.=) 1991 Oxford University Press
Nucleic Acids Research, Vol. 19, No. 11 3099
Lack of a requirement for strict rotational alignment transcription factor binding sites in yeast
among
Kaoru Inokuchi* and Akiko Nakayama Laboratory of Molecular Genetics, Mitsubishi Kasei Institute of Life Sciences, 11 Minamiooya, Machida-shi, Tokyo 194, Japan Received December 28, 1990; Revised and Accepted April 23, 1991
ABSTRACT The MFal gene of Saccharomyces cerevisiae is an specific gene whose expression is regulated by two upstream activation sites (UASMFa1s), which are the binding sites for activator proteins, MATal and MCM1. UASMF,1 elements act in a synergistic fashion; lack of either element causes reduced expression levels that are 6- to 45-fold less than that of intact promoter in a cells. We investigated the effect of manipulating rotational alignments among transcription factor binding sites of MFal on the expression of the gene. The expression level of MFa1 decreased with the spacing between the two UASMFa1s and no synergism was observed when the distance of the two elements was longer than 90 base pairs. No strict rotational alignment was required for their synergistic action. We also show that the spacing between UASMFaI elements and TFIID binding site, the TATA box, had little, if any, effect on MFa1 expression. We chose a sufficient number of positions for UASMFa1s to ensure that, in several of these positions, MATal and MCM1 were on the opposite side of the DNA helix with respect to the TATA box. a
INTRODUCTION Most promoters recognized by RNA polymerase II in the yeast Saccharomyces cerevisiae consist of two elements (for review see reference 1). The first element, the TATA box, is usually located within 100 base pairs (bp) upstream of the transcription start point(s) and is the binding site for a component of the basic transcription machinery termed TFIID (2, 3). Binding of TFIID to the TATA box initiates the assembly of the other components of the basic machinery including RNA polymerase II, resulting in a preinitiation complex capable of accurate transcription initiation in vitro (4, 5). A second class of elements, termed upstream activation sites (UASs), is a binding site for a gene specific transcriptional activator protein(s) and determines the efficiency of transcription in response to particular physiological signals (1). UASs are similar to enhancer elements in higher
eukaryotes; they function in both orientations and at variable distances with respect to the TATA box (6, 7). Molecular mechanisms involved in transcription activation are conserved from yeast and mammal. For example, the yeast GAL4 activator can stimulate transcription in mammalian cells depending upon a GAL4 binding sequences (UASG) (8, 9), and the mammalian DNA binding protein Fos activates transcription in yeast (10). Recent studies have revealed that initiation of transcription is facilitated by the interaction of enhancer/UAS sequence with proximal promoter element including the TATA box via proteins bound to the DNA, with the intervening DNA looped out (11-14). The interaction between proteins bound to DNA is thought to be facilitated by the precise alignment of their binding sites along the DNA double helix; proteins bound to the same side of the DNA helix interact with each other much more readily than proteins bound on opposite side of the helix (11, 15-23). We have previously reported the existance of two UASs (UASMFa15S) that confer cell type specific control of MFal expression in Saccharomyces cerevisiae (24). These UASMF,a1S are very similar in sequence and each one is a binding site for two transcription factors, the MATcal gene product and MCMJ gene product (also called PRTF or GRM) (for review see reference 25, and references therein). While the MCMJ gene is expressed in all three cell types, a, a and a/a, the MATal gene is expressed only in cells. The MCM1 protein is thought to be a transcriptional activator, however, MCM1 must act together with the MATa protein to activate the specific genes, cell including MFal (26). Thus, UASMFadS can confer specific expression of the MFal gene. The most intriguing feature of UASMFaI elements is that they act in a synergistic fashion; lack of either element caused reduced expression levels that are 6- to 45-fold less than that of the intact promoter in a cell (24). The UASmFai region contains two sequence directed curvatures, each of which overlaps each UASMFa1 element (27). The relative directions of these curvatures are almost the same, and these curvatured DNAs seem to be involved in transcriptional regulation of specific genes (27). Here we show that no strict rotational alignment is required between the two UASMFaIS for their synergistic action and between UASMFa1l and the TATA box to activate transcription.
* To whom correspondence should be addressed at Center for Neurobiology and Behavior, West 168th Street, New York, NY 10032, USA
a
a
a
a
College of Physicians and Surgeons, Columbia University, 722
3100 Nucleic Acids Research, Vol. 19, No. 11
MATERIALS AND METHODS Spacing mutants between UASmFIAGls Plasmid pAKI039-30 (24) (Figure lA) was used to construct insertion mutants. The construction of insertion plasmids and the nucletide sequence of the inserts were described previously (27). The DNA sequence inserted into the 23 bp insertion mutant at the XmnI site was GCAGATGATCTGCGCGGATCTGC.
Spacing mutants between UASm[a¢Is and TATA box Structure of plasmid pAKI093 is shown in Figure lB. The UAS and TATA box region of pAKI093 was derived from plasmid A-241/-148, in which the XhfoI linker (8mer, CCTCGAGG) was substituted for 95 bp DNA segment between UASMFals and the TATA box (24). Thus, in this case the UASmFals sequences are closer to the TATA box by 87 bp compared with the intact MFal gene. To construct spacing mutants between UASMF,Is and the TATA box, pAKI093 was digested with X7wI, which cut the unique site between UASMFals and the TATA box, and treated with SI muclease or BAL31 nuclease to construct series deletions. To construct insertions, synthetic oligonucleotide was inserted into the XhoI site of pAKI093. All of the DNA sequences of spacing mutants were verified directly by the dideoxy DNA sequencing method (28) using a synthetic primer.
