Analyst View Article Online
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
PAPER
Cite this: Analyst, 2014, 139, 1721
View Journal | View Issue
Metal–organic framework-based molecular beacons for multiplexed DNA detection by synchronous fluorescence analysis† Tai Ye, Yufei Liu, Ming Luo, Xia Xiang, Xinghu Ji,* Guohua Zhou and Zhike He* We report a new sensor combined two dimensional metal–organic framework (MOF), N,N-bis(2-hydroxyethyl)dithiooxamidato copper(II) (H2dtoaCu), with the hairpin-structured oligonucleotides and demonstrate its feasibility in detecting multiplexed sequence-specific DNA. The key component of this sensor (MOF– MBs) is the hairpin-structured fluorescent oligonucleotide that allows the MOFs to function as both a “nanoscaffold” for the oligonucleotide and a “nanoquencher” of the fluorophore. An oligonucleotide sequence fragment of wild-type HBV (T1) and a reverse-transcription oligonucleotide sequence of RNA fragment of HIV (T2) were used as model systems. While in the presence of the targets, the fluorescence of dyes was recovered by forming a double strand structure. Multiplex DNA detection can be realized by
Received 6th November 2013 Accepted 3rd January 2014
synchronous scanning fluorescence spectrometry, and there was no cross reaction between the two probes. Under the optimum conditions, the fluorescence intensities of two dyes all exhibit good linear dependence on their target DNA concentration in the range of 1–10 nM with the detection limit of 0.87
DOI: 10.1039/c3an02077k www.rsc.org/analyst
nM and 0.22 nM for T1 and T2, respectively. As a proof of concept, the MOF–MBs have been successfully used as a potential sensing platform for simultaneous detection of multiplexed DNA.
1. Introduction Sensitive analysis of target DNA, especially for simultaneous detection of multiplexed DNA is important in clinical prediagnosis.1–3 For the analysis of DNA, many optical sensors had been fabricated with carbon nanomaterials, such as graphene,4 graphene oxide,5 carbon nanotube,6 etc. These carbon nanomaterials are applied in optical sensors as efficient quenchers or energy accepters, due to strong interaction between their hexagonal cells and the ring structures of nucleotides through p–p stacking interaction.7,8 Although these carbon nanomaterials were involved in biomolecule assays successfully, the high-quality preparation at the large-scale is still a challenge.9 MOFs are highly crystalline inorganic–organic hybrids that are constructed by assembling metal ions or metal-containing clusters with multidentate organic ligands via coordinate bonds.10 Owing to their large internal surface areas, extensive porosity, and high degree of crystallinity, MOFs show fabulous performance in gas storage11 and separation12 as well as heterogeneous catalysis.13 Lately, MOFs show potential
Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), College of Chemistry and Molecular Sciences, Wuhan University, Wuhan 430072, P.R. China. E-mail: [email protected]; Fax: +86-27-6875-4067; Tel: +8627-6875-6557 † Electronic supplementary information (ESI) available: Fluorescence recovery of T1 and T2 in 1% culture medium, the linear curve of determination for T1 and T2 and the interference of high concentration ss-DNA. See DOI: 10.1039/c3an02077k
This journal is © The Royal Society of Chemistry 2014
application in biology analysis.14,15 Zhu and co-workers had demonstrated MOFs can be utilized as a sensing platform for the detection of the HIV DNA and thrombin, with detection limits of 3 and 1.3 nM, respectively.16 Wei and co-workers utilized H5N1 antibody protected dye modied DNA probe from hydrolyzation by exonuclease I with a “turn-off” uorescence signal for H5N1 antibody detection.17 Chen and co-workers fabricated a new uorescence sensor with MOFs for sequencespecic recognition of duplex DNA. In the presence of the double stranded (ds-)DNA target, the TFO (triplex-forming oligonucleotide) could interact with the major groove in ds-DNA to form a rigid triplex-structure, resulting in the recovery of uorescence.18 The detection limit was as low as 1.3 nM with good selectivity. However, to the best of our knowledge, there is no report on using MOFs as a platform for multiplexed DNA detection yet. Molecular beacons (MBs) have