G Model ACTHIS-50989; No. of Pages 8
ARTICLE IN PRESS Acta Histochemica xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway Di Zhong a , Guangxu He b , Siren Zhao b , Jinku Li b , Yanbin Lang b , Wei Ye b , Yongli Li b , Chuanlu Jiang b , Xianfeng Li b,∗ a b
Department of Neurology, The First Affiliated Hospital of Harbin Medical University, Harbin 150001, People’s Republic of China Department of Neurosurgery, The Second Affiliated Hospital of Harbin Medical University, Harbin 150086, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 5 January 2015 Received in revised form 6 May 2015 Accepted 7 May 2015 Available online xxx Keywords: LRG1 Glioma Invasion Migration TGF- signaling
a b s t r a c t Studies have shown that the abnormal expression of leucine-rich ␣2 glycoprotein 1 (LRG1) is associated with multiple malignancies, yet its role in glioma pathology remains to be elucidated. In this study, we investigated the role of LRG1 in regulating proliferation, migration and invasion of glioma cells by establishing glioma cell strains with constitutively silenced or elevated LRG1 expression. LRG1 overexpression and silenced cell lines demonstrated modulation of glioma cellular proliferation, migration and invasion through MTT, cell scratching and Transwell assays. Furthermore, overexpression of LRG1 led to augmented activation of transforming growth factor- (TGF-) signaling pathway as well as downregulation of E-cadherin and resultant enhanced invasiveness, which was reversed by TGF- signaling pathway inhibitor SB431542. In summary, our findings suggest that LRG1 promotes invasion and migration of glioma cells through TGF- signaling pathway. © 2015 Elsevier GmbH. All rights reserved.
Introduction Gliomas, which originate from glial cells, are the most common tumors in the central nervous system, and account for 30% of all brain and central nervous system tumors and 80% of all malignant brain tumors (Goodenberger and Jenkins, 2012). Gliomas are classified in 4 grades according to World Health Organization criteria based on the malignant behaviors, and up to 70% of grade II gliomas progress to grade III/IV within 5–10 years from diagnosis (Louis et al., 2007). For the more aggressive form of glioma, glioblastoma, the survival rate with 5-year lifespan from the time of diagnosis is less than 5% (Stupp et al., 2005). Hence, glioma is considered as a malignant tumor and characterized by rapid growth, strong invasiveness, frequent postoperative relapse, and high mortality (Altieri et al., 2014). Current treatments for glioma include surgery, chemotherapy and radiotherapy, and there are ongoing researches on gene therapy and immunotherapy (Arrillaga-Romany et al., 2014; Cuddapah et al., 2014). However, the overall therapeutic efficacy is still insignificant, with an average survival of less than
∗ Corresponding author at: Department of Neurosurgery, The Second Affiliated Hospital of Harbin Medical University, 246 Xuefu Road, Harbin 150086, People’s Republic of China. E-mail address: [email protected] (X. Li).
one year (Cloughesy et al., 2014). To date, the molecular mechanisms underlying the tumorigenesis and progression of glioma are poorly understood, and glioma remains the focus of concern in the field of neurosurgery. With recent technological advancement, a number of genes related to the development of glioma have been identified (Kondo et al., 2014; Weller and Wick, 2014), providing new directions for the research into the diagnosis and treatment of glioma. Leucine-rich ␣2 glycoprotein 1 (LRG1) was firstly isolated from human serum by Haupt and Baudner (1977). It was then characterized to be a glycoprotein containing 312 amino acid residues of which 66 are leucine (Takahashi et al., 1985). Studies have shown that the level of LRG1 is elevated in the sera and the tumor tissues of patients with non-small-cell lung cancer (Nakajima et al., 2011; O’Donnell et al., 2002). Similarly, the level of LRG1 has been found to be elevated in the sera of colorectal cancer patients, and is closely correlated with tumor progression (Ladd et al., 2012). Recently, Nakajima et al. (2012) showed that LRG1 is distributed throughout the entire brain and is mainly expressed in the astrocytes with the expression increasing with age, suggesting a possibility of the involvement of LRG1 in astrocytic malignancy and glioma tumorigenesis. Our previous study demonstrated that silencing of LRG1 expression inhibited growth of glioma cell lines in vitro and delayed glioma tumorigenesis in a xenograft mouse model (Zhong et al., 2015), providing evidence for the positive role of
http://dx.doi.org/10.1016/j.acthis.2015.05.001 0065-1281/© 2015 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
2
LRG1 in glioma pathology. However, the molecular mechanism underlying the role of LRG1 in glioma development and progression are elusive. Thus, understanding the pathology of LRG1-associated glioma may have great clinical significance and shed light on the development of novel and effective therapeutic approaches for glioma. Transforming growth factor- (TGF-) superfamily proteins, which are present in both normal cells and transformed cells, are widely involved in cell proliferation, migration and invasion (Drabsch and ten Dijke, 2012; Sun et al., 1995). Cytoplasmic Smads are the key signal transduction factors in the canonical TGF- signaling pathway (Liu et al., 2013). Binding of TGF- with its type I and type II receptors leads to phosphorylation and activation of smad2 and smad3, which in turn bind to smad4 and modulate cell functions (Kamato et al., 2013). The aberrant expression and activity of TGF- has been shown to be associated with a variety of tumors including lung (Araz et al., 2014), liver (Giannelli et al., 2014), breast (Zhang et al., 2014) and ovarian cancer (Chou et al., 2010). LRG1 was recently demonstrated to promote endothelial cell proliferation and angiogenesis via TGF- signaling pathway (Wang et al., 2013). However, whether TGF- is involved in the LRG1-associated tumor development and progression is unclear and remains to be elucidated. In this study, we first detected the expression of LRG1 in various human glioma cell lines, and then investigated the effects of LRG1 on the cellular behavior of glioma cells and the underlying molecular mechanism by manipulating the expression levels of LRG1 in glioma cell lines. The results indicate that LRG1 plays an important role in promoting proliferation, migration and invasion of glioma cells, and these functions are mediated via TGF- signaling pathway.
Table 1 Sequences of the primers for real-time PCR. Primer name
Sequence (5 –3 )
E-cadherin F E-cadherin R LRG1 F LRG1 R ˇ-actin F ˇ-actin R
ATGCCGCCATCGCTTACAC CGACGTTAGCCTCGTTCTCA GGTATTGAAAGAAAACCAGC TGGCAAGGTCTCCAACTG CTTAGTTGCGTTACACCCTTTCTTG CTGTCACCTTCACCGTTCCAGTTT
G418 (Invitrogen) was added for screening of successfully transfected cells, followed by G418 selection for another 1–2 weeks till the appearance of sparse single cell-derived colonies. Individual colonies were expanded as positive clones which were selected for determination of LRG1 expression levels. SHG-44 cells with relatively low expression of endogenous LRG1 protein were transfected with LRG1 overexpression plasmids. The amplification primers for LRG1 coding region were designed as follows: Forward: 5 -GGC TGA AGC TTG CAG AGC TAC CAT GTC CTC-3 (with underlined HindIII restriction site); Reverse: 5 -TGA TGG ATC CTG GTC TCA CTG GGA CTT GG-3 (with underlined BamHI restriction site). The amplified LRG1 coding region was then ligated into pUM-T simple vector (BioTeke Corporation, Beijing, China), and positive recombinant plasmid, namely pUMT-LRG1, was sequenced. The cells were transfected and selected for stable expression clones as described above. SHG-44 cells with stable expression of pUM-T vector or pUM-T-LRG1 overexpression construct were cultured in complete medium containing 10 M SB431542 (MedChem Express, Princeton, NJ, USA) or an equal volume of DMSO (Sigma–Aldrich, St. Louis, MO, USA) for 48 h for inhibitor interference experiments.
Materials and methods Cell culture Human glioma cell lines U373, U251, A172, and SHG-44 were purchased from Shanghai Cell Bank of Chinese Academy of Sciences (Shanghai, China); U87-MG was purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). The characteristics of the cell lines are described in Table S1. U251, U87-MG, U373, and A172 cells were cultured in DMEM (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS), and SHG-44 cells were cultured in RPMI-1640 (Gibco) medium supplemented with 10% FBS. The cells were maintained at 37 ◦ C in a humidified atmosphere of 95% air and 5% CO2 .
Real-time PCR Total RNA was extracted with total RNA extraction kit (TIANGEN Biotech, Beijing, China). cDNA was obtained by reverse transcription, and quantitative fluorescence real-time PCR analysis was performed using SYBR GREEN master mix (TIANGEN) in an ExicyclerTM 96 Real-Time Quantitative Thermal block (Bioneer, Daejeon, Korea), with ˇ-actin as the internal control. The primers are listed in Table 1. The total PCR reaction volume was 20 l and consisted of 1 l of cDNA, 0.5 l of each primer, 10 l of SYBR GREEN master mix, and 8 l of ddH2 O. The PCR reaction program was as follows: 95 ◦ C for 10 min; 40 cycles of 95 ◦ C for 10 s, 60 ◦ C for 20 s, 72 ◦ C for 30 s; and 4 ◦ C for 5 min.