Assay of 3-galactosidase activity Spacing mutant plasmids were introduced into strain DBY746 (MATai his3-A1 leu2-3 leu2-112 ura3-52 trpl-289a) or DBY747 (AlT4 his3-A1 leu2-3 leu2-112 ura3-52 trpl-289a) by the lithium ion method (29). Cells carrying the spacing mutant plasmids were grown with shaling at 30°C in synthetic complete mediun lacldng uracil or lacking leucine (30) to an A6,. of 2 to 3. ,B-Galactosidase activity was assayed as described by Miller (31). RNA analysis Yeast strains were grown to an A6w of 1.0 in synthetic complete medium lacking leucine (30). Preparation of total cellular RNA
A
,
UASMFcl
and S1 muclease mapping were performed as described previously (24). The 5' end labeled DNA fragment used as a probe (probe B) is shown in Figure lB.
Estimation of plasmid copy number Total DNA was isolated quantitatively from yeast strains carrying a spacing mutant plasmid (30), electrophoresed on an agarose gel, transfered to a nitrocellulose filter, and probed with the EcoRI/BamHI fragment (Figure lA, probe A) specific to lacZ which was labeled with [a-32P]dCTP by nick translation (32).
RESULTS To facilitate the MFcil expression assay in vivo, we constructed a UASMFals-TATAcycl-lacZ fusion (plasmid pAKI039-30, reference 24) and a UASMFaIs-TATAmFal-lacZ fusion (plasmid pAK1093) (Figure 1). These fusion genes were carried on a multicopy plasmid replicated from the origin of 2sm plasmid. In pAKI039-30, the UASMFa,I region containing both of the UASMFalS was substituted for the CYCI UASs of the CYCJ-lacZ fusion of plasmid pLGA-312 (33). These fusion genes were regulated normally; they were expressed only in a cells, not in a and a/a cells (Figures 2, 4). A spacing mutant between the two UASmaFls is denoted UUX, where X indicates the insertion length (bp) compared to the wild type MFal gene. The positions of three cis acting elements in MFal are; UASMFaI1 1 at position -367 to -340, UASMFa,12 at -314 to -287 and the TATA box at -128 to -122 (24) (We have numbered the first letter of the initiation codon + 1 throughout this work).
No strict rotational aligment is required for the synergistic action of two UASfsals The distance between the first nucleotides of the two UASMFaIs is 53 bp, just five helical turns assuming 10.5 bp per turn (24). This led us to speculate that the synergistic action of the two UAS,,ials requires rotational alignment between them. We have B
2pm Figure 1. Structure of UASMFI5s-TATAcycI-lacZ (A) and UASMFaIs-TATAMF,I-laCZ (B) fusion plasmids. Ori and 21m refer to the locations of the origins of replication for Escherichia coil and Saccharomyses cerevisiae, respectively. TATAcycI, three functional TATA boxes of the CYCI gene (40); TATAMFGI, a functional TATA box of the MFael gene (24); UASMFQIS, two UASs of the MFal gene (24); B, BamHI; E, EcoRI; Hd, Hird; Xb, XbaI; Xh, X7wI; Xm, XumI. Hindul, XbaI and XVoI, or XmnI sites are not shown in pAKI039-30 and pAKI093, respectively. Arrows indicate the transcriptional orientation of the fusion genes. 32p labeled probes used for assay of plasmid copy number (probe A) and for SI nuclease mapping (probe B) are shown. Closed circle indicates the position of 32p labeled site. Note that drawings are not drawn to scale.
Nucleic Acids Research, Vol. 19, No. 11 3101 tested the effect of varying the distance between UASMFaIs by inserting systematically increasing lengths of spacer DNA. Figure 2 shows a lack of dependence on rotational alignment between UASMFa1s for synergistic function. The most prominent feature of the spacing mutants is that the insertion of DNA segments of increasing length leads to a rapid and drastic
120 0
100 X
36b
80
9\2
( n ~~~~c60 ~~~~~~42
nd
14010 23 -L20
m
3
20
cm~~
0
~
~
~
~
20
10
37
0
30
40
50
Insertion length (bp) Figure 2. Effect of the distance between the two UASMFa1S on their synergistic action. Numbers in the panel correspond to the insetion length (bp). Asterisk shows the (3-galactosidase activity of UASMFa,l2-TATAcycl-lacZ fusion which bears one UASMF,,12 element as UAS. In a cells, 13-galactosidase activities are 1.2, 5.9, 2.9, and less than 0.1 for UU28, UU36b, UU42 and the other spacing mutants, respectively.
decrease in the synergistic action in a cells except for UU28, UU36b and UU42. In a cells, all spacing mutants but these three inserts produced no detectable level of ,3-galactosidase (see Figure 2 legend), indicating that these mutants were regulated normally. Insertions UU28, UU36b and UU42 produced a significant level of 3-galactosidase even in a cells, suggesting that some DNA sequence included in these inserts had ability to function as an UAS in yeast. Comparison of inserts from these mutants revealed a common palindromic sequence of GATCCGCGGATC, which is not present in the other inserts (for nucleotide sequence of the inserts, see reference 27, Figure 5). UU36b and UU42 in a cells, which possessed this sequence in duplicate, produced 2- to 5-fold more 3-galactosidase compared with UU28 containing the sequence only once. Thus, we concluded that this sequence functioned as an UAS in yeast cells. A significantly high level of ,B-galactosidase production from UU28, UU36b and UU42 in a cells is probably due to a synergistic action between UASMFads and the palindromic sequence. For this reason, we will exclude these spacing mutants from further consideration. No synergistic action was observed when the insertion was longer than 36 bp, i.e. the actual length between UASMFdSl was longer than 89 bp. There was no significant difference in the copy number of the plasmid tested (data not shown). This indicates that the failure of synergism was not caused by a concomitant loss of plasmids from yeast cells.
