Loop-Mediated Isothermal Amplification for Detection of Nucleic Acids
UNIT 15.14
Nathan A. Tanner1 and Thomas C. Evans, Jr.1 1
New England Biolabs, Ipswich, Massachusetts
ABSTRACT Sequence-specific isothermal nucleic acid amplification techniques are ideally suited for use in molecular diagnostic applications because they do not require thermal cycling equipment and the reactions are typically fast. One of the most widely cited isothermal techniques is termed loop-mediated isothermal amplification (LAMP). This protocol allows amplification times as fast as 5 to 10 min. Furthermore, various methodologies to detect amplification have been applied to LAMP to increase its utility for the pointof-care market. Basic LAMP protocols are provided herein for detection of specific DNA and RNA targets, along with a method to perform multiplex LAMP reactions, permitting even greater flexibility from this powerful technique. Curr. Protoc. Mol. Biol. C 2014 by John Wiley & Sons, Inc. 105:15.14.1-15.14.14. Keywords: LAMP r isothermal amplification r molecular diagnostics
INTRODUCTION Recent years have seen a dramatic rise in the abundance and availability of nucleic acid sequence information. This expansion has enabled the use of DNA and RNA amplification techniques for specific detection, harnessing the complexity inherent in genetic material for the purpose of targeted identification. Molecular diagnostic techniques utilizing nucleic acids were pioneered through use of the polymerase chain reaction (PCR), which remains the predominant method in the field due to its robustness, sensitivity, and familiarity. However, the growing use of these molecular diagnostic methods has emphasized speed and simplicity as key criteria for adoption in point-ofcare and field applications, and isothermal amplification techniques are well-suited for these uses (isothermal methods and point-of-care applications are reviewed in Niemz et al., 2011; Njiru, 2012). By their nature, isothermal amplification methods require only a single temperature, avoiding the need for expensive thermal cycling equipment and potentially even electrical power, depending on incubation temperature and heating. Additionally, by constant incubation and amplification, no temporal constraints from defined cycles are implied, resulting in amplification reactions as rapid as 5 min. Perhaps the most widespread isothermal method is loop-mediated isothermal amplification (LAMP). Since its publication in 2000 (Notomi et al., 2000), LAMP has been applied to diagnostic detection of hundreds of pathogens in clinical, plant, food, and animal samples. LAMP presents a simple, robust, and flexible platform for molecular diagnostics. This unit describes the basic methods and materials for performing LAMP reactions using DNA (Basic Protocol) and RNA (Alternate Protocol 1) targets. Alternate Protocol 2 provides a guide for multiplexed LAMP reactions using labeled primers. While simple, LAMP can require experience and practice to optimize, so helpful strategies are provided for implementation and troubleshooting of LAMP reactions. The Polymerase Chain Reaction Current Protocols in Molecular Biology 15.14.1-15.14.14, January 2014 Published online January 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/0471142727.mb1514s105 C 2014 John Wiley & Sons, Inc. Copyright
15.14.1 Supplement 105
BASIC PROTOCOL
LAMP REACTIONS WITH DNA TEMPLATES This protocol describes a basic LAMP reaction using DNA template and six LAMP primers (four core, two loop) (Notomi et al., 2000; Nagamine et al., 2002). The LAMP principle is shown in Figure 15.14.1. Reactions can be monitored in real time by fluorescence, turbidity, luminescence, or metal-sensitive dye (Mori et al., 2004; Goto et al., 2009; Gandelman et al., 2010). Alternatively, reactions can be analyzed after amplification by visual inspection of fluorescence, color, or turbidity, or using gel electrophoresis, lateral flow devices, or nanoparticle detection (Tomita et al., 2008; Murray et al., 2013; Seetang-Nun et al., 2013). Primers for LAMP reactions can be chosen for any target nucleic acid, with either high specificity (detecting only one target) or universality (detecting many related targets). Primer design may be performed manually, but software is available for efficient primer design using various recommended settings (e.g., length of amplicons and primers, avoiding AT richness for ends of FIP/BIP, proper Tm ; Tomita et al., 2008). LAMP primers for BRCA1 were designed using PrimerExplorer v4 (Eiken Chemical), but LAMP Designer (Premier Biosoft) is another available software option. LAMP is prone to nontemplate amplification due to the amount and number of primers, so care should be taken to avoid primer dimers or other effects. Software solutions will automatically avoid obvious problem sequences and are highly recommended. If possible, order multiple complete primer sets for validation and optimization of the reaction, including controls for both positive and negative performance. HPLC or gel purification of primers is generally not required, but can improve specificity and reproducibility for diagnostic and multiplex applications (Tomita et al., 2008).
