hearts cells.

Isolation and Characterization of Human Lung Lymphatic Endothelial Cells.