Independence of rotational alignment between UASFai region and the TATA box We placed the UA region containing the two UASs of MFaJ at twelve different positions that ranged from 40 to 90 bp upstream of the TATA box (Figure 3). In wild type MFail gene the actual spacer length between the last nucleotide of UASMFal2 and the first thymidine of the TATA box is 159 bp. We observed no significant difference in expression level for any
Distance bp -119
Helical turns -11.3
AAATTTTGCC CCTCGAGG6
CAGGTTTTGGATAAG
-113
-10.8
CAGGTTTTGGATAAG
-109
-10.4
AAATT*CCTCGAGGGCCCTCGAGGI AAATTTTGCC CCTCGAGGGCCCTCG6 AGG
-97
- 9.2
AAATTTTGCCGAATTTAATAGCTTCTACTGAAAAACAGTGGAC
GGTTTTGGATAAG
-94
-9.0
AAATTTTGCCGAATTTAATAGCTTCTACTGAAAAACAGTGGAC
1CAGGTTTTGGATAAG
-92
-8.7
CAGGTTTTGGATAAG
AAATTTTGCCGAATTTAATAGCTTCTACTGAAAAACAGTGGACC
-265
XCAGGTTTTGGATAAG -147 -133
-241
AAATTTTGCCGAATTTAATAGCTTCTACTGAAAAACAGTGGACCCTCGAGGCAGGTTTTGGATAAG
-87
-8.3
-84 -83
-8.0 -7.9
A
77
7.3
GGCCCTCGA
-74
7.0
CCCTCGAGGGCGAI
-69
- 6.6
[GCCCTCGAGGGCCCTCGAI
Figure 3. Stuctures of spacing mutants between UASMFds and the TATA box. The XJzoI site used to constract mutants is underlined and nucleotides derived from synthetic DNA are boxed. The distance is defined as the deletion length (bp) compared with the wild type MFcrl gene. The helical turns are defined by assuming 10.5 bp per turn.
3102 Nucleic Acids Research, Vol. 19, No. 11 140
I
a cells
12 4L.'
10b *Em*.
I*
ct
4.'
80 cU-
60-
en,
cu 2
40-
Cu
a cells __ _~ a _I_ 0 -120 -110 -100 -90 -80 -70 _
I
Distance
-60
(bp)
Figure 4. Effect of changing the distance between UASMFalS Xand TATA box. The distance is defined as in Figure 3.
Helical turns
QC
60
c-C
=
-.
A',
*1.-\ A
A
G
/
r
50
z
Figure 5. Analysis of mRNA initiation sites of spacing nnutants between UASMFaIs and the TATA box by nuclease SI mapping. TotaI cellular RNAs (10gg) from DBY746 (MA Ta) carrying the deletion mutant pl;asmids indicated were hybridized to the probe B and treated with SI nuclease (64 U) for 30 Lane M displays G+A reaction (41) of the probe. Note tha the analysis is qualitative, not quantitative.
nlyin
of these twelve spacing mutants in a cells (Figure 4). These mutants were regulated normally, because in a cells they could not produce a detectable level of f.-galactosidase.
Figure 5 shows that the transcription start points for spacing the same as the sites for the wild type MFcrl gene, in which mRNA 5' ends are located at positions -59, -56, and -53 (24). Since probe B was 5' end labeled with 32P at the EcoRI site derived from multilinker site of pMC 1871 (34), only the fusion transcript can be detected. The mRNA start points of spacing mutants examined were located around position -55. mutants are
DISCUSSION Recent work has revealed that activation of transcription initiation is mediated by the interaction of proteins bound to cis elements (11-14). We examied the effect of differences in the spacing among three cis acting elements on the expression level of the MFal gene in yeast. We showed that no strict alignment is required between UASMFa5s and the TATA box. We found that UASMFa5S functioned at nearly identical levels from twelve positions that are 40 to 90 bp upstream of the TATA box (Figure 4), in which UASMFA1s are moved to different sides of the DNA helix relative to the TATA box. Our result is strikingly different from those obtained with various transcriptional control elements (11, 15- 17, 19, 20, 22, 23), which showed a dependence on strict rotational alignment between cis acting elements. On the other hand, some observations are consistent with our result, which demonstrated that the octamer activator binding site, the major late transcription factor binding site and the GAL4 activator binding site activated transcription to identical levels even when they were on the opposite sides of the DNA helix with respect to the TATA box (35 -37). These observations might be explained if in these cases the activator proteins and/or their target factor is highly flexible so that they can interact with each other irrespective of their relative rotational positions. Recently we have identified the activator target by a genetic approach (K. Inokuchi and A. Nakayama, in preparation). A structual analyses of the target factor will reveal whether this explanation is the case. We have also shown that no strict aligment is required between the two UASMFa1 elements (Figure 2). In this case, the expression level of MFal decreased with the spacing between them and no synergism was observed when the distance between them was longer than 89 bp. Thus, UASMFa1 elements are similar to mammalian enhancer elements (also called protoenhancers) which can enhance transcription when separated by roughly up to 100 bp (38, 39). An UASMFaI element consists of two sites, P and Q, which are binding sites for MCM1 and MATcd1, respectively (26). Probably a pair of these binding sites (P and Q) must be in close proximity to create a functional UASMFa1 element. Therefore, a regulatory region of the MFacl gene can be divided into three different levels of organization according to the flexibility of the spacing between its component pair of subunits. The first level is a binding site for a regulatory protein, the P and Q sites. The second level corresponds to a combination of the protein binding sites to form an UASMFad element. At the last level, a regulatory region is divided into UASMFa, elements and the TATA box. These two sets of regulatory elements are capable of activating transcription when separated by distances as large as hundreds of bp (24). Taken together, the molecular organizations of regulatory regions are conserved between yeast and mammals.