A
LAMP principle
exponential amplification
B
DARQ LAMP
exponential amplification
Figure 15.14.1 LAMP amplification scheme. (A) Standard LAMP amplification. (1) Initiation at F end of target sequence via FIP (primers in italics) and displacement of nascent strand by synthesis initiating at F3. (2,3) Synthesis and displacement at B end of target resulting in (4), the seed structure for exponential LAMP amplification. (B) DARQ LAMP amplification using qFIP:Fd duplex primer with a fluorophore (F) and dark quencher (Q). LAMP proceeds as in (A), but with displacement of Fd in (3) producing the fluorescent signal. Additional qFIP:Fd duplex participates in downstream amplification and is subsequently displaced to produce additional fluorescence during exponential amplification (4). More detailed illustration of LAMP products can be found in Notomi et al. (2000) and Nagamine et al. (2002).
15.14.2 Supplement 105
Current Protocols in Molecular Biology
Materials Oligonucleotide primers (typically, 100 μM stocks in H2 O or 1× TE buffer) For human breast cancer 1 (BRCA1; 5 to 3 ): F3: TCCTTGAACTTTGGTCTCC B3: CAGTTCATAAAGGAATTGATAGC FIP: ATCCCCAGTCTGTGAAATTGGGCAAAATGCTGGGATTATAGATGT BIP: GCAGCAGAAAGATTATTAACTTGGGCAGTTGGTAAGTAAATGGAAGA Loop F: AGAACCAGAGGCCAGGCGAG Loop B: AGGCAGATAGGCTTAGACTCAA Test sample Control template DNA (e.g., HeLa genomic DNA, New England Biolabs, 0.1 mg/ml) LoopAmp Extraction kit (Eiken Chemical) or other method for DNA extraction (optional) 2× LAMP reaction buffer (see recipe) Dye for visual detection (optional), such as: 50 μM SYTO-9 (see recipe, 2 μM final) or other intercalating dsDNA dye 625 μM calcein (see recipe, 25 μM final) 3 mM hydroxynaphthol blue (see recipe, 120 μM final) SYBR Green (Life Technologies/BioRad, 0.1× to 1× final) Strand-displacing DNA polymerase (e.g., Bst 2.0, large fragment, New England Biolabs, 8,000 U/ml) Molecular-biology grade water 5 M betaine solution (see recipe; optional) Appropriate plates (with sealing film) or tubes for instrumentation 65°C heating block, thermal cycler, or water bath Fluorescence or turbidity instrument for real-time detection (e.g., LA-320c, SA-Scientific; ESE-Quant, Qiagen; CFX, Bio-Rad) Prepare LAMP primer mixes 1. From primer stock solutions, prepare two 25× mixes of core primers and loop primers, or a single 20× or 10× mix of all six primers. For 100 μl of 25× core primers:
40 μl 100 μM FIP 40 μl 100 μM BIP 5 μl 100 μM F3 5 μl 100 μM B3 10 μl H2 O. For 100 μl of 25× loop primers:
10 μl 100 μM Loop F 10 μl 100 μM Loop B 80 μl H2 O. Alternatively, for 100 μl of 20× LAMP primers:
32 μl 100 μM FIP 32 μl 100 μM BIP 4 μl 100 μM F3 Current Protocols in Molecular Biology
The Polymerase Chain Reaction
15.14.3 Supplement 105
4 μl 100 μM B3 8 μl 100 μM Loop F 8 μl 100 μM Loop B 12 μl H2 O. Suggested final concentrations are 1.6 μM FIP, 1.6 μM BIP, 0.2 μM F3, 0.2 μM B3, 0.4 μM Loop F, and 0.4 μM Loop B. Individual primer stocks as well as mixes should be stored at −20°C for long-term stability (up to 3 years or longer).