very high selectivity in regard to the identication of a single base-pair mismatch.19,20 The classic MBs consist of an organic uorophore and a quencher in a hairpin-shaped oligonucleotide.21 However, low signal to noise, tedious modifying process, and easy digestion by nuclease, which conned MBs' application.22 In order to overcome these limitations, Li and co-workers utilized the longrange nanoscale energy transfer between uorophore and graphene to improve the sensitivity of MBs-based DNA detection.23 Similarly, a series of carbon materials, such as graphene oxide,24 carbon nanotube22 also show excellent performance in enhancing signal-to-noise of MBs. Compared with graphene,
Analyst, 2014, 139, 1721–1725 | 1721
View Article Online
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
Analyst
MOFs show similar two-dimension structure, and the ligands of MOFs usually contain a conjugated p-electron, which can absorb the loop area of MBs to the MOFs. Additionally, the metal cations of MOFs have intrinsic uorescence quenching ability. Thus the MOFs could efficiently quench the uorescence of the dye labeled on hairpin-shaped oligonucleotide. Regarding that, herein, we developed MOF-based MBs (MOF–MBs), and applied them for the multiplexed DNA detection by synchronous uorescence analysis. It was demonstrated by an oligonucleotide sequence of wild-type HBV fragment and a reverse-transcription oligonucleotide sequence of RNA fragment of HIV as model systems. In the absence of the targets, dyes labelled hairpin-shaped oligonucleotides are adsorbed on MOFs via interactions between DNA nucleotide bases and the conjugated p-electron rich MOFs, bringing carboxyuorescein (FAM)-tagged probes (PHBV) and 5(6)-carboxyrhodamine, triethylammonium salt (ROX)-tagged probes (PHIV) close to MOFs. As a result of that, their uorescence is quenched by MOFs. However, in the presence of the targets, PHBV and PHIV hybridized with their targets resulting in the formation of doublestranded DNA, causing the release of the probes from MOFs and the recovery of their uorescences. The uorescence signals of two uorophores can be obtained simultaneously using synchronous scanning uorescence spectrometry, as the wavelength intervals between the maximum excitation wavelength and maximum emission wavelength of FAM and ROX are very close. Thus, the simultaneous detection of two targets can be realized by measuring uorescence signals of FAM and ROX, respectively.
2. 2.1
Experimental section Apparatus and chemicals
DNA sequences were synthesized by Shanghai Sangon Biotechnology Co., Ltd (Shanghai, China): Molecular beacon probe of HBV (PHBV): 50 -TAT ATA GCA GAC ACA TCC AGC GAT AGC CAG GAC AAT ATA TA-FAM-30 Molecular beacon probe of HIV (PHIV): 50 -TTT AAA TGC ATC CAG GTC ATG TTA TTC CAA ATA TCT TCT TTT AAA-ROX-30 Target sequences of HBV and HIV: HBV (T1): 50 -TTG TCC TGG CTA TCG CTG GAT GTG TCT GC-30 HIV (T2): 50 -AGA AGA TAT TTG GAA TAA CAT GAC CTG GAT GCA-30 Single-base mismatched sequences (MT1) of HBV: MT1: 50 -TTG TCC TGG CTA TCA CTG GAT GTG TCT GC-30 Single-base mismatched sequences of HIV: MT1: 50 -AGA AGA TAT TTG GAA TTA CAT GAC CTG GAT GCA-30 No complementary single strand (ss) DNA: ss-DNA: TATATGGATGATGTGGTATT All DNA samples were dissolved in 20 mM Tris–HCl buffer solution (pH 8.0, 100 mM NaCl) and stored at 4 C for use. H2dtoaCu was synthesized according to the published procedure.25–27 4.0 mg H2dtoaCu powder was dispersed into
1722 | Analyst, 2014, 139, 1721–1725
Paper
20 mL double-distilled water with oscillation and ultrasound to form 0.2 mg ml1 MOFs aqueous solution and then stored at 4 C for later use. All other chemicals employed were of analytical grade. Fluorescence spectra were obtained in an RF-5301PC spectrophotometer (Shimadzu, Japan), with 10 nm band-pass spectrometer slits. The xed wavelength difference (Dl) of synchronous scanning uorescence spectroscopy was set at 22 nm. 2.2
Procedure for sample preparation
In a typical DNA assay, the uorescent probes (PHBV and PHIV, 5 nM) and their target DNA were incubated in a 20 mM Tris–HCl buffer for 30 min at room temperature to ensure complete hybridization. Then, 12 mg mL1 of MOFs was added. Aer 10 min incubation, uorescence measurements were performed with a quartz cuvette to quantify the targets.