ACKNOWLEDGEMENTS We are most grateful to F. Hishinuma for his encouragment throughout this work. We also thank L. Guarente for plasmid,F. Ozawa for synthesis of oligonucleotides, T. E. Kennedy for critical reading of the manuscript and H. Sakazume for her excellent secretarial assistance. This work was performed as a part of the Research and Development of Basic Technology for Future Industries supported by NEDO of Japan.
Nucleic Acids Research, Vol. 19, No. 11 3103
REFERENCES 1. Struhl, K. (1987) Cell 49, 295-297. 2. Matsui, T., Segall, J., Weil, P. and Roeder, R. G. (1980) J. Biol. Chem. 255, 11992-11996. 3. Samuels, M., Fire, A. and Sharp, P. A. (1982) J. Biol. Chem. 257, 14419-14427. 4. Van Dyke, M., Roeder, R. G. and Sawadogo, M. (1988) Science 241, 1335-1338. 5. Buratowski, S., Hahn, S., Guarente, L. and Sharp, P. A. (1989) Cell 56, 549-561. 6. Guarente, L. and Hoar, E. (1984) Proc. Natl. Acad. Sci. USA 81, 7860-7864. 7. Struhl, K. (1984) Proc. Natl. Acad. Sci. USA 81, 7865-7869 8. Kakidani, H. and Ptashne, M. (1988) Cell 52, 161-167. 9. Webster, N., Jun, J. R., Green, S., Hollis, M. and Chambon, P. (1988) Cell 52, 169-178. 10. Lech, K., Anderson, K. and Brent, R. (1988) Cell 52, 179-184. 11. Takahashi, K., Vigneron, M., Matthes, H., Wildeman, A., Zenke, M. and Chambon, P. (1986) Nature 319, 121-126. 12. Ptashne, M. (1986) Nature 322, 697-701. 13. Muller, H.-P., Sogo, J. M. and Schaffener, W. (1989) Cell 58, 767-777. 14. Dunaway, M. and Droge, P. (1989) Nature 341, 657-659 15. Dunn, T. M., Hahn, S., Ogden, S. and Schleif, R. F. (1984) Proc. Natl. Acad. Sci. USA 81, 5017-5020. 16. Hochschild, A. and Ptashne, M. (1986) Cell 44, 681-687. 17. Cohen, R. S. and Meselson, M. (1988) Nature 332, 856-858. 18. Johnson, R. C., Glasgow, A. C. and Simon, M. I. (1987) Nature 329, 462-465. 19. Kramer, H., Niem6ller, M., Amouyal, M., Revet, B., von WickenBeergmen, B. and Muller-Hill, B. (1987) EMBO J. 6, 1481-1491. 20. Maeda, S., Ozawa, Y., Mizuno, T. and Mizushima, S. (1988) J. Mol. Biol. 202, 433-441. 21. Snyder, U. K., Thompson, J. F. and Landy, A. (1989) Nature 341, 255-257. 22. Schatz, C. and Chatton, B. (1990) Nucleic Acids Res. 18, 421-427. 23. Ushida, C. and Aiba, H. (1990) Nucleic Acids Res. 18, 6325-6330. 24. Inokuchi, K., Nakayama, A. and Hishinuma, F. (1987) Mol. Cell. Biol. 7,
3185-3193. 25. Herskowitz, I. (1989) Nature 342, 749-757. 26. Bender, A. and Sprague, G. J. Jr. (1987) Cell 50, 681-691. 27. Inokuchi, K., Nakayama, A. and Hishinuma. F. (1988) Nucleic Acids Res. 16, 6693-6711. 28. Sanger, F., Nicklen, S. and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 29. Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983) J. Bacteriol. 153, 163-168. 30. Sherman, F., Fink, G. R. and Hicks, J. B. (1986) Laboratory course manual for methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 31. Miller, J. H. (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 32. Maniatis, T. E., Fritsch, F. and Sambrook, J. (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 33. Guatente, L. and Mason, T. (1983) Cell 32, 1279-1286. 34. Shapira, S. K., Chou, J., Richaud, F. V. and Casadaban, M. J. (1983) Gene 25, 71-82. 35. Wirth, T., Stradt, L. and Baltimore, D. (1987) Nature 329, 174-178. 36. Chodosh, L. A., Carthew, R. W., Morgan, J. G., Crabtree, G. R. and Sharp, P. A. (1987) Science 238, 684-688. 37. Ruden, D. M., Ma, J. and Ptashne, M. (1988) Proc. Natl. Acad. Sci. USA 85, 4262-4266. 38. Ondek, B., Gloss, L. and Herr, H. (1988) Nature 333, 40-45. 39. Fromental, C., Kanno, M., Nomiyama, H. and Chambon, P. (1988) Cell 54, 943-953. 40. Hahn, S., Hoar, E. T. and Guarente, L. (1985) Proc. Natl. Acad. Sci. USA 82, 8562-8566. 41. Maxiam, A. M. and Gilbert, W. (1980) Methods Enzymol. 65, 499-560, Academic Press Inc., New York.