Construction of LRG1-silenced and LRG1-overexpression glioma cell lines
Immunoblotting
U251 cells with high expression of LRG1 protein were subjected to LRG1 knockdown. LRG1 shRNA, and non-targeting control (NC) were purchased from GenePharma (Shanghai, China), and cloned into pGPH-1 shRNA expression vector. The RNA interference sequences were as follows: LRG1 shRNA: 5 -GAT CCC CGA TGT TTT CCC AGA ATG ACT TCA AGA GAG TCA TTC TGG GAA AAC ATC TTT TT-3 (target sequence), 5 -AGC TAA AAA GAT GTT TTC CCA GAA TGA CTC TCT TGA AGT CAT TCT GGG AAA ACA TCG GG-3 (interference sequence); NC shRNA: 5 -GAT CCC CTT CTC CGA ACG TGT CAC GTT TCA AGA GAA CGT GAC ACG TTC GGA GAA TTT TT-3 , 5 -AGC TAA AAA TTC TCC GAA CGT GTC ACG TTC TCT TGA AAC GTG ACA CGT TCG GAG AAG GG-3 . When reaching 50–60% confluence, the cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) in strict accordance with the kit instructions. At 24 h post-transfection, DMEM complete medium containing 200 g/ml
Cells were lysed with NP-40 lysis buffer (Beyotime Institute of Biotechnology, Haimen, China), and total proteins were extracted. Protein concentration was determined by BSA method. A total of 40 g protein from each sample was subjected to SDS-PAGE, and the separated proteins were transferred to PVDF membranes (Millipore, Bedford, MA, USA). The membrane was incubated with a primary antibody against LRG1, smad2, smad3, p-smad2, psmad3 (1:500, Bioss, Beijing, China), TGF- or E-cadherin (1:1000, Wanleibio, Shenyang, China) at 4 ◦ C overnight. Subsequently, the membrane was incubated with HRP-labeled secondary antibody (1:5000, Beyotime) at room temperature for 45 min, followed by chromogenic detection with ECL luminescent solution (Qihai biotech, Shanghai, China). The images were analyzed for density comparison with Gel Pro Analyzer software, using -actin as the internal control.
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
MTT assay for cell proliferation
Results
Cells were seeded at a density of 2 × 103 cells/well in a 96-well plate and cultured at 37 ◦ C with 5% CO2 in a humidified incubator. MTT (Sigma–Aldrich) was added to the medium at 12 h, 24 h, 48 h, 72 h and 96 h to a final concentration of 0.2 mg/ml, and incubated for 4 h. After centrifugation, the supernatant was carefully aspirated, and 200 L DMSO (Sigma–Aldrich) was added to each well to fully dissolve the crystals by shaking the plate for 15 min at 37 ◦ C in the dark. OD values at 490 nm were measured with a microplate reader, and the growth curve was plotted.
LRG1 gene silencing inhibited proliferation, invasion and migration of glioma cells
Cell scratching assay Cell suspensions were applied to a 6-well plate at a density of 1 × 105 /well. When a monolayer of adherent cells was formed, a scratch perpendicular to the surface of the cell monolayer was evenly created using the tip of a 200 l pipette. The cells were washed twice with serum-free medium and subsequently cultured with serum-free medium. Cells were observed and photographed at 0 h, 12 h and 24 h after scratching, and cell migration rate was calculated as (original gap distance − current gap distance)/original gap distance × 100%. Transwell assay For each treatment group, 2 × 104 cells were resuspended in 200 l serum-free medium and seeded in the upper Transwell chamber (Corning, Tewksbury, MA, USA) pre-coated with Matrigel (BD Biosciences, San Jose, CA, USA). The lower chamber contained 800 l culture medium supplemented with 30% FBS. Cells were cultured for 24 h in a 37 ◦ C incubator. After 24 h incubation, cells on the upper surface of the microporous membrane were wiped off with a cotton swab. The remaining cells were fixed with paraformaldehyde and stained with hematoxylin. Each membrane was divided into four equal quadrants. Under a 200× inverted microscope, one field in each quadrant and one in the center were selected for counting the invading cells and the average number of cells was calculated.
Immunofluorescence staining Cells cultured on glass slides were fixed in 4% paraformaldehyde for 15 min, permeabilized with 0.1% TritonX-100, and incubated with anti-E-cadherin antibody (1:50, Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 4 ◦ C overnight. The cells were then incubated with 1:200 diluted Cy3-labeled goat anti-rabbit secondary antibody (Beyotime) at room temperature for 1 h. After counter-stained the nuclei with DAPI, the slides were mounted in fluorescence antiquenching reagent. The cells were observed under a laser confocal microscope (FV1000S-SIM/IX81; Olympus, Tokyo, Japan) and the images were captured at 600× magnification.
Statistical analysis All assays were performed in three independent experiments with three replicates each. The data are presented as the mean ± standard deviation. Comparisons between multiple groups were conducted using one-way analysis of variance (ANOVA), and comparisons between two groups were performed with Bonferroni’s post hoc test. GraphPad Prism 5.0 software was used to process data and images. Statistical significance was defined as p < 0.05.
3
To investigate the role of LRG1 in glioma cell behavior, we first detected expression levels of LRG1 protein in various human glioma cell lines by Western Blot analysis. The results demonstrated that the expression level of LRG1 protein was highest in U251 cells and lowest in SHG-44 cells among the cell lines examined (Fig. 1A). U251 cells were then transfected with an LRG1 shRNA construct for the establishment of a shRNA-silenced LRG1 stable cell line. LRG1 shRNA achieved 71% relative reduction of LRG1 protein expression in U251 cells, as determined by Western Blot analysis (Fig. 1B, p < 0.001). The impacts of LRG1 gene silencing on proliferation, migration and invasiveness of glioma cells were further characterized by MTT, cell scratching and Transwell assays. Proliferation of LRG1-silenced cells was significantly lower than control cells from 48 h post-seeding (Fig. 1C, p < 0.05). Transwell invasion assay demonstrated significantly a reduced number of invading cells due to LRG1 gene silencing (33.0 ± 4.74) as compared to NC control (84.4 ± 8.62) (Fig. 1D and E, p < 0.001). Furthermore, scratch healing rate, which represents cell migration rate, was significantly lower in LRG1-silenced cells compared with NC control at both 12 h (17.7% ± 1.87% vs 34.59% ± 5.05%; p < 0.01) and 24 h (44.74% ± 5.71% vs 71.88% ± 7.89%; p < 0.05) (Fig. 1F–H). In summary, silencing of LRG1 by shRNA reduced LRG1 protein expression and inhibited the proliferation, invasion and migration of glioma cells. LRG1 overexpression promoted proliferation, migration and invasion of glioma cells SHG-44 cells were transfected with an LRG1 overexpression construct, and elevated levels of LRG1 in the positive monoclonal cells was confirmed by real-time PCR and Western Blot analysis (Fig. 2A and B, p < 0.001, p < 0.001). The impacts of LRG1 overexpression on proliferation, migration and invasiveness of glioma cells were further evaluated. Proliferation of LRG1-overexpressing cells was significantly augmented than control cells expressing pUM-T control vector alone (Fig. 2C, p < 0.05). Transwell invasion assay showed a significantly higher number of invading cells in LRG1-overexpressing cells (101.6 ± 11.01) than that in control cells (53.6 ± 6.07) (Fig. 2D and E, p < 0.001). LRG1 overexpression resulted in faster cell migration compared with control cells at both 12 h (56.02% ± 5.84% vs 20.22% ± 3.69%; p < 0.001) and 24 h (81.68% ± 8.87% vs 52.48% ± 6.87%; p < 0.01) (Fig. 2F–H). In summary, overexpression of LRG1 enhanced proliferation, invasiveness and migration of glioma cells. LRG1 overexpression led to activation of TGF-ˇ signaling pathway and inhibition of E-cadherin expression in glioma cells To investigate the molecular mechanism for LRG1-regulated cell migration and invasiveness, we assessed the activation of TGF signaling pathway and the expression of E-cadherin which are the key players in tumor cell migration and invasion. The protein levels of TGF-1, p-smad2 and p-smad3 were increased by 1.75 folds (Fig. 3A, p < 0.001), 0.74 fold (Fig. 3B, p < 0.01) and 0.76 fold (Fig. 3C, p < 0.01) respectively in LRG1-overexpressing cells, compared with the levels observed in vector control cells. In contrast, expression of E-cadherin was reduced by almost half at both mRNA and protein levels as a result of LRG1 overexpression (Fig. 3D, p < 0.01; Fig. 3E, p < 0.01). Immunofluorescence staining showed that E-cadherin was mainly located in the junctions between cells, and the fluorescence intensity was significantly reduced when LRG1
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8 4
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
Fig. 1. Silencing of LRG1 inhibited proliferation, migration and invasion of glioma cells. (A) Immunoblotting was performed to determine the levels of LRG1 protein in different human glioma cell lines. (B) The levels of LRG1 protein in LRG1-silenced U251 cells and the control cells (ANOVA, p < 0.001, n = 3). -actin was used as an internal control for grayscale analysis of immunoblotting results. (C) Cell proliferation was assessed by MTT assay, which was performed at 12 h, 24 h, 48 h, 72 h and 96 h after cell-plating (ANOVA, p = 0.603, p = 0.071, p = 0.005, p = 0.003, p = 0.004 for the corresponding time points, n = 3). (D, E) Transwell assay was performed to evaluate the invasiveness of glioma cells upon LRG1 silencing. Cells were cultured in the upper chamber of the Transwell for 24 h and the invading cells were fixed and stained with hematoxylin. The invading cells were photographed and counted under a microscope (ANOVA, p < 0.001, n = 3). (F, G, H) Cell scratching assay was performed to detect cell migration. When the cells were cultured to 80% confluence, a scratch was created. At 0 h, 12 h and 24 h post-scratching, the gap distance was measured, and cell migration rate was calculated (ANOVA, p = 0.004 for 12 h and p = 0.005 for 24 h, n = 3). The figure shows the representative images of three independent experiments. All data are expressed as the mean ± standard deviation. Compared with NC cells, *p < 0.05, **p < 0.01, ***p < 0.001.