Prepare samples 2. If desired, perform nucleic acid extraction on test samples to avoid inhibition of the reaction (e.g., LoopAmp Extraction kit, Eiken Chemical). Compared to PCR, LAMP is more tolerant of many culture media components and samples (e.g., MEM, vitreous humor), but high levels of material from clinical (e.g., blood, sputum, fecal) or plant (e.g., humic acid) samples can affect the reaction (Kaneko et al., 2007). Typical nucleic acid extraction techniques (e.g., Qiagen columns, DNAzol, phenol/chloroform extraction, ethanol precipitation) are recommended if samples are highly impure or may interfere with detection methods (e.g., whole blood).
3. For improved specificity and amplification efficiency with some templates, denature the template or sample prior to amplification by heating to 95°C for 5 min and then placing on ice. Denaturation must be performed prior to addition of Bst polymerase and initiation of amplification, as the polymerase is not sufficiently heat-stable.
Perform LAMP reactions 4. Prepare sample and control reaction mixtures on ice, as follows: 12.5 μl 2× LAMP reaction buffer 1 μl 25× primer mix 1 μl 25× loop mix 1 μl dye for visual detection (optional) 1 μl 8 U/μl Bst 2.0 DNA polymerase 1 μl test sample or 10 ng control template DNA 7.5 μl H2 O. For consistency, perform each reaction in duplicate or triplicate 25-μl reactions. Include negative control reactions using water in place of sample or template DNA. Keep reactions on ice, as nonspecific room-temperature activity of Bst DNA polymerase will adversely affect reactions (Tanner et al., 2012). For room-temperature, high-throughput, or field setup, Bst 2.0 WarmStart (New England Biolabs) can be used (Poole et al., 2012). Addition of intercalating dye causes some inhibition of the amplification reaction, but SYTO-9 has been demonstrated to produce minimal inhibition (Monis et al., 2005; Njiru et al., 2008). If desired, 0.4 to 1.2 M betaine (Sigma) can be added to reduce nonspecific amplification for certain primer sets. Efficacy of this addition can be examined by running positive and negative reactions with and without betaine.
5. Mix components by pipetting or vortexing, then briefly pulse-spin in a microcentrifuge. 6. For quantitation, run a series of template or sample concentrations. LAMP for Detection of Nucleic Acids
15.14.4 Supplement 105
LAMP can typically provide a dynamic range of 104 to 108 , with maximum sensitivity of 1 to 1000 copies, depending on the efficiency of amplification and level of non-template (negative) amplification. Measure both parameters with control reactions before or during the test sample run. Current Protocols in Molecular Biology
7. Place the reaction directly into a preheated 65°C chamber and incubate for the desired time. Threshold times using fluorescence detection are typically 3 to 30 min depending on the amount of template and efficiency of amplification. If using real-time turbidimetry, threshold times will be slower, e.g., 10 to 60 min (Mori et al., 2004).
8. Perform endpoint detection after 45 to 60 min incubation using agarose gel electrophoresis, alternative methods such as nanoparticles (Seetang-Nun et al., 2013), or visual detection using a UV or light box. CAUTION: When opening reaction vessels for analysis, extreme care should be taken to avoid contamination of laboratory areas and equipment. Tubes or plates should only be opened in areas separate from those where reactions are prepared, ideally in a laminar flow hood using separate pipets and equipment. Due to the high level of amplification, LAMP is extremely sensitive to even small amounts of carryover contamination (see Critical Parameters and Troubleshooting). Conditions and parameters for optimizing LAMP reactions, including buffer and additives, temperature, and reagent concentrations, are discussed in Critical Parameters and Troubleshooting.