Nucleic Acids Research, Vol. 19, No. 11 3099
Lack of a requirement for strict rotational alignment transcription factor binding sites in yeast
among
Kaoru Inokuchi* and Akiko Nakayama Laboratory of Molecular Genetics, Mitsubishi Kasei Institute of Life Sciences, 11 Minamiooya, Machida-shi, Tokyo 194, Japan Received December 28, 1990; Revised and Accepted April 23, 1991
ABSTRACT The MFal gene of Saccharomyces cerevisiae is an specific gene whose expression is regulated by two upstream activation sites (UASMFa1s), which are the binding sites for activator proteins, MATal and MCM1. UASMF,1 elements act in a synergistic fashion; lack of either element causes reduced expression levels that are 6- to 45-fold less than that of intact promoter in a cells. We investigated the effect of manipulating rotational alignments among transcription factor binding sites of MFal on the expression of the gene. The expression level of MFa1 decreased with the spacing between the two UASMFa1s and no synergism was observed when the distance of the two elements was longer than 90 base pairs. No strict rotational alignment was required for their synergistic action. We also show that the spacing between UASMFaI elements and TFIID binding site, the TATA box, had little, if any, effect on MFa1 expression. We chose a sufficient number of positions for UASMFa1s to ensure that, in several of these positions, MATal and MCM1 were on the opposite side of the DNA helix with respect to the TATA box. a
INTRODUCTION Most promoters recognized by RNA polymerase II in the yeast Saccharomyces cerevisiae consist of two elements (for review see reference 1). The first element, the TATA box, is usually located within 100 base pairs (bp) upstream of the transcription start point(s) and is the binding site for a component of the basic transcription machinery termed TFIID (2, 3). Binding of TFIID to the TATA box initiates the assembly of the other components of the basic machinery including RNA polymerase II, resulting in a preinitiation complex capable of accurate transcription initiation in vitro (4, 5). A second class of elements, termed upstream activation sites (UASs), is a binding site for a gene specific transcriptional activator protein(s) and determines the efficiency of transcription in response to particular physiological signals (1). UASs are similar to enhancer elements in higher
eukaryotes; they function in both orientations and at variable distances with respect to the TATA box (6, 7). Molecular mechanisms involved in transcription activation are conserved from yeast and mammal. For example, the yeast GAL4 activator can stimulate transcription in mammalian cells depending upon a GAL4 binding sequences (UASG) (8, 9), and the mammalian DNA binding protein Fos activates transcription in yeast (10). Recent studies have revealed that initiation of transcription is facilitated by the interaction of enhancer/UAS sequence with proximal promoter element including the TATA box via proteins bound to the DNA, with the intervening DNA looped out (11-14). The interaction between proteins bound to DNA is thought to be facilitated by the precise alignment of their binding sites along the DNA double helix; proteins bound to the same side of the DNA helix interact with each other much more readily than proteins bound on opposite side of the helix (11, 15-23). We have previously reported the existance of two UASs (UASMFa15S) that confer cell type specific control of MFal expression in Saccharomyces cerevisiae (24). These UASMF,a1S are very similar in sequence and each one is a binding site for two transcription factors, the MATcal gene product and MCMJ gene product (also called PRTF or GRM) (for review see reference 25, and references therein). While the MCMJ gene is expressed in all three cell types, a, a and a/a, the MATal gene is expressed only in cells. The MCM1 protein is thought to be a transcriptional activator, however, MCM1 must act together with the MATa protein to activate the specific genes, cell including MFal (26). Thus, UASMFadS can confer specific expression of the MFal gene. The most intriguing feature of UASMFaI elements is that they act in a synergistic fashion; lack of either element caused reduced expression levels that are 6- to 45-fold less than that of the intact promoter in a cell (24). The UASmFai region contains two sequence directed curvatures, each of which overlaps each UASMFa1 element (27). The relative directions of these curvatures are almost the same, and these curvatured DNAs seem to be involved in transcriptional regulation of specific genes (27). Here we show that no strict rotational alignment is required between the two UASMFaIS for their synergistic action and between UASMFa1l and the TATA box to activate transcription.
* To whom correspondence should be addressed at Center for Neurobiology and Behavior, West 168th Street, New York, NY 10032, USA
a
a
a
a
College of Physicians and Surgeons, Columbia University, 722
3100 Nucleic Acids Research, Vol. 19, No. 11
MATERIALS AND METHODS Spacing mutants between UASmFIAGls Plasmid pAKI039-30 (24) (Figure lA) was used to construct insertion mutants. The construction of insertion plasmids and the nucletide sequence of the inserts were described previously (27). The DNA sequence inserted into the 23 bp insertion mutant at the XmnI site was GCAGATGATCTGCGCGGATCTGC.
Spacing mutants between UASm[a¢Is and TATA box Structure of plasmid pAKI093 is shown in Figure lB. The UAS and TATA box region of pAKI093 was derived from plasmid A-241/-148, in which the XhfoI linker (8mer, CCTCGAGG) was substituted for 95 bp DNA segment between UASMFals and the TATA box (24). Thus, in this case the UASmFals sequences are closer to the TATA box by 87 bp compared with the intact MFal gene. To construct spacing mutants between UASMF,Is and the TATA box, pAKI093 was digested with X7wI, which cut the unique site between UASMFals and the TATA box, and treated with SI muclease or BAL31 nuclease to construct series deletions. To construct insertions, synthetic oligonucleotide was inserted into the XhoI site of pAKI093. All of the DNA sequences of spacing mutants were verified directly by the dideoxy DNA sequencing method (28) using a synthetic primer.