was overexpressed, as compared to the control cells (Fig. 3F). These results indicate that elevated expression of LRG1 modulates the activation of TGF- signaling pathway and the expression of Ecadherin. LRG1 overexpression-induced downregulation of E-cadherin and enhanced invasiveness was blocked by inhibition of TGF-ˇ signaling pathway Since we had observed an upregulation of TGF- signaling and a concurrent downregulation of E-cadherin expression in LRG1overexpressing cells, we wanted to know whether LRG1-associated
E-cadherin downregulation was mediated through TGF- signaling pathway. Thus, SB431542, a specific inhibitor of the TGF- signaling pathway (Halder et al., 2005; Laping et al., 2002), was added into the culture medium of LRG1-overexpressing cells to suppress TGF signaling. The expression of E-cadherin was upregulated by 0.88 fold in SB431542-treated control cells compared with DMSOtreated control cells (p < 0.001), and LRG1 overexpression-induced downregulation of E-cadherin was rescued by SB431542 treatment to a comparable level as vector + DMSO-treated control cells (Fig. 4A). Moreover, inhibition of TGF- signaling by SB431542 reduced the invasiveness of SHG-44 cells (26.8 ± 3.27) compared with the control cells (55.6 ± 5.81) (p < 0.001), and effectively
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
5
Fig. 2. Overexpression of LRG1 promoted proliferation, migration and invasion of glioma cells. SHG-44 cells were transfected with LRG1 overexpression construct and selected for stable expression. (A) Real-time PCR was performed to examine the expression levels of LRG1 mRNA (ANOVA, p < 0.001, n = 3). (B) The levels of LRG1 protein were detected by Western Blot analysis, with the grayscale analysis using -actin as the internal control (ANOVA, p < 0.001, n = 3). (C) Cell proliferation was examined by MTT assay (ANOVA, p = 0.962, p = 0.145, p = 0.003, p = 0.021, p = 0.008 for 12 h, 24 h, 48 h, 72 h and 96 h respectively, n = 3). (D, E) Invasiveness of SHG-44 cells with and without LRG1 overexpression was assessed by Transwell assay (ANOVA, p < 0.001, n = 3). (F, G, H) Cell scratching assay was performed to assess cell migration rate in LRG1-overexpressing cells in comparison with the control cells (ANOVA, p < 0.001 for 12 h and p = 0.004 for 24 h, n = 3). The figure shows the representative images of three independent experiments, and data are presented as the mean ± standard deviation. Compared with pUM-T vector control cells, *p < 0.05, **p < 0.01, ***p < 0.001.
suppressed the augmented invasiveness induced by LRG1 overexpression (73.4 ± 8.38 vs 101.6 ± 11.41; p < 0.001) (Fig. 4B and C). These results suggest that LRG1 inhibits E-cadherin expression by activating TGF- signaling pathway, thereby promoting the invasiveness of the glioma cells. Discussion Upregulation of LRG1 is associated with various malignant tumors, but its role in glioma pathology has not been explicitly reported. In this study, glioma cell strains with constitutive silencing or overexpression of LRG1 were established. Our experiments with overexpressing and silencing LRG1 demonstrated that LRG1 plays a critical role in promoting migration and invasion of glioma
cells, which is, at least partially, mediated via activation of the TGF- signaling pathway and inhibition of E-cadherin expression. These findings provide preliminary characterization of the molecular mechanism of LRG1 in the development of glioma. Excessive proliferation, migration and invasion of tumor cells are the main biological characteristics of malignant tumors, and the most important factors in determining the degree of malignancy (Schonberg et al., 2014). Although potential clinicopathologic associations have been demonstrated with LRG1 in multiple tumors, including ovarian (Andersen et al., 2010), lung (Li et al., 2011) and colon cancer (Ladd et al., 2012), little is known about the role of LRG1 in tumor cells and tumor development. In this study, we observed that LRG1 was highly expressed in Grade IV glioma cell lines, but was expressed at a relatively lower level in SHG-44 cells
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8 6
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
Fig. 3. Overexpression of LRG1 augmented activation of TGF- signaling pathway and repressed E-cadherin expression in glioma cells. Western Blot assay was performed to detect the protein levels of (A) TGF-1 (ANOVA, p < 0.001, n = 3), (B) p-smad2 (ANOVA, p = 0.0011 for p-smad2 and p = 0.678 for smad2, n = 3), (C) p-smad3 (ANOVA, p = 0.0014 for p-smad3 and p = 0.811 for smad3, n = 3) and (D) E-cadherin (ANOVA, p = 0.003, n = 3), with the grayscale analysis using -actin as the internal control. (E) Real-time PCR was used to detect the level of E-cadherin mRNA (ANOVA, p = 0.0019, n = 3). (F) Immunofluorescence staining was performed to observe the distribution of E-cadherin protein in glioma cells. E-cadherin was primarily expressed in cell junctions (red), while the nuclei were stained with DAPI (blue). The figure shows the representative images of three independent experiments, and data are presented as the mean ± standard deviation. Compared with pUM-T vector control, **p < 0.01, ***p < 0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
that originated from Grade III glioma, suggesting that LRG1 expression in glioma might be correlated with tumor grade. Moreover, by manipulating the levels of LRG1 in glioma cells, we showed that the proliferative capacity, the migration rate and the invasiveness of glioma cells were positively correlated with the intracellular levels of LRG1 (Figs. 1 and 2), suggesting that LRG1 plays an important role in promoting proliferation, migration and invasion of glioma cells and it might play a part in glioma progression. TGF- superfamily proteins have been demonstrated to play important roles in cell proliferation, migration and invasion (Drabsch and ten Dijke, 2012; Sun et al., 1995), and their
aberrant expression and activity is associated with a variety of tumors (Araz et al., 2014; Chou et al., 2010; Giannelli et al., 2014; Zhang et al., 2014). Here we showed that overexpression of LRG1 activated TGF- signaling in glioma cells by upregulating TGF-1 and promoting the phosphorylation of its downstream Smad proteins (Fig. 3A–C), which was associated with enhanced migration and invasion of glioma cells (Fig. 2D–H). In addition, inhibiting TGF signaling pathway by the TGF- receptor inhibitor SB431542 effectively reduced the invasiveness of glioma cells (Fig. 4B and C), suggesting that TGF- signaling pathway plays a critical role in regulating the migration and invasion of glioma cells. The positive role
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
7
Fig. 4. Inhibition of TGF- signaling reversed LRG1-induced E-cadherin downregulation and invasiveness. LRG1-overexpressing cells and vector transfection control cells were cultured in the medium containing TGF- receptor inhibitor SB431542 or an equivalent volume of DMSO for 48 h. (A) Expression levels of E-cadherin were examined by immunoblotting, with grayscale analysis using -actin as the internal control (ANOVA, p < 0.001, n = 4). (B, C) Transwell assays were performed to detect the invasiveness of SB431542-treated cells (ANOVA, p < 0.001, n = 4). The figure shows the representative images of three independent experiments, and data are presented as the mean ± standard deviation. Compared with vector + DMSO, ***p < 0.001; compared with LRG1 + DMSO, # p < 0.05, ## p < 0.01.
of TGF- signaling in glioma cell migration and invasion observed in this study is consistent with previous reports on glioma (Lu et al., 2011; Merzak et al., 1994) and other types of tumors (Fransvea et al., 2008; Wiercinska et al., 2011), and herein we identified that LRG1 is an upstream regulator of TGF- signaling pathway. LRG1 has been demonstrated to regulate the migratory machinery of neuroblastoma cells through the non-canonical TGF- pathway (Lynch et al., 2012). In the present study, we show for the first time that LRG1 also plays a critical role in modulating the canonical TGF- pathway. The expression of E-cadherin, a well known factor that plays an important regulatory role in epithelial-mesenchymal transition (EMT) (Schmalhofer et al., 2009), was found to be negatively correlated with the expression level of TGF-1 in primary glioma tissues and in glioma cell lines (Yang et al., 2012). Downregulating or abolishing the expression of E-cadherin can trigger EMT, thereby endowing the tumor cells with strong capacities for metastasis and invasion (Thiery et al., 2009). Expression of E-cadherin has been shown to be reduced in various tumor tissues (Silye et al., 1998; Tanaka et al., 2002), and low expression of E-cadherin in the brain of glioma patients renders the risk of EMT, resulting in deterioration of glioma (Song et al., 2014). Our study showed that the expression of E-cadherin was reduced in LRG1-overexpressing cells, which was reversed by inhibiting TGF- signaling pathway (Fig. 4), suggesting that LRG1 inhibits E-cadherin expression via TGF- signaling pathway, thereby enhancing the invasiveness of glioma cells and the risk of malignant metastasis. Conclusions In the present study, we demonstrate that LRG1 plays an important role in promoting proliferation, migration and invasion of
glioma cells as well as modulating the expression of E-cadherin through TGF- signaling pathway. Our study provides preliminary characterization of the role of LRG1 in the malignant progression of glioma, and suggests that LRG1 may be further explored as a potential target of gene therapy for glioma. Acknowledgement This study was supported by a grant from the National Natural Science Foundation of China (NSFC, No. 30640008). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.acthis.2015.05. 001 References Altieri R, Agnoletti A, Quattrucci F, Garbossa D, Calamo Specchia FM, Bozzaro M, et al. Molecular biology of gliomas: present and future challenges. Transl Med UniSa 2014;10:29–37. Andersen JD, Boylan KL, Jemmerson R, Geller MA, Misemer B, Harrington KM, et al. Leucine-rich alpha-2-glycoprotein-1 is upregulated in sera and tumors of ovarian cancer patients. J Ovarian Res 2010;3:21. Araz O, Demirci E, Yilmazel Ucar E, Calik M, Karaman A, DururSubasi I, et al. Roles of Ki-67, p53, transforming growth factor-beta and lysyl oxidase in the metastasis of lung cancer. Respirology 2014;19:1034–9.