RT-LAMP REACTIONS WITH RNA TEMPLATES A benefit to LAMP reactions is its inherent compatibility with reverse transcription (RT). First, unlike PCR reactions, LAMP is performed in buffers containing high levels of magnesium (typically 8 mM), optimal for RT activity. Second, LAMP amplicons are diagnostic in function and thus quite short (
UNIT 15.14
Nathan A. Tanner1 and Thomas C. Evans, Jr.1 1
New England Biolabs, Ipswich, Massachusetts
ABSTRACT Sequence-specific isothermal nucleic acid amplification techniques are ideally suited for use in molecular diagnostic applications because they do not require thermal cycling equipment and the reactions are typically fast. One of the most widely cited isothermal techniques is termed loop-mediated isothermal amplification (LAMP). This protocol allows amplification times as fast as 5 to 10 min. Furthermore, various methodologies to detect amplification have been applied to LAMP to increase its utility for the pointof-care market. Basic LAMP protocols are provided herein for detection of specific DNA and RNA targets, along with a method to perform multiplex LAMP reactions, permitting even greater flexibility from this powerful technique. Curr. Protoc. Mol. Biol. C 2014 by John Wiley & Sons, Inc. 105:15.14.1-15.14.14. Keywords: LAMP r isothermal amplification r molecular diagnostics
INTRODUCTION Recent years have seen a dramatic rise in the abundance and availability of nucleic acid sequence information. This expansion has enabled the use of DNA and RNA amplification techniques for specific detection, harnessing the complexity inherent in genetic material for the purpose of targeted identification. Molecular diagnostic techniques utilizing nucleic acids were pioneered through use of the polymerase chain reaction (PCR), which remains the predominant method in the field due to its robustness, sensitivity, and familiarity. However, the growing use of these molecular diagnostic methods has emphasized speed and simplicity as key criteria for adoption in point-ofcare and field applications, and isothermal amplification techniques are well-suited for these uses (isothermal methods and point-of-care applications are reviewed in Niemz et al., 2011; Njiru, 2012). By their nature, isothermal amplification methods require only a single temperature, avoiding the need for expensive thermal cycling equipment and potentially even electrical power, depending on incubation temperature and heating. Additionally, by constant incubation and amplification, no temporal constraints from defined cycles are implied, resulting in amplification reactions as rapid as 5 min. Perhaps the most widespread isothermal method is loop-mediated isothermal amplification (LAMP). Since its publication in 2000 (Notomi et al., 2000), LAMP has been applied to diagnostic detection of hundreds of pathogens in clinical, plant, food, and animal samples. LAMP presents a simple, robust, and flexible platform for molecular diagnostics. This unit describes the basic methods and materials for performing LAMP reactions using DNA (Basic Protocol) and RNA (Alternate Protocol 1) targets. Alternate Protocol 2 provides a guide for multiplexed LAMP reactions using labeled primers. While simple, LAMP can require experience and practice to optimize, so helpful strategies are provided for implementation and troubleshooting of LAMP reactions. The Polymerase Chain Reaction Current Protocols in Molecular Biology 15.14.1-15.14.14, January 2014 Published online January 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/0471142727.mb1514s105 C 2014 John Wiley & Sons, Inc. Copyright
15.14.1 Supplement 105
BASIC PROTOCOL
LAMP REACTIONS WITH DNA TEMPLATES This protocol describes a basic LAMP reaction using DNA template and six LAMP primers (four core, two loop) (Notomi et al., 2000; Nagamine et al., 2002). The LAMP principle is shown in Figure 15.14.1. Reactions can be monitored in real time by fluorescence, turbidity, luminescence, or metal-sensitive dye (Mori et al., 2004; Goto et al., 2009; Gandelman et al., 2010). Alternatively, reactions can be analyzed after amplification by visual inspection of fluorescence, color, or turbidity, or using gel electrophoresis, lateral flow devices, or nanoparticle detection (Tomita et al., 2008; Murray et al., 2013; Seetang-Nun et al., 2013). Primers for LAMP reactions can be chosen for any target nucleic acid, with either high specificity (detecting only one target) or universality (detecting many related targets). Primer design may be performed manually, but software is available for efficient primer design using various recommended settings (e.g., length of amplicons and primers, avoiding AT richness for ends of FIP/BIP, proper Tm ; Tomita et al., 2008). LAMP primers for BRCA1 were designed using PrimerExplorer v4 (Eiken Chemical), but LAMP Designer (Premier Biosoft) is another available software option. LAMP is prone to nontemplate amplification due to the amount and number of primers, so care should be taken to avoid primer dimers or other effects. Software solutions will automatically avoid obvious problem sequences and are highly recommended. If possible, order multiple complete primer sets for validation and optimization of the reaction, including controls for both positive and negative performance. HPLC or gel purification of primers is generally not required, but can improve specificity and reproducibility for diagnostic and multiplex applications (Tomita et al., 2008).