Assay of 3-galactosidase activity Spacing mutant plasmids were introduced into strain DBY746 (MATai his3-A1 leu2-3 leu2-112 ura3-52 trpl-289a) or DBY747 (AlT4 his3-A1 leu2-3 leu2-112 ura3-52 trpl-289a) by the lithium ion method (29). Cells carrying the spacing mutant plasmids were grown with shaling at 30°C in synthetic complete mediun lacldng uracil or lacking leucine (30) to an A6,. of 2 to 3. ,B-Galactosidase activity was assayed as described by Miller (31). RNA analysis Yeast strains were grown to an A6w of 1.0 in synthetic complete medium lacking leucine (30). Preparation of total cellular RNA
A
,
UASMFcl
and S1 muclease mapping were performed as described previously (24). The 5' end labeled DNA fragment used as a probe (probe B) is shown in Figure lB.
Estimation of plasmid copy number Total DNA was isolated quantitatively from yeast strains carrying a spacing mutant plasmid (30), electrophoresed on an agarose gel, transfered to a nitrocellulose filter, and probed with the EcoRI/BamHI fragment (Figure lA, probe A) specific to lacZ which was labeled with [a-32P]dCTP by nick translation (32).
RESULTS To facilitate the MFcil expression assay in vivo, we constructed a UASMFals-TATAcycl-lacZ fusion (plasmid pAKI039-30, reference 24) and a UASMFaIs-TATAmFal-lacZ fusion (plasmid pAK1093) (Figure 1). These fusion genes were carried on a multicopy plasmid replicated from the origin of 2sm plasmid. In pAKI039-30, the UASMFa,I region containing both of the UASMFalS was substituted for the CYCI UASs of the CYCJ-lacZ fusion of plasmid pLGA-312 (33). These fusion genes were regulated normally; they were expressed only in a cells, not in a and a/a cells (Figures 2, 4). A spacing mutant between the two UASmaFls is denoted UUX, where X indicates the insertion length (bp) compared to the wild type MFal gene. The positions of three cis acting elements in MFal are; UASMFaI1 1 at position -367 to -340, UASMFa,12 at -314 to -287 and the TATA box at -128 to -122 (24) (We have numbered the first letter of the initiation codon + 1 throughout this work).
No strict rotational aligment is required for the synergistic action of two UASfsals The distance between the first nucleotides of the two UASMFaIs is 53 bp, just five helical turns assuming 10.5 bp per turn (24). This led us to speculate that the synergistic action of the two UAS,,ials requires rotational alignment between them. We have B
2pm Figure 1. Structure of UASMFI5s-TATAcycI-lacZ (A) and UASMFaIs-TATAMF,I-laCZ (B) fusion plasmids. Ori and 21m refer to the locations of the origins of replication for Escherichia coil and Saccharomyses cerevisiae, respectively. TATAcycI, three functional TATA boxes of the CYCI gene (40); TATAMFGI, a functional TATA box of the MFael gene (24); UASMFQIS, two UASs of the MFal gene (24); B, BamHI; E, EcoRI; Hd, Hird; Xb, XbaI; Xh, X7wI; Xm, XumI. Hindul, XbaI and XVoI, or XmnI sites are not shown in pAKI039-30 and pAKI093, respectively. Arrows indicate the transcriptional orientation of the fusion genes. 32p labeled probes used for assay of plasmid copy number (probe A) and for SI nuclease mapping (probe B) are shown. Closed circle indicates the position of 32p labeled site. Note that drawings are not drawn to scale.
Nucleic Acids Research, Vol. 19, No. 11 3101 tested the effect of varying the distance between UASMFaIs by inserting systematically increasing lengths of spacer DNA. Figure 2 shows a lack of dependence on rotational alignment between UASMFa1s for synergistic function. The most prominent feature of the spacing mutants is that the insertion of DNA segments of increasing length leads to a rapid and drastic
120 0
100 X
36b
80
9\2
( n ~~~~c60 ~~~~~~42
nd
14010 23 -L20
m
3
20
cm~~
0
~
~
~
~
20
10
37
0
30
40
50
Insertion length (bp) Figure 2. Effect of the distance between the two UASMFa1S on their synergistic action. Numbers in the panel correspond to the insetion length (bp). Asterisk shows the (3-galactosidase activity of UASMFa,l2-TATAcycl-lacZ fusion which bears one UASMF,,12 element as UAS. In a cells, 13-galactosidase activities are 1.2, 5.9, 2.9, and less than 0.1 for UU28, UU36b, UU42 and the other spacing mutants, respectively.
decrease in the synergistic action in a cells except for UU28, UU36b and UU42. In a cells, all spacing mutants but these three inserts produced no detectable level of ,3-galactosidase (see Figure 2 legend), indicating that these mutants were regulated normally. Insertions UU28, UU36b and UU42 produced a significant level of 3-galactosidase even in a cells, suggesting that some DNA sequence included in these inserts had ability to function as an UAS in yeast. Comparison of inserts from these mutants revealed a common palindromic sequence of GATCCGCGGATC, which is not present in the other inserts (for nucleotide sequence of the inserts, see reference 27, Figure 5). UU36b and UU42 in a cells, which possessed this sequence in duplicate, produced 2- to 5-fold more 3-galactosidase compared with UU28 containing the sequence only once. Thus, we concluded that this sequence functioned as an UAS in yeast cells. A significantly high level of ,B-galactosidase production from UU28, UU36b and UU42 in a cells is probably due to a synergistic action between UASMFads and the palindromic sequence. For this reason, we will exclude these spacing mutants from further consideration. No synergistic action was observed when the insertion was longer than 36 bp, i.e. the actual length between UASMFdSl was longer than 89 bp. There was no significant difference in the copy number of the plasmid tested (data not shown). This indicates that the failure of synergism was not caused by a concomitant loss of plasmids from yeast cells.