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
Arrillaga-Romany I, Reardon DA, Wen PY. Current status of antiangiogenic therapies for glioblastomas. Expert Opin Investig Drugs 2014;23:199–210. Chou JL, Chen LY, Lai HC, Chan MW. TGF-beta: friend or foe? The role of TGF-beta/SMAD signaling in epigenetic silencing of ovarian cancer and its implication in epigenetic therapy. Expert Opin Ther Targets 2010;14:1213–23. Cloughesy TF, Cavenee WK, Mischel PS. Glioblastoma: from molecular pathology to targeted treatment. Annu Rev Pathol 2014;9:1–25. Cuddapah VA, Robel S, Watkins S, Sontheimer H. A neurocentric perspective on glioma invasion. Nat Rev Neurosci 2014;15: 455–65. Drabsch Y, ten Dijke P. TGF-beta signalling and its role in cancer progression and metastasis. Cancer Metastasis Rev 2012;31: 553–68. Fransvea E, Angelotti U, Antonaci S, Giannelli G. Blocking transforming growth factor-beta up-regulates E-cadherin and reduces migration and invasion of hepatocellular carcinoma cells. Hepatology 2008;47:1557–66. Giannelli G, Villa E, Lahn M. Transforming growth factor-beta as a therapeutic target in hepatocellular carcinoma. Cancer Res 2014;74:1890–4. Goodenberger ML, Jenkins RB. Genetics of adult glioma. Cancer Genet 2012;205:613–21. Halder SK, Beauchamp RD, Datta PK. A specific inhibitor of TGFbeta receptor kinase, SB-431542, as a potent antitumor agent for human cancers. Neoplasia 2005;7:509–21. Haupt H, Baudner S. Isolation and characterization of an unknown, leucine-rich 3.1-S-alpha2-glycoprotein from human serum (author’s transl). Hoppe Seylers Z Physiol Chem 1977;358: 639–46. Kamato D, Burch ML, Piva TJ, Rezaei HB, Rostam MA, Xu S, et al. Transforming growth factor-beta signalling: role and consequences of Smad linker region phosphorylation. Cell Signal 2013;25:2017–24. Kondo Y, Katsushima K, Ohka F, Natsume A, Shinjo K. Epigenetic dysregulation in glioma. Cancer Sci 2014;105:363–9. Ladd JJ, Busald T, Johnson MM, Zhang Q, Pitteri SJ, Wang H, et al. Increased plasma levels of the APC-interacting protein MAPRE1, LRG1, and IGFBP2 preceding a diagnosis of colorectal cancer in women. Cancer Prev Res (Phila) 2012;5:655–64. Laping NJ, Grygielko E, Mathur A, Butter S, Bomberger J, Tweed C, et al. Inhibition of transforming growth factor (TGF)-beta1induced extracellular matrix with a novel inhibitor of the TGF-beta type I receptor kinase activity: SB-431542. Mol Pharmacol 2002;62:58–64. Li Y, Zhang Y, Qiu F, Qiu Z. Proteomic identification of exosomal LRG1: a potential urinary biomarker for detecting NSCLC. Electrophoresis 2011;32:1976–83. Liu L, Dai Q, Min Z, Zhang M. Transforming growth factor beta1 enhances the invasiveness of human glioma cell line via ERK/MAPK pathway. Nan Fang Yi Ke Da Xue Xue Bao 2013;33:1744–7. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Jouvet A, et al. The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol (Berl) 2007;114: 97–109. Lu Y, Jiang F, Zheng X, Katakowski M, Buller B, To SS, et al. TGF-beta1 promotes motility and invasiveness of glioma cells through activation of ADAM17. Oncol Rep 2011;25:1329–35. Lynch J, Fay J, Meehan M, Bryan K, Watters KM, Murphy DM, et al. MiRNA-335 suppresses neuroblastoma cell invasiveness by direct targeting of multiple genes from the non-canonical TGF-beta signalling pathway. Carcinogenesis 2012;33:976–85.
Merzak A, McCrea S, Koocheckpour S, Pilkington GJ. Control of human glioma cell growth, migration and invasion in vitro by transforming growth factor beta 1. Br J Cancer 1994;70: 199–203. Nakajima M, Miyajima M, Ogino I, Watanabe M, Hagiwara Y, Segawa T, et al. Brain localization of leucine-rich alpha2glycoprotein and its role. Acta Neurochir Suppl 2012;113: 97–101. Nakajima M, Miyajima M, Ogino I, Watanabe M, Miyata H, Karagiozov KL, et al. Leucine-rich alpha-2-glycoprotein is a marker for idiopathic normal pressure hydrocephalus. Acta Neurochir (Wien) 2011;153:1339–46, discussion 1346. O’Donnell LC, Druhan LJ, Avalos BR. Molecular characterization and expression analysis of leucine-rich alpha2-glycoprotein, a novel marker of granulocytic differentiation. J Leukoc Biol 2002;72:478–85. Schmalhofer O, Brabletz S, Brabletz T. E-cadherin, beta-catenin, and ZEB1 in malignant progression of cancer. Cancer Metastasis Rev 2009;28:151–66. Schonberg DL, Lubelski D, Miller TE, Rich JN. Brain tumor stem cells: molecular characteristics and their impact on therapy. Mol Asp Med 2014;39C:82–101. Silye R, Karayiannakis AJ, Syrigos KN, Poole S, van Noorden S, Batchelor W, et al. E-cadherin/catenin complex in benign and malignant melanocytic lesions. J Pathol 1998;186:350–5. Song Y, Hu Z, Long H, Peng Y, Zhang X, Que T, et al. A complex mechanism for HDGF-mediated cell growth, migration, invasion, and TMZ chemosensitivity in glioma. J Neurooncol 2014;119:285–95. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 2005;352:987–96. Sun D, Kar S, Carr BI. Differentially expressed genes in TGF-beta 1 sensitive and resistant human hepatoma cells. Cancer Lett 1995;89:73–9. Takahashi N, Takahashi Y, Putnam FW. Periodicity of leucine and tandem repetition of a 24-amino acid segment in the primary structure of leucine-rich alpha 2-glycoprotein of human serum. Proc Natl Acad Sci U S A 1985;82:1906–10. Tanaka M, Kitajima Y, Edakuni G, Sato S, Miyazaki K. Abnormal expression of E-cadherin and beta-catenin may be a molecular marker of submucosal invasion and lymph node metastasis in early gastric cancer. Br J Surg 2002;89:236–44. Thiery JP, Acloque H, Huang RY, Nieto MA. Epithelial–mesenchymal transitions in development and disease. Cell 2009;139:871–90. Wang X, Abraham S, McKenzie JA, Jeffs N, Swire M, Tripathi VB, et al. LRG1 promotes angiogenesis by modulating endothelial TGF-beta signalling. Nature 2013;499:306–11. Weller M, Wick W. Neuro-oncology in 2013: improving outcome in newly diagnosed malignant glioma. Nat Rev Neurol 2014;10:68–70. Wiercinska E, Naber HP, Pardali E, van der Pluijm G, van Dam H, ten Dijke P. The TGF-beta/Smad pathway induces breast cancer cell invasion through the up-regulation of matrix metalloproteinase 2 and 9 in a spheroid invasion model system. Breast Cancer Res Treat 2011;128:657–66. Yang L, Liu M, Deng C, Gu Z, Gao Y. Expression of transforming growth factor-beta1 (TGF-beta1) and E-cadherin in glioma. Tumour Biol 2012;33:1477–84. Zhang G, Zhao Q, Yu S, Lin R, Yi X. Pttg1 inhibits TGFbeta signaling in breast cancer cells to promote their growth. Tumour Biol 2014. Zhong D, Zhao S, He G, Li J, Lang Y, Ye W, et al. Stable knockdown of LRG1 by RNA interference inhibits growth and promotes apoptosis of glioblastoma cells in vitro and in vivo. Tumour Biol 2015.