3. 3.1
Results and discussion The principle of detection
The principle for multiplexed DNA detection with MOF-based MBs is depicted in Fig. 1. In the absence of targets, PHBV and PHIV were adsorbed on MOFs via interactions between DNA nucleotide bases and the conjugated p-electron rich MOFs, which brought the uorophores (FAM of PHBV and ROX of PHIV) close to the MOFs surface. Thus, the uorescence of FAM and ROX was quenched simultaneously by MOFs. However, in the presence of the targets, PHBV and PHIV hybridized with their targets resulting in the formation of ds-DNA far from MOFs and the uorescence of FAM and ROX is retained. In this strategy, the uorescence signals of FAM and ROX can be obtained simultaneously using synchronous scanning uorescence spectrometry, as the wavelength intervals between the maximum excitation wavelength and maximum emission wavelength of FAM and ROX are close between 23 nm and 20 nm, respectively. Thus, the simultaneous detections of T1 and T2 can be realized by measuring uorescence signals of FAM and ROX. 3.2
The uorescence quenching of probes by MOFs
The high quenching efficiency of probes based MOFs is the basis of the sensor. Compared with other MOFs, H2dtoaCu shows effective uorescence quenching ability.17 Therefore, the
Fig. 1
The principle of simultaneous detection T1 and T2.
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
Paper
concentration of MOFs is investigated as shown in Fig. 2. The results show that the uorescence intensities of two probes decreased quickly with the increased concentration of MOFs. As we know, the Cu complex with free coordination sites efficiently quench uorophores in hairpin-shaped oligonucleotide probes.28 In addition, the porous structure of MOFs was formed by more than one Cu complex which facilitated the design of MBs with very high signal to noise performance in DNA analysis. As shown in Fig. 2, the uorescence intensity of FAM decreases with the increase of concentration of MOFs from 3–15 mg mL1, and achieves the minimum at 15 mg mL1. At the same time, the uorescence intensity of ROX decreases with the increase of MOFs from 3–12 mg mL1, and the change of uorescence intensity (DF) was no longer changed when the concentration of MOFs was higher than 12 mg mL1. The maximal quenching efficiencies were about 85.0% for FAM, 91.1% for ROX, respectively. Considering the sensitivity of the assay, 12 mg mL1 of MOFs was selected for further experiments. 3.3
Fig. 3 Changes in the fluorescence spectra of the sensor upon increasing the concentration of T1: 0, 0.6, 1, 3, 5, 7, and 10 nM (from the bottom to the top). Insert: the linear curve of single determination for THBV.