A
LAMP principle
exponential amplification
B
DARQ LAMP
exponential amplification
Figure 15.14.1 LAMP amplification scheme. (A) Standard LAMP amplification. (1) Initiation at F end of target sequence via FIP (primers in italics) and displacement of nascent strand by synthesis initiating at F3. (2,3) Synthesis and displacement at B end of target resulting in (4), the seed structure for exponential LAMP amplification. (B) DARQ LAMP amplification using qFIP:Fd duplex primer with a fluorophore (F) and dark quencher (Q). LAMP proceeds as in (A), but with displacement of Fd in (3) producing the fluorescent signal. Additional qFIP:Fd duplex participates in downstream amplification and is subsequently displaced to produce additional fluorescence during exponential amplification (4). More detailed illustration of LAMP products can be found in Notomi et al. (2000) and Nagamine et al. (2002).
15.14.2 Supplement 105
Current Protocols in Molecular Biology
Materials Oligonucleotide primers (typically, 100 μM stocks in H2 O or 1× TE buffer) For human breast cancer 1 (BRCA1; 5 to 3 ): F3: TCCTTGAACTTTGGTCTCC B3: CAGTTCATAAAGGAATTGATAGC FIP: ATCCCCAGTCTGTGAAATTGGGCAAAATGCTGGGATTATAGATGT BIP: GCAGCAGAAAGATTATTAACTTGGGCAGTTGGTAAGTAAATGGAAGA Loop F: AGAACCAGAGGCCAGGCGAG Loop B: AGGCAGATAGGCTTAGACTCAA Test sample Control template DNA (e.g., HeLa genomic DNA, New England Biolabs, 0.1 mg/ml) LoopAmp Extraction kit (Eiken Chemical) or other method for DNA extraction (optional) 2× LAMP reaction buffer (see recipe) Dye for visual detection (optional), such as: 50 μM SYTO-9 (see recipe, 2 μM final) or other intercalating dsDNA dye 625 μM calcein (see recipe, 25 μM final) 3 mM hydroxynaphthol blue (see recipe, 120 μM final) SYBR Green (Life Technologies/BioRad, 0.1× to 1× final) Strand-displacing DNA polymerase (e.g., Bst 2.0, large fragment, New England Biolabs, 8,000 U/ml) Molecular-biology grade water 5 M betaine solution (see recipe; optional) Appropriate plates (with sealing film) or tubes for instrumentation 65°C heating block, thermal cycler, or water bath Fluorescence or turbidity instrument for real-time detection (e.g., LA-320c, SA-Scientific; ESE-Quant, Qiagen; CFX, Bio-Rad) Prepare LAMP primer mixes 1. From primer stock solutions, prepare two 25× mixes of core primers and loop primers, or a single 20× or 10× mix of all six primers. For 100 μl of 25× core primers:
40 μl 100 μM FIP 40 μl 100 μM BIP 5 μl 100 μM F3 5 μl 100 μM B3 10 μl H2 O. For 100 μl of 25× loop primers:
10 μl 100 μM Loop F 10 μl 100 μM Loop B 80 μl H2 O. Alternatively, for 100 μl of 20× LAMP primers:
32 μl 100 μM FIP 32 μl 100 μM BIP 4 μl 100 μM F3 Current Protocols in Molecular Biology
The Polymerase Chain Reaction
15.14.3 Supplement 105
4 μl 100 μM B3 8 μl 100 μM Loop F 8 μl 100 μM Loop B 12 μl H2 O. Suggested final concentrations are 1.6 μM FIP, 1.6 μM BIP, 0.2 μM F3, 0.2 μM B3, 0.4 μM Loop F, and 0.4 μM Loop B. Individual primer stocks as well as mixes should be stored at −20°C for long-term stability (up to 3 years or longer).