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
ARTICLE IN PRESS Acta Histochemica xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.de/acthis
LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway Di Zhong a , Guangxu He b , Siren Zhao b , Jinku Li b , Yanbin Lang b , Wei Ye b , Yongli Li b , Chuanlu Jiang b , Xianfeng Li b,∗ a b
Department of Neurology, The First Affiliated Hospital of Harbin Medical University, Harbin 150001, People’s Republic of China Department of Neurosurgery, The Second Affiliated Hospital of Harbin Medical University, Harbin 150086, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 5 January 2015 Received in revised form 6 May 2015 Accepted 7 May 2015 Available online xxx Keywords: LRG1 Glioma Invasion Migration TGF- signaling
a b s t r a c t Studies have shown that the abnormal expression of leucine-rich ␣2 glycoprotein 1 (LRG1) is associated with multiple malignancies, yet its role in glioma pathology remains to be elucidated. In this study, we investigated the role of LRG1 in regulating proliferation, migration and invasion of glioma cells by establishing glioma cell strains with constitutively silenced or elevated LRG1 expression. LRG1 overexpression and silenced cell lines demonstrated modulation of glioma cellular proliferation, migration and invasion through MTT, cell scratching and Transwell assays. Furthermore, overexpression of LRG1 led to augmented activation of transforming growth factor- (TGF-) signaling pathway as well as downregulation of E-cadherin and resultant enhanced invasiveness, which was reversed by TGF- signaling pathway inhibitor SB431542. In summary, our findings suggest that LRG1 promotes invasion and migration of glioma cells through TGF- signaling pathway. © 2015 Elsevier GmbH. All rights reserved.
Introduction Gliomas, which originate from glial cells, are the most common tumors in the central nervous system, and account for 30% of all brain and central nervous system tumors and 80% of all malignant brain tumors (Goodenberger and Jenkins, 2012). Gliomas are classified in 4 grades according to World Health Organization criteria based on the malignant behaviors, and up to 70% of grade II gliomas progress to grade III/IV within 5–10 years from diagnosis (Louis et al., 2007). For the more aggressive form of glioma, glioblastoma, the survival rate with 5-year lifespan from the time of diagnosis is less than 5% (Stupp et al., 2005). Hence, glioma is considered as a malignant tumor and characterized by rapid growth, strong invasiveness, frequent postoperative relapse, and high mortality (Altieri et al., 2014). Current treatments for glioma include surgery, chemotherapy and radiotherapy, and there are ongoing researches on gene therapy and immunotherapy (Arrillaga-Romany et al., 2014; Cuddapah et al., 2014). However, the overall therapeutic efficacy is still insignificant, with an average survival of less than
∗ Corresponding author at: Department of Neurosurgery, The Second Affiliated Hospital of Harbin Medical University, 246 Xuefu Road, Harbin 150086, People’s Republic of China. E-mail address: [email protected] (X. Li).
one year (Cloughesy et al., 2014). To date, the molecular mechanisms underlying the tumorigenesis and progression of glioma are poorly understood, and glioma remains the focus of concern in the field of neurosurgery. With recent technological advancement, a number of genes related to the development of glioma have been identified (Kondo et al., 2014; Weller and Wick, 2014), providing new directions for the research into the diagnosis and treatment of glioma. Leucine-rich ␣2 glycoprotein 1 (LRG1) was firstly isolated from human serum by Haupt and Baudner (1977). It was then characterized to be a glycoprotein containing 312 amino acid residues of which 66 are leucine (Takahashi et al., 1985). Studies have shown that the level of LRG1 is elevated in the sera and the tumor tissues of patients with non-small-cell lung cancer (Nakajima et al., 2011; O’Donnell et al., 2002). Similarly, the level of LRG1 has been found to be elevated in the sera of colorectal cancer patients, and is closely correlated with tumor progression (Ladd et al., 2012). Recently, Nakajima et al. (2012) showed that LRG1 is distributed throughout the entire brain and is mainly expressed in the astrocytes with the expression increasing with age, suggesting a possibility of the involvement of LRG1 in astrocytic malignancy and glioma tumorigenesis. Our previous study demonstrated that silencing of LRG1 expression inhibited growth of glioma cell lines in vitro and delayed glioma tumorigenesis in a xenograft mouse model (Zhong et al., 2015), providing evidence for the positive role of
http://dx.doi.org/10.1016/j.acthis.2015.05.001 0065-1281/© 2015 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
2
LRG1 in glioma pathology. However, the molecular mechanism underlying the role of LRG1 in glioma development and progression are elusive. Thus, understanding the pathology of LRG1-associated glioma may have great clinical significance and shed light on the development of novel and effective therapeutic approaches for glioma. Transforming growth factor- (TGF-) superfamily proteins, which are present in both normal cells and transformed cells, are widely involved in cell proliferation, migration and invasion (Drabsch and ten Dijke, 2012; Sun et al., 1995). Cytoplasmic Smads are the key signal transduction factors in the canonical TGF- signaling pathway (Liu et al., 2013). Binding of TGF- with its type I and type II receptors leads to phosphorylation and activation of smad2 and smad3, which in turn bind to smad4 and modulate cell functions (Kamato et al., 2013). The aberrant expression and activity of TGF- has been shown to be associated with a variety of tumors including lung (Araz et al., 2014), liver (Giannelli et al., 2014), breast (Zhang et al., 2014) and ovarian cancer (Chou et al., 2010). LRG1 was recently demonstrated to promote endothelial cell proliferation and angiogenesis via TGF- signaling pathway (Wang et al., 2013). However, whether TGF- is involved in the LRG1-associated tumor development and progression is unclear and remains to be elucidated. In this study, we first detected the expression of LRG1 in various human glioma cell lines, and then investigated the effects of LRG1 on the cellular behavior of glioma cells and the underlying molecular mechanism by manipulating the expression levels of LRG1 in glioma cell lines. The results indicate that LRG1 plays an important role in promoting proliferation, migration and invasion of glioma cells, and these functions are mediated via TGF- signaling pathway.
Table 1 Sequences of the primers for real-time PCR. Primer name
Sequence (5 –3 )
E-cadherin F E-cadherin R LRG1 F LRG1 R ˇ-actin F ˇ-actin R
ATGCCGCCATCGCTTACAC CGACGTTAGCCTCGTTCTCA GGTATTGAAAGAAAACCAGC TGGCAAGGTCTCCAACTG CTTAGTTGCGTTACACCCTTTCTTG CTGTCACCTTCACCGTTCCAGTTT
G418 (Invitrogen) was added for screening of successfully transfected cells, followed by G418 selection for another 1–2 weeks till the appearance of sparse single cell-derived colonies. Individual colonies were expanded as positive clones which were selected for determination of LRG1 expression levels. SHG-44 cells with relatively low expression of endogenous LRG1 protein were transfected with LRG1 overexpression plasmids. The amplification primers for LRG1 coding region were designed as follows: Forward: 5 -GGC TGA AGC TTG CAG AGC TAC CAT GTC CTC-3 (with underlined HindIII restriction site); Reverse: 5 -TGA TGG ATC CTG GTC TCA CTG GGA CTT GG-3 (with underlined BamHI restriction site). The amplified LRG1 coding region was then ligated into pUM-T simple vector (BioTeke Corporation, Beijing, China), and positive recombinant plasmid, namely pUMT-LRG1, was sequenced. The cells were transfected and selected for stable expression clones as described above. SHG-44 cells with stable expression of pUM-T vector or pUM-T-LRG1 overexpression construct were cultured in complete medium containing 10 M SB431542 (MedChem Express, Princeton, NJ, USA) or an equal volume of DMSO (Sigma–Aldrich, St. Louis, MO, USA) for 48 h for inhibitor interference experiments.
Materials and methods Cell culture Human glioma cell lines U373, U251, A172, and SHG-44 were purchased from Shanghai Cell Bank of Chinese Academy of Sciences (Shanghai, China); U87-MG was purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). The characteristics of the cell lines are described in Table S1. U251, U87-MG, U373, and A172 cells were cultured in DMEM (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS), and SHG-44 cells were cultured in RPMI-1640 (Gibco) medium supplemented with 10% FBS. The cells were maintained at 37 ◦ C in a humidified atmosphere of 95% air and 5% CO2 .
Real-time PCR Total RNA was extracted with total RNA extraction kit (TIANGEN Biotech, Beijing, China). cDNA was obtained by reverse transcription, and quantitative fluorescence real-time PCR analysis was performed using SYBR GREEN master mix (TIANGEN) in an ExicyclerTM 96 Real-Time Quantitative Thermal block (Bioneer, Daejeon, Korea), with ˇ-actin as the internal control. The primers are listed in Table 1. The total PCR reaction volume was 20 l and consisted of 1 l of cDNA, 0.5 l of each primer, 10 l of SYBR GREEN master mix, and 8 l of ddH2 O. The PCR reaction program was as follows: 95 ◦ C for 10 min; 40 cycles of 95 ◦ C for 10 s, 60 ◦ C for 20 s, 72 ◦ C for 30 s; and 4 ◦ C for 5 min.