The uorescence recovery of the sensor
We then explored the recovery of uorescence of MOF–MBs, taking an oligonucleotide sequence fragment of wild-type HBV as a model. As shown in Fig. 3, the uorescence intensity increased with the concentration of THBV raised from 0.6–10 nM, indicating that the probe freed from absorption was highly dependent on the concentration of the target DNA. The immersion of nucleotide bases into formed duplex structure protected the DNA from being absorbed. With the relative distance between ds-DNA and MOFs increasing, the photoinduced electron transfer-based quenching was weakened which is consistent with previous reports.16 As a result, the quantitative determination of oligonucleotide with developed MOF–MBs is feasible. 3.4
Analyst
Cross-reaction analysis
Before simultaneous detection of T1 and T2, it is necessary to demonstrate whether there is cross reaction between PHBV and
PHIV, as the cross-reaction is a crucial analytical parameter regarding the assay specicity and thus the reliability of the multiplex detection. As shown in Fig. 4, when T1 alone existed in the sample solution, increased uorescence emission of PHBV was observed. In contrast, when T2 alone existed in the analysis sample, only PHIV uorescence emission intensity increased. When both targets existed in the sample solution, the two distinguishing probe uorescence emissions increased at the same time. The uctuation of uorescence intensity between single detection and simultaneous detection was due to 12 mg mL1 of MOFs being an overdose for single detection. Herein, the MOFs were used as substrates for analyte detection, while in the proposed detection scheme, MOFs mainly served as a signal quencher for the free dyes labeled probes. Additionally, compared with ss-DNA probe, the hairpin-structured uorescent oligonucleotide has good selectivity. 3.5
Fig. 2 Fluorescence quenching of 5 nM probes (PHBV and PHIV) in the presence of MOFs with concentration of 0, 3, 6, 9, 12, 15, and 18 mg mL1. Insert: linear curve of fluorescence quenching for probes.
This journal is © The Royal Society of Chemistry 2014
The simultaneous detection of the targets
Fig. 5 characterizes the simultaneous detection ability of MOFbased MBs. The uorescence emission spectra of the multiplexed probes upon the addition of different concentrations of targets were recorded by synchronous scanning uorescence spectrometry. A gradual increase of uorescence intensity of two probes had been detected, with increasing targets concentrations in the range of 1–100 nM. As shown in the insert of Fig. 5, linear relationships between the uorescence change FT F0 and the concentration of two targets were obtained in the range of 1 nM to 10 nM. For T1, the tted regression equation is DF1 ¼ 58.77C1 33.29 with a correlation coefficient of 0.9920 (R2), and that of T2 is DF2 ¼ 43.19C2 1.529 with a correlation coefficient of 0.9816 (R2). The detection limit (3s) of T1 is estimated to be 0.87 nM and that of T2 is 0.22 nM, respectively. A series of parallel experiments (n ¼ 5) about 5 nM T1 and T2 were used for estimating the precision and the relative standard deviation (RSD) were 5.64% and 1.91%, respectively.
Analyst, 2014, 139, 1721–1725 | 1723
View Article Online
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
Analyst
Paper
Fig. 4 (A) Fluorescence spectra of (a) MBs probes, (b) MOF-MBs probes. (B) Fluorescence spectra of (a) MOF–MBs probes, (b) T1 and MOF–MBs probes. (C) Fluorescence spectra of (a) MOF–MBs probes, (b) T2 and MOF–MBs probes. (D) Fluorescence spectra of (a) MOF–MBs probes, (b) T1, T2 and MOF–MBs probes. The concentration of T1 and T2: 5 nM, the MOF–MBs probes consist of 12 mg mL1 of MOFs and 5 nM MBs for each target.
mismatched targets. As shown in Fig. 6, the uorescence signals for targets (T1 and T2) are approximately two times higher than those for their single-base mismatched targets under the same conditions. The results indicate that the proposed method can perfectly distinguish the complementary sequences from the single-base mismatched sequences. To study the inuence of high concentration ss-DNA on this approach, a certain amount of T1 and T2 in the presence of 10 fold and 100 fold ss-DNA was investigated. In the presence of 10 fold ss-DNA, the uorescence recovery shows less change than that of 100 fold ss-DNA
Fig. 5 Synchronous scanning fluorescence spectra of MOF–MBs with different concentrations of target DNA. Concentration of target DNA: 0, 1, 3, 5, 7, 10, 15, 20, 50 and 100 nM (from the bottom to the top). Insert: the linear curve of determination for T1 (a) and T2 (b).