Independence of rotational alignment between UASFai region and the TATA box We placed the UA region containing the two UASs of MFaJ at twelve different positions that ranged from 40 to 90 bp upstream of the TATA box (Figure 3). In wild type MFail gene the actual spacer length between the last nucleotide of UASMFal2 and the first thymidine of the TATA box is 159 bp. We observed no significant difference in expression level for any
Distance bp -119
Helical turns -11.3
AAATTTTGCC CCTCGAGG6
CAGGTTTTGGATAAG
-113
-10.8
CAGGTTTTGGATAAG
-109
-10.4
AAATT*CCTCGAGGGCCCTCGAGGI AAATTTTGCC CCTCGAGGGCCCTCG6 AGG
-97
- 9.2
AAATTTTGCCGAATTTAATAGCTTCTACTGAAAAACAGTGGAC
GGTTTTGGATAAG
-94
-9.0
AAATTTTGCCGAATTTAATAGCTTCTACTGAAAAACAGTGGAC
1CAGGTTTTGGATAAG
-92
-8.7
CAGGTTTTGGATAAG
AAATTTTGCCGAATTTAATAGCTTCTACTGAAAAACAGTGGACC
-265
XCAGGTTTTGGATAAG -147 -133
-241
AAATTTTGCCGAATTTAATAGCTTCTACTGAAAAACAGTGGACCCTCGAGGCAGGTTTTGGATAAG
-87
-8.3
-84 -83
-8.0 -7.9
A
77
7.3
GGCCCTCGA
-74
7.0
CCCTCGAGGGCGAI
-69
- 6.6
[GCCCTCGAGGGCCCTCGAI
Figure 3. Stuctures of spacing mutants between UASMFds and the TATA box. The XJzoI site used to constract mutants is underlined and nucleotides derived from synthetic DNA are boxed. The distance is defined as the deletion length (bp) compared with the wild type MFcrl gene. The helical turns are defined by assuming 10.5 bp per turn.
3102 Nucleic Acids Research, Vol. 19, No. 11 140
I
a cells
12 4L.'
10b *Em*.
I*
ct
4.'
80 cU-
60-
en,
cu 2
40-
Cu
a cells __ _~ a _I_ 0 -120 -110 -100 -90 -80 -70 _
I
Distance
-60
(bp)
Figure 4. Effect of changing the distance between UASMFalS Xand TATA box. The distance is defined as in Figure 3.
Helical turns
QC
60
c-C
=
-.
A',
*1.-\ A
A
G
/
r
50
z
Figure 5. Analysis of mRNA initiation sites of spacing nnutants between UASMFaIs and the TATA box by nuclease SI mapping. TotaI cellular RNAs (10gg) from DBY746 (MA Ta) carrying the deletion mutant pl;asmids indicated were hybridized to the probe B and treated with SI nuclease (64 U) for 30 Lane M displays G+A reaction (41) of the probe. Note tha the analysis is qualitative, not quantitative.
nlyin
of these twelve spacing mutants in a cells (Figure 4). These mutants were regulated normally, because in a cells they could not produce a detectable level of f.-galactosidase.
Figure 5 shows that the transcription start points for spacing the same as the sites for the wild type MFcrl gene, in which mRNA 5' ends are located at positions -59, -56, and -53 (24). Since probe B was 5' end labeled with 32P at the EcoRI site derived from multilinker site of pMC 1871 (34), only the fusion transcript can be detected. The mRNA start points of spacing mutants examined were located around position -55. mutants are
DISCUSSION Recent work has revealed that activation of transcription initiation is mediated by the interaction of proteins bound to cis elements (11-14). We examied the effect of differences in the spacing among three cis acting elements on the expression level of the MFal gene in yeast. We showed that no strict alignment is required between UASMFa5s and the TATA box. We found that UASMFa5S functioned at nearly identical levels from twelve positions that are 40 to 90 bp upstream of the TATA box (Figure 4), in which UASMFA1s are moved to different sides of the DNA helix relative to the TATA box. Our result is strikingly different from those obtained with various transcriptional control elements (11, 15- 17, 19, 20, 22, 23), which showed a dependence on strict rotational alignment between cis acting elements. On the other hand, some observations are consistent with our result, which demonstrated that the octamer activator binding site, the major late transcription factor binding site and the GAL4 activator binding site activated transcription to identical levels even when they were on the opposite sides of the DNA helix with respect to the TATA box (35 -37). These observations might be explained if in these cases the activator proteins and/or their target factor is highly flexible so that they can interact with each other irrespective of their relative rotational positions. Recently we have identified the activator target by a genetic approach (K. Inokuchi and A. Nakayama, in preparation). A structual analyses of the target factor will reveal whether this explanation is the case. We have also shown that no strict aligment is required between the two UASMFa1 elements (Figure 2). In this case, the expression level of MFal decreased with the spacing between them and no synergism was observed when the distance between them was longer than 89 bp. Thus, UASMFa1 elements are similar to mammalian enhancer elements (also called protoenhancers) which can enhance transcription when separated by roughly up to 100 bp (38, 39). An UASMFaI element consists of two sites, P and Q, which are binding sites for MCM1 and MATcd1, respectively (26). Probably a pair of these binding sites (P and Q) must be in close proximity to create a functional UASMFa1 element. Therefore, a regulatory region of the MFacl gene can be divided into three different levels of organization according to the flexibility of the spacing between its component pair of subunits. The first level is a binding site for a regulatory protein, the P and Q sites. The second level corresponds to a combination of the protein binding sites to form an UASMFad element. At the last level, a regulatory region is divided into UASMFa, elements and the TATA box. These two sets of regulatory elements are capable of activating transcription when separated by distances as large as hundreds of bp (24). Taken together, the molecular organizations of regulatory regions are conserved between yeast and mammals.