Construction of LRG1-silenced and LRG1-overexpression glioma cell lines
Immunoblotting
U251 cells with high expression of LRG1 protein were subjected to LRG1 knockdown. LRG1 shRNA, and non-targeting control (NC) were purchased from GenePharma (Shanghai, China), and cloned into pGPH-1 shRNA expression vector. The RNA interference sequences were as follows: LRG1 shRNA: 5 -GAT CCC CGA TGT TTT CCC AGA ATG ACT TCA AGA GAG TCA TTC TGG GAA AAC ATC TTT TT-3 (target sequence), 5 -AGC TAA AAA GAT GTT TTC CCA GAA TGA CTC TCT TGA AGT CAT TCT GGG AAA ACA TCG GG-3 (interference sequence); NC shRNA: 5 -GAT CCC CTT CTC CGA ACG TGT CAC GTT TCA AGA GAA CGT GAC ACG TTC GGA GAA TTT TT-3 , 5 -AGC TAA AAA TTC TCC GAA CGT GTC ACG TTC TCT TGA AAC GTG ACA CGT TCG GAG AAG GG-3 . When reaching 50–60% confluence, the cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) in strict accordance with the kit instructions. At 24 h post-transfection, DMEM complete medium containing 200 g/ml
Cells were lysed with NP-40 lysis buffer (Beyotime Institute of Biotechnology, Haimen, China), and total proteins were extracted. Protein concentration was determined by BSA method. A total of 40 g protein from each sample was subjected to SDS-PAGE, and the separated proteins were transferred to PVDF membranes (Millipore, Bedford, MA, USA). The membrane was incubated with a primary antibody against LRG1, smad2, smad3, p-smad2, psmad3 (1:500, Bioss, Beijing, China), TGF- or E-cadherin (1:1000, Wanleibio, Shenyang, China) at 4 ◦ C overnight. Subsequently, the membrane was incubated with HRP-labeled secondary antibody (1:5000, Beyotime) at room temperature for 45 min, followed by chromogenic detection with ECL luminescent solution (Qihai biotech, Shanghai, China). The images were analyzed for density comparison with Gel Pro Analyzer software, using -actin as the internal control.
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
MTT assay for cell proliferation
Results
Cells were seeded at a density of 2 × 103 cells/well in a 96-well plate and cultured at 37 ◦ C with 5% CO2 in a humidified incubator. MTT (Sigma–Aldrich) was added to the medium at 12 h, 24 h, 48 h, 72 h and 96 h to a final concentration of 0.2 mg/ml, and incubated for 4 h. After centrifugation, the supernatant was carefully aspirated, and 200 L DMSO (Sigma–Aldrich) was added to each well to fully dissolve the crystals by shaking the plate for 15 min at 37 ◦ C in the dark. OD values at 490 nm were measured with a microplate reader, and the growth curve was plotted.
LRG1 gene silencing inhibited proliferation, invasion and migration of glioma cells
Cell scratching assay Cell suspensions were applied to a 6-well plate at a density of 1 × 105 /well. When a monolayer of adherent cells was formed, a scratch perpendicular to the surface of the cell monolayer was evenly created using the tip of a 200 l pipette. The cells were washed twice with serum-free medium and subsequently cultured with serum-free medium. Cells were observed and photographed at 0 h, 12 h and 24 h after scratching, and cell migration rate was calculated as (original gap distance − current gap distance)/original gap distance × 100%. Transwell assay For each treatment group, 2 × 104 cells were resuspended in 200 l serum-free medium and seeded in the upper Transwell chamber (Corning, Tewksbury, MA, USA) pre-coated with Matrigel (BD Biosciences, San Jose, CA, USA). The lower chamber contained 800 l culture medium supplemented with 30% FBS. Cells were cultured for 24 h in a 37 ◦ C incubator. After 24 h incubation, cells on the upper surface of the microporous membrane were wiped off with a cotton swab. The remaining cells were fixed with paraformaldehyde and stained with hematoxylin. Each membrane was divided into four equal quadrants. Under a 200× inverted microscope, one field in each quadrant and one in the center were selected for counting the invading cells and the average number of cells was calculated.
Immunofluorescence staining Cells cultured on glass slides were fixed in 4% paraformaldehyde for 15 min, permeabilized with 0.1% TritonX-100, and incubated with anti-E-cadherin antibody (1:50, Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 4 ◦ C overnight. The cells were then incubated with 1:200 diluted Cy3-labeled goat anti-rabbit secondary antibody (Beyotime) at room temperature for 1 h. After counter-stained the nuclei with DAPI, the slides were mounted in fluorescence antiquenching reagent. The cells were observed under a laser confocal microscope (FV1000S-SIM/IX81; Olympus, Tokyo, Japan) and the images were captured at 600× magnification.
Statistical analysis All assays were performed in three independent experiments with three replicates each. The data are presented as the mean ± standard deviation. Comparisons between multiple groups were conducted using one-way analysis of variance (ANOVA), and comparisons between two groups were performed with Bonferroni’s post hoc test. GraphPad Prism 5.0 software was used to process data and images. Statistical significance was defined as p < 0.05.
3
To investigate the role of LRG1 in glioma cell behavior, we first detected expression levels of LRG1 protein in various human glioma cell lines by Western Blot analysis. The results demonstrated that the expression level of LRG1 protein was highest in U251 cells and lowest in SHG-44 cells among the cell lines examined (Fig. 1A). U251 cells were then transfected with an LRG1 shRNA construct for the establishment of a shRNA-silenced LRG1 stable cell line. LRG1 shRNA achieved 71% relative reduction of LRG1 protein expression in U251 cells, as determined by Western Blot analysis (Fig. 1B, p < 0.001). The impacts of LRG1 gene silencing on proliferation, migration and invasiveness of glioma cells were further characterized by MTT, cell scratching and Transwell assays. Proliferation of LRG1-silenced cells was significantly lower than control cells from 48 h post-seeding (Fig. 1C, p < 0.05). Transwell invasion assay demonstrated significantly a reduced number of invading cells due to LRG1 gene silencing (33.0 ± 4.74) as compared to NC control (84.4 ± 8.62) (Fig. 1D and E, p < 0.001). Furthermore, scratch healing rate, which represents cell migration rate, was significantly lower in LRG1-silenced cells compared with NC control at both 12 h (17.7% ± 1.87% vs 34.59% ± 5.05%; p < 0.01) and 24 h (44.74% ± 5.71% vs 71.88% ± 7.89%; p < 0.05) (Fig. 1F–H). In summary, silencing of LRG1 by shRNA reduced LRG1 protein expression and inhibited the proliferation, invasion and migration of glioma cells. LRG1 overexpression promoted proliferation, migration and invasion of glioma cells SHG-44 cells were transfected with an LRG1 overexpression construct, and elevated levels of LRG1 in the positive monoclonal cells was confirmed by real-time PCR and Western Blot analysis (Fig. 2A and B, p < 0.001, p < 0.001). The impacts of LRG1 overexpression on proliferation, migration and invasiveness of glioma cells were further evaluated. Proliferation of LRG1-overexpressing cells was significantly augmented than control cells expressing pUM-T control vector alone (Fig. 2C, p < 0.05). Transwell invasion assay showed a significantly higher number of invading cells in LRG1-overexpressing cells (101.6 ± 11.01) than that in control cells (53.6 ± 6.07) (Fig. 2D and E, p < 0.001). LRG1 overexpression resulted in faster cell migration compared with control cells at both 12 h (56.02% ± 5.84% vs 20.22% ± 3.69%; p < 0.001) and 24 h (81.68% ± 8.87% vs 52.48% ± 6.87%; p < 0.01) (Fig. 2F–H). In summary, overexpression of LRG1 enhanced proliferation, invasiveness and migration of glioma cells. LRG1 overexpression led to activation of TGF-ˇ signaling pathway and inhibition of E-cadherin expression in glioma cells To investigate the molecular mechanism for LRG1-regulated cell migration and invasiveness, we assessed the activation of TGF signaling pathway and the expression of E-cadherin which are the key players in tumor cell migration and invasion. The protein levels of TGF-1, p-smad2 and p-smad3 were increased by 1.75 folds (Fig. 3A, p < 0.001), 0.74 fold (Fig. 3B, p < 0.01) and 0.76 fold (Fig. 3C, p < 0.01) respectively in LRG1-overexpressing cells, compared with the levels observed in vector control cells. In contrast, expression of E-cadherin was reduced by almost half at both mRNA and protein levels as a result of LRG1 overexpression (Fig. 3D, p < 0.01; Fig. 3E, p < 0.01). Immunofluorescence staining showed that E-cadherin was mainly located in the junctions between cells, and the fluorescence intensity was significantly reduced when LRG1
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8 4
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
Fig. 1. Silencing of LRG1 inhibited proliferation, migration and invasion of glioma cells. (A) Immunoblotting was performed to determine the levels of LRG1 protein in different human glioma cell lines. (B) The levels of LRG1 protein in LRG1-silenced U251 cells and the control cells (ANOVA, p < 0.001, n = 3). -actin was used as an internal control for grayscale analysis of immunoblotting results. (C) Cell proliferation was assessed by MTT assay, which was performed at 12 h, 24 h, 48 h, 72 h and 96 h after cell-plating (ANOVA, p = 0.603, p = 0.071, p = 0.005, p = 0.003, p = 0.004 for the corresponding time points, n = 3). (D, E) Transwell assay was performed to evaluate the invasiveness of glioma cells upon LRG1 silencing. Cells were cultured in the upper chamber of the Transwell for 24 h and the invading cells were fixed and stained with hematoxylin. The invading cells were photographed and counted under a microscope (ANOVA, p < 0.001, n = 3). (F, G, H) Cell scratching assay was performed to detect cell migration. When the cells were cultured to 80% confluence, a scratch was created. At 0 h, 12 h and 24 h post-scratching, the gap distance was measured, and cell migration rate was calculated (ANOVA, p = 0.004 for 12 h and p = 0.005 for 24 h, n = 3). The figure shows the representative images of three independent experiments. All data are expressed as the mean ± standard deviation. Compared with NC cells, *p < 0.05, **p < 0.01, ***p < 0.001.