Prepare samples 2. If desired, perform nucleic acid extraction on test samples to avoid inhibition of the reaction (e.g., LoopAmp Extraction kit, Eiken Chemical). Compared to PCR, LAMP is more tolerant of many culture media components and samples (e.g., MEM, vitreous humor), but high levels of material from clinical (e.g., blood, sputum, fecal) or plant (e.g., humic acid) samples can affect the reaction (Kaneko et al., 2007). Typical nucleic acid extraction techniques (e.g., Qiagen columns, DNAzol, phenol/chloroform extraction, ethanol precipitation) are recommended if samples are highly impure or may interfere with detection methods (e.g., whole blood).
3. For improved specificity and amplification efficiency with some templates, denature the template or sample prior to amplification by heating to 95°C for 5 min and then placing on ice. Denaturation must be performed prior to addition of Bst polymerase and initiation of amplification, as the polymerase is not sufficiently heat-stable.
Perform LAMP reactions 4. Prepare sample and control reaction mixtures on ice, as follows: 12.5 μl 2× LAMP reaction buffer 1 μl 25× primer mix 1 μl 25× loop mix 1 μl dye for visual detection (optional) 1 μl 8 U/μl Bst 2.0 DNA polymerase 1 μl test sample or 10 ng control template DNA 7.5 μl H2 O. For consistency, perform each reaction in duplicate or triplicate 25-μl reactions. Include negative control reactions using water in place of sample or template DNA. Keep reactions on ice, as nonspecific room-temperature activity of Bst DNA polymerase will adversely affect reactions (Tanner et al., 2012). For room-temperature, high-throughput, or field setup, Bst 2.0 WarmStart (New England Biolabs) can be used (Poole et al., 2012). Addition of intercalating dye causes some inhibition of the amplification reaction, but SYTO-9 has been demonstrated to produce minimal inhibition (Monis et al., 2005; Njiru et al., 2008). If desired, 0.4 to 1.2 M betaine (Sigma) can be added to reduce nonspecific amplification for certain primer sets. Efficacy of this addition can be examined by running positive and negative reactions with and without betaine.
5. Mix components by pipetting or vortexing, then briefly pulse-spin in a microcentrifuge. 6. For quantitation, run a series of template or sample concentrations. LAMP for Detection of Nucleic Acids
15.14.4 Supplement 105
LAMP can typically provide a dynamic range of 104 to 108 , with maximum sensitivity of 1 to 1000 copies, depending on the efficiency of amplification and level of non-template (negative) amplification. Measure both parameters with control reactions before or during the test sample run. Current Protocols in Molecular Biology
7. Place the reaction directly into a preheated 65°C chamber and incubate for the desired time. Threshold times using fluorescence detection are typically 3 to 30 min depending on the amount of template and efficiency of amplification. If using real-time turbidimetry, threshold times will be slower, e.g., 10 to 60 min (Mori et al., 2004).
8. Perform endpoint detection after 45 to 60 min incubation using agarose gel electrophoresis, alternative methods such as nanoparticles (Seetang-Nun et al., 2013), or visual detection using a UV or light box. CAUTION: When opening reaction vessels for analysis, extreme care should be taken to avoid contamination of laboratory areas and equipment. Tubes or plates should only be opened in areas separate from those where reactions are prepared, ideally in a laminar flow hood using separate pipets and equipment. Due to the high level of amplification, LAMP is extremely sensitive to even small amounts of carryover contamination (see Critical Parameters and Troubleshooting). Conditions and parameters for optimizing LAMP reactions, including buffer and additives, temperature, and reagent concentrations, are discussed in Critical Parameters and Troubleshooting.
RT-LAMP REACTIONS WITH RNA TEMPLATES A benefit to LAMP reactions is its inherent compatibility with reverse transcription (RT). First, unlike PCR reactions, LAMP is performed in buffers containing high levels of magnesium (typically 8 mM), optimal for RT activity. Second, LAMP amplicons are diagnostic in function and thus quite short (