ACKNOWLEDGEMENTS We are most grateful to F. Hishinuma for his encouragment throughout this work. We also thank L. Guarente for plasmid,F. Ozawa for synthesis of oligonucleotides, T. E. Kennedy for critical reading of the manuscript and H. Sakazume for her excellent secretarial assistance. This work was performed as a part of the Research and Development of Basic Technology for Future Industries supported by NEDO of Japan.
Nucleic Acids Research, Vol. 19, No. 11 3103
REFERENCES 1. Struhl, K. (1987) Cell 49, 295-297. 2. Matsui, T., Segall, J., Weil, P. and Roeder, R. G. (1980) J. Biol. Chem. 255, 11992-11996. 3. Samuels, M., Fire, A. and Sharp, P. A. (1982) J. Biol. Chem. 257, 14419-14427. 4. Van Dyke, M., Roeder, R. G. and Sawadogo, M. (1988) Science 241, 1335-1338. 5. Buratowski, S., Hahn, S., Guarente, L. and Sharp, P. A. (1989) Cell 56, 549-561. 6. Guarente, L. and Hoar, E. (1984) Proc. Natl. Acad. Sci. USA 81, 7860-7864. 7. Struhl, K. (1984) Proc. Natl. Acad. Sci. USA 81, 7865-7869 8. Kakidani, H. and Ptashne, M. (1988) Cell 52, 161-167. 9. Webster, N., Jun, J. R., Green, S., Hollis, M. and Chambon, P. (1988) Cell 52, 169-178. 10. Lech, K., Anderson, K. and Brent, R. (1988) Cell 52, 179-184. 11. Takahashi, K., Vigneron, M., Matthes, H., Wildeman, A., Zenke, M. and Chambon, P. (1986) Nature 319, 121-126. 12. Ptashne, M. (1986) Nature 322, 697-701. 13. Muller, H.-P., Sogo, J. M. and Schaffener, W. (1989) Cell 58, 767-777. 14. Dunaway, M. and Droge, P. (1989) Nature 341, 657-659 15. Dunn, T. M., Hahn, S., Ogden, S. and Schleif, R. F. (1984) Proc. Natl. Acad. Sci. USA 81, 5017-5020. 16. Hochschild, A. and Ptashne, M. (1986) Cell 44, 681-687. 17. Cohen, R. S. and Meselson, M. (1988) Nature 332, 856-858. 18. Johnson, R. C., Glasgow, A. C. and Simon, M. I. (1987) Nature 329, 462-465. 19. Kramer, H., Niem6ller, M., Amouyal, M., Revet, B., von WickenBeergmen, B. and Muller-Hill, B. (1987) EMBO J. 6, 1481-1491. 20. Maeda, S., Ozawa, Y., Mizuno, T. and Mizushima, S. (1988) J. Mol. Biol. 202, 433-441. 21. Snyder, U. K., Thompson, J. F. and Landy, A. (1989) Nature 341, 255-257. 22. Schatz, C. and Chatton, B. (1990) Nucleic Acids Res. 18, 421-427. 23. Ushida, C. and Aiba, H. (1990) Nucleic Acids Res. 18, 6325-6330. 24. Inokuchi, K., Nakayama, A. and Hishinuma, F. (1987) Mol. Cell. Biol. 7,
3185-3193. 25. Herskowitz, I. (1989) Nature 342, 749-757. 26. Bender, A. and Sprague, G. J. Jr. (1987) Cell 50, 681-691. 27. Inokuchi, K., Nakayama, A. and Hishinuma. F. (1988) Nucleic Acids Res. 16, 6693-6711. 28. Sanger, F., Nicklen, S. and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 29. Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983) J. Bacteriol. 153, 163-168. 30. Sherman, F., Fink, G. R. and Hicks, J. B. (1986) Laboratory course manual for methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 31. Miller, J. H. (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 32. Maniatis, T. E., Fritsch, F. and Sambrook, J. (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 33. Guatente, L. and Mason, T. (1983) Cell 32, 1279-1286. 34. Shapira, S. K., Chou, J., Richaud, F. V. and Casadaban, M. J. (1983) Gene 25, 71-82. 35. Wirth, T., Stradt, L. and Baltimore, D. (1987) Nature 329, 174-178. 36. Chodosh, L. A., Carthew, R. W., Morgan, J. G., Crabtree, G. R. and Sharp, P. A. (1987) Science 238, 684-688. 37. Ruden, D. M., Ma, J. and Ptashne, M. (1988) Proc. Natl. Acad. Sci. USA 85, 4262-4266. 38. Ondek, B., Gloss, L. and Herr, H. (1988) Nature 333, 40-45. 39. Fromental, C., Kanno, M., Nomiyama, H. and Chambon, P. (1988) Cell 54, 943-953. 40. Hahn, S., Hoar, E. T. and Guarente, L. (1985) Proc. Natl. Acad. Sci. USA 82, 8562-8566. 41. Maxiam, A. M. and Gilbert, W. (1980) Methods Enzymol. 65, 499-560, Academic Press Inc., New York.