was overexpressed, as compared to the control cells (Fig. 3F). These results indicate that elevated expression of LRG1 modulates the activation of TGF- signaling pathway and the expression of Ecadherin. LRG1 overexpression-induced downregulation of E-cadherin and enhanced invasiveness was blocked by inhibition of TGF-ˇ signaling pathway Since we had observed an upregulation of TGF- signaling and a concurrent downregulation of E-cadherin expression in LRG1overexpressing cells, we wanted to know whether LRG1-associated
E-cadherin downregulation was mediated through TGF- signaling pathway. Thus, SB431542, a specific inhibitor of the TGF- signaling pathway (Halder et al., 2005; Laping et al., 2002), was added into the culture medium of LRG1-overexpressing cells to suppress TGF signaling. The expression of E-cadherin was upregulated by 0.88 fold in SB431542-treated control cells compared with DMSOtreated control cells (p < 0.001), and LRG1 overexpression-induced downregulation of E-cadherin was rescued by SB431542 treatment to a comparable level as vector + DMSO-treated control cells (Fig. 4A). Moreover, inhibition of TGF- signaling by SB431542 reduced the invasiveness of SHG-44 cells (26.8 ± 3.27) compared with the control cells (55.6 ± 5.81) (p < 0.001), and effectively
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
5
Fig. 2. Overexpression of LRG1 promoted proliferation, migration and invasion of glioma cells. SHG-44 cells were transfected with LRG1 overexpression construct and selected for stable expression. (A) Real-time PCR was performed to examine the expression levels of LRG1 mRNA (ANOVA, p < 0.001, n = 3). (B) The levels of LRG1 protein were detected by Western Blot analysis, with the grayscale analysis using -actin as the internal control (ANOVA, p < 0.001, n = 3). (C) Cell proliferation was examined by MTT assay (ANOVA, p = 0.962, p = 0.145, p = 0.003, p = 0.021, p = 0.008 for 12 h, 24 h, 48 h, 72 h and 96 h respectively, n = 3). (D, E) Invasiveness of SHG-44 cells with and without LRG1 overexpression was assessed by Transwell assay (ANOVA, p < 0.001, n = 3). (F, G, H) Cell scratching assay was performed to assess cell migration rate in LRG1-overexpressing cells in comparison with the control cells (ANOVA, p < 0.001 for 12 h and p = 0.004 for 24 h, n = 3). The figure shows the representative images of three independent experiments, and data are presented as the mean ± standard deviation. Compared with pUM-T vector control cells, *p < 0.05, **p < 0.01, ***p < 0.001.
suppressed the augmented invasiveness induced by LRG1 overexpression (73.4 ± 8.38 vs 101.6 ± 11.41; p < 0.001) (Fig. 4B and C). These results suggest that LRG1 inhibits E-cadherin expression by activating TGF- signaling pathway, thereby promoting the invasiveness of the glioma cells. Discussion Upregulation of LRG1 is associated with various malignant tumors, but its role in glioma pathology has not been explicitly reported. In this study, glioma cell strains with constitutive silencing or overexpression of LRG1 were established. Our experiments with overexpressing and silencing LRG1 demonstrated that LRG1 plays a critical role in promoting migration and invasion of glioma
cells, which is, at least partially, mediated via activation of the TGF- signaling pathway and inhibition of E-cadherin expression. These findings provide preliminary characterization of the molecular mechanism of LRG1 in the development of glioma. Excessive proliferation, migration and invasion of tumor cells are the main biological characteristics of malignant tumors, and the most important factors in determining the degree of malignancy (Schonberg et al., 2014). Although potential clinicopathologic associations have been demonstrated with LRG1 in multiple tumors, including ovarian (Andersen et al., 2010), lung (Li et al., 2011) and colon cancer (Ladd et al., 2012), little is known about the role of LRG1 in tumor cells and tumor development. In this study, we observed that LRG1 was highly expressed in Grade IV glioma cell lines, but was expressed at a relatively lower level in SHG-44 cells
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8 6
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
Fig. 3. Overexpression of LRG1 augmented activation of TGF- signaling pathway and repressed E-cadherin expression in glioma cells. Western Blot assay was performed to detect the protein levels of (A) TGF-1 (ANOVA, p < 0.001, n = 3), (B) p-smad2 (ANOVA, p = 0.0011 for p-smad2 and p = 0.678 for smad2, n = 3), (C) p-smad3 (ANOVA, p = 0.0014 for p-smad3 and p = 0.811 for smad3, n = 3) and (D) E-cadherin (ANOVA, p = 0.003, n = 3), with the grayscale analysis using -actin as the internal control. (E) Real-time PCR was used to detect the level of E-cadherin mRNA (ANOVA, p = 0.0019, n = 3). (F) Immunofluorescence staining was performed to observe the distribution of E-cadherin protein in glioma cells. E-cadherin was primarily expressed in cell junctions (red), while the nuclei were stained with DAPI (blue). The figure shows the representative images of three independent experiments, and data are presented as the mean ± standard deviation. Compared with pUM-T vector control, **p < 0.01, ***p < 0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
that originated from Grade III glioma, suggesting that LRG1 expression in glioma might be correlated with tumor grade. Moreover, by manipulating the levels of LRG1 in glioma cells, we showed that the proliferative capacity, the migration rate and the invasiveness of glioma cells were positively correlated with the intracellular levels of LRG1 (Figs. 1 and 2), suggesting that LRG1 plays an important role in promoting proliferation, migration and invasion of glioma cells and it might play a part in glioma progression. TGF- superfamily proteins have been demonstrated to play important roles in cell proliferation, migration and invasion (Drabsch and ten Dijke, 2012; Sun et al., 1995), and their
aberrant expression and activity is associated with a variety of tumors (Araz et al., 2014; Chou et al., 2010; Giannelli et al., 2014; Zhang et al., 2014). Here we showed that overexpression of LRG1 activated TGF- signaling in glioma cells by upregulating TGF-1 and promoting the phosphorylation of its downstream Smad proteins (Fig. 3A–C), which was associated with enhanced migration and invasion of glioma cells (Fig. 2D–H). In addition, inhibiting TGF signaling pathway by the TGF- receptor inhibitor SB431542 effectively reduced the invasiveness of glioma cells (Fig. 4B and C), suggesting that TGF- signaling pathway plays a critical role in regulating the migration and invasion of glioma cells. The positive role
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
7
Fig. 4. Inhibition of TGF- signaling reversed LRG1-induced E-cadherin downregulation and invasiveness. LRG1-overexpressing cells and vector transfection control cells were cultured in the medium containing TGF- receptor inhibitor SB431542 or an equivalent volume of DMSO for 48 h. (A) Expression levels of E-cadherin were examined by immunoblotting, with grayscale analysis using -actin as the internal control (ANOVA, p < 0.001, n = 4). (B, C) Transwell assays were performed to detect the invasiveness of SB431542-treated cells (ANOVA, p < 0.001, n = 4). The figure shows the representative images of three independent experiments, and data are presented as the mean ± standard deviation. Compared with vector + DMSO, ***p < 0.001; compared with LRG1 + DMSO, # p < 0.05, ## p < 0.01.
of TGF- signaling in glioma cell migration and invasion observed in this study is consistent with previous reports on glioma (Lu et al., 2011; Merzak et al., 1994) and other types of tumors (Fransvea et al., 2008; Wiercinska et al., 2011), and herein we identified that LRG1 is an upstream regulator of TGF- signaling pathway. LRG1 has been demonstrated to regulate the migratory machinery of neuroblastoma cells through the non-canonical TGF- pathway (Lynch et al., 2012). In the present study, we show for the first time that LRG1 also plays a critical role in modulating the canonical TGF- pathway. The expression of E-cadherin, a well known factor that plays an important regulatory role in epithelial-mesenchymal transition (EMT) (Schmalhofer et al., 2009), was found to be negatively correlated with the expression level of TGF-1 in primary glioma tissues and in glioma cell lines (Yang et al., 2012). Downregulating or abolishing the expression of E-cadherin can trigger EMT, thereby endowing the tumor cells with strong capacities for metastasis and invasion (Thiery et al., 2009). Expression of E-cadherin has been shown to be reduced in various tumor tissues (Silye et al., 1998; Tanaka et al., 2002), and low expression of E-cadherin in the brain of glioma patients renders the risk of EMT, resulting in deterioration of glioma (Song et al., 2014). Our study showed that the expression of E-cadherin was reduced in LRG1-overexpressing cells, which was reversed by inhibiting TGF- signaling pathway (Fig. 4), suggesting that LRG1 inhibits E-cadherin expression via TGF- signaling pathway, thereby enhancing the invasiveness of glioma cells and the risk of malignant metastasis. Conclusions In the present study, we demonstrate that LRG1 plays an important role in promoting proliferation, migration and invasion of
glioma cells as well as modulating the expression of E-cadherin through TGF- signaling pathway. Our study provides preliminary characterization of the role of LRG1 in the malignant progression of glioma, and suggests that LRG1 may be further explored as a potential target of gene therapy for glioma. Acknowledgement This study was supported by a grant from the National Natural Science Foundation of China (NSFC, No. 30640008). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.acthis.2015.05. 001 References Altieri R, Agnoletti A, Quattrucci F, Garbossa D, Calamo Specchia FM, Bozzaro M, et al. Molecular biology of gliomas: present and future challenges. Transl Med UniSa 2014;10:29–37. Andersen JD, Boylan KL, Jemmerson R, Geller MA, Misemer B, Harrington KM, et al. Leucine-rich alpha-2-glycoprotein-1 is upregulated in sera and tumors of ovarian cancer patients. J Ovarian Res 2010;3:21. Araz O, Demirci E, Yilmazel Ucar E, Calik M, Karaman A, DururSubasi I, et al. Roles of Ki-67, p53, transforming growth factor-beta and lysyl oxidase in the metastasis of lung cancer. Respirology 2014;19:1034–9.
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
G Model ACTHIS-50989; No. of Pages 8 8
ARTICLE IN PRESS D. Zhong et al. / Acta Histochemica xxx (2015) xxx–xxx
Arrillaga-Romany I, Reardon DA, Wen PY. Current status of antiangiogenic therapies for glioblastomas. Expert Opin Investig Drugs 2014;23:199–210. Chou JL, Chen LY, Lai HC, Chan MW. TGF-beta: friend or foe? The role of TGF-beta/SMAD signaling in epigenetic silencing of ovarian cancer and its implication in epigenetic therapy. Expert Opin Ther Targets 2010;14:1213–23. Cloughesy TF, Cavenee WK, Mischel PS. Glioblastoma: from molecular pathology to targeted treatment. Annu Rev Pathol 2014;9:1–25. Cuddapah VA, Robel S, Watkins S, Sontheimer H. A neurocentric perspective on glioma invasion. Nat Rev Neurosci 2014;15: 455–65. Drabsch Y, ten Dijke P. TGF-beta signalling and its role in cancer progression and metastasis. Cancer Metastasis Rev 2012;31: 553–68. Fransvea E, Angelotti U, Antonaci S, Giannelli G. Blocking transforming growth factor-beta up-regulates E-cadherin and reduces migration and invasion of hepatocellular carcinoma cells. Hepatology 2008;47:1557–66. Giannelli G, Villa E, Lahn M. Transforming growth factor-beta as a therapeutic target in hepatocellular carcinoma. Cancer Res 2014;74:1890–4. Goodenberger ML, Jenkins RB. Genetics of adult glioma. Cancer Genet 2012;205:613–21. Halder SK, Beauchamp RD, Datta PK. A specific inhibitor of TGFbeta receptor kinase, SB-431542, as a potent antitumor agent for human cancers. Neoplasia 2005;7:509–21. Haupt H, Baudner S. Isolation and characterization of an unknown, leucine-rich 3.1-S-alpha2-glycoprotein from human serum (author’s transl). Hoppe Seylers Z Physiol Chem 1977;358: 639–46. Kamato D, Burch ML, Piva TJ, Rezaei HB, Rostam MA, Xu S, et al. Transforming growth factor-beta signalling: role and consequences of Smad linker region phosphorylation. Cell Signal 2013;25:2017–24. Kondo Y, Katsushima K, Ohka F, Natsume A, Shinjo K. Epigenetic dysregulation in glioma. Cancer Sci 2014;105:363–9. Ladd JJ, Busald T, Johnson MM, Zhang Q, Pitteri SJ, Wang H, et al. Increased plasma levels of the APC-interacting protein MAPRE1, LRG1, and IGFBP2 preceding a diagnosis of colorectal cancer in women. Cancer Prev Res (Phila) 2012;5:655–64. Laping NJ, Grygielko E, Mathur A, Butter S, Bomberger J, Tweed C, et al. Inhibition of transforming growth factor (TGF)-beta1induced extracellular matrix with a novel inhibitor of the TGF-beta type I receptor kinase activity: SB-431542. Mol Pharmacol 2002;62:58–64. Li Y, Zhang Y, Qiu F, Qiu Z. Proteomic identification of exosomal LRG1: a potential urinary biomarker for detecting NSCLC. Electrophoresis 2011;32:1976–83. Liu L, Dai Q, Min Z, Zhang M. Transforming growth factor beta1 enhances the invasiveness of human glioma cell line via ERK/MAPK pathway. Nan Fang Yi Ke Da Xue Xue Bao 2013;33:1744–7. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Jouvet A, et al. The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol (Berl) 2007;114: 97–109. Lu Y, Jiang F, Zheng X, Katakowski M, Buller B, To SS, et al. TGF-beta1 promotes motility and invasiveness of glioma cells through activation of ADAM17. Oncol Rep 2011;25:1329–35. Lynch J, Fay J, Meehan M, Bryan K, Watters KM, Murphy DM, et al. MiRNA-335 suppresses neuroblastoma cell invasiveness by direct targeting of multiple genes from the non-canonical TGF-beta signalling pathway. Carcinogenesis 2012;33:976–85.
Merzak A, McCrea S, Koocheckpour S, Pilkington GJ. Control of human glioma cell growth, migration and invasion in vitro by transforming growth factor beta 1. Br J Cancer 1994;70: 199–203. Nakajima M, Miyajima M, Ogino I, Watanabe M, Hagiwara Y, Segawa T, et al. Brain localization of leucine-rich alpha2glycoprotein and its role. Acta Neurochir Suppl 2012;113: 97–101. Nakajima M, Miyajima M, Ogino I, Watanabe M, Miyata H, Karagiozov KL, et al. Leucine-rich alpha-2-glycoprotein is a marker for idiopathic normal pressure hydrocephalus. Acta Neurochir (Wien) 2011;153:1339–46, discussion 1346. O’Donnell LC, Druhan LJ, Avalos BR. Molecular characterization and expression analysis of leucine-rich alpha2-glycoprotein, a novel marker of granulocytic differentiation. J Leukoc Biol 2002;72:478–85. Schmalhofer O, Brabletz S, Brabletz T. E-cadherin, beta-catenin, and ZEB1 in malignant progression of cancer. Cancer Metastasis Rev 2009;28:151–66. Schonberg DL, Lubelski D, Miller TE, Rich JN. Brain tumor stem cells: molecular characteristics and their impact on therapy. Mol Asp Med 2014;39C:82–101. Silye R, Karayiannakis AJ, Syrigos KN, Poole S, van Noorden S, Batchelor W, et al. E-cadherin/catenin complex in benign and malignant melanocytic lesions. J Pathol 1998;186:350–5. Song Y, Hu Z, Long H, Peng Y, Zhang X, Que T, et al. A complex mechanism for HDGF-mediated cell growth, migration, invasion, and TMZ chemosensitivity in glioma. J Neurooncol 2014;119:285–95. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 2005;352:987–96. Sun D, Kar S, Carr BI. Differentially expressed genes in TGF-beta 1 sensitive and resistant human hepatoma cells. Cancer Lett 1995;89:73–9. Takahashi N, Takahashi Y, Putnam FW. Periodicity of leucine and tandem repetition of a 24-amino acid segment in the primary structure of leucine-rich alpha 2-glycoprotein of human serum. Proc Natl Acad Sci U S A 1985;82:1906–10. Tanaka M, Kitajima Y, Edakuni G, Sato S, Miyazaki K. Abnormal expression of E-cadherin and beta-catenin may be a molecular marker of submucosal invasion and lymph node metastasis in early gastric cancer. Br J Surg 2002;89:236–44. Thiery JP, Acloque H, Huang RY, Nieto MA. Epithelial–mesenchymal transitions in development and disease. Cell 2009;139:871–90. Wang X, Abraham S, McKenzie JA, Jeffs N, Swire M, Tripathi VB, et al. LRG1 promotes angiogenesis by modulating endothelial TGF-beta signalling. Nature 2013;499:306–11. Weller M, Wick W. Neuro-oncology in 2013: improving outcome in newly diagnosed malignant glioma. Nat Rev Neurol 2014;10:68–70. Wiercinska E, Naber HP, Pardali E, van der Pluijm G, van Dam H, ten Dijke P. The TGF-beta/Smad pathway induces breast cancer cell invasion through the up-regulation of matrix metalloproteinase 2 and 9 in a spheroid invasion model system. Breast Cancer Res Treat 2011;128:657–66. Yang L, Liu M, Deng C, Gu Z, Gao Y. Expression of transforming growth factor-beta1 (TGF-beta1) and E-cadherin in glioma. Tumour Biol 2012;33:1477–84. Zhang G, Zhao Q, Yu S, Lin R, Yi X. Pttg1 inhibits TGFbeta signaling in breast cancer cells to promote their growth. Tumour Biol 2014. Zhong D, Zhao S, He G, Li J, Lang Y, Ye W, et al. Stable knockdown of LRG1 by RNA interference inhibits growth and promotes apoptosis of glioblastoma cells in vitro and in vivo. Tumour Biol 2015.
Please cite this article in press as: Zhong D, et al. LRG1 modulates invasion and migration of glioma cell lines through TGF- signaling pathway. Acta Histochemica (2015), http://dx.doi.org/10.1016/j.acthis.2015.05.001