To authenticate the feasibility of our approach in complex biological matrixes, a certain amount of T1 and T2 in 1% culture medium was investigated. The linear relationships between the uorescence change FT F0 and the concentration of two targets were obtained in the range of 1.6 nM to 10 nM (see Fig. S1 in ESI†). Consequently, this assay indicates the potential for applications in multiplexed DNA detection in complex matrix. 3.6
Selectivity analysis
According to the selectivity analysis procedure, the specicity of this method is investigated by challenging with single-base
1724 | Analyst, 2014, 139, 1721–1725
Fig. 6 Changes in fluorescence intensities of the MOF–MBs sensors (5 nM) toward targets DNA (5 nM) and single-base mismatched DNA (5 nM). Inset: fluorescence spectra of MOF–MBs (black line), MOF–MBs with single base mismatch of T1 and T2 (green line), and MOF–MBs with T1 and T2 (red line).
This journal is © The Royal Society of Chemistry 2014
View Article Online
Paper
(see Fig. S2 in ESI†). However, the results indicate the MOF– MBs show good interference tolerance.
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
4 Conclusions An MOF-based sensor was developed for dual-colour DNA detection with synchronous uorescence analysis. In the analysis of DNA, the MOF–MBs show graphene based sensor-like properties which enhance the signal to noise of individual MBs. MOF's convenient and simple synthesis in large scale overcomes the time-consuming preparation of graphene based sensors. Furthermore, as a sensing platform, MOF–MBs show no cross-reaction in multiplex DNA detection.
Acknowledgements This work was nancially supported by the National Key Scientic Program-Nanoscience and Nanotechnology (2011CB933600) and the National Science Foundation of China (21075093, 21275109 and 21205089).
Notes and references 1 X. Zuo, F. Xia, Y. Xiao and K. W. Plaxco, J. Am. Chem. Soc., 2010, 132, 1816. 2 F. Xia, X. Zuo, R. Yang, Y. Xiao, D. Kang, A. Vall´ ee-B´ elisle, X. Gong, J. D. Yuen, B. B. Y. Hsu, A. J. Heeger and K. W. Plaxco, Proc. Natl. Acad. Sci., 2010, 107, 10837. 3 L. Zhang, J. Zhu, S. Guo, T. Li, J. Li and E. Wang, J. Am. Chem. Soc., 2013, 135, 2403. 4 W. L. Wei and X. G. Qu, Small, 2012, 8, 2138. 5 K. P. Loh, Q. L. Bao, G. Eda and M. Chhowalla, Nat. Chem., 2010, 2, 1015. 6 H. Chen, J. Q. Wang, G. H. Liang, P. Zhang and J. L. Kong, Chem. Commun., 2012, 48, 269. 7 M. Zheng, A. Jagota, E. D. Semke, B. A. Diner, R. S. Mclean, S. R. Lustig, R. E. Richardson and N. G. Tassi, Nat. Mater., 2003, 2, 338. 8 M. Zheng, A. Jagota, M. S. Strano, A. P. Santos, P. Barone, S. G. Chou, B. A. Diner, M. S. Dresselhaus, R. S. McLean, G. B. Onoa, G. G. Samsonidze, E. D. Semke, M. Usrey and D. J. Walls, Science, 2003, 302, 1545.
This journal is © The Royal Society of Chemistry 2014
Analyst
9 S. J. Guo and S. J. Dong, Chem. Soc. Rev., 2011, 40, 2644. 10 J. Lee, O. K. Farha, J. Roberts, K. A. Scheidt, S. T. Nguyen and J. T. Hupp, Chem. Soc. Rev., 2009, 38, 1450. 11 O. K. Farha, A. O. Yazaydin, I. Eryazici, C. D. Malliakas, B. G. Hauser, M. G. Kanatzidis, S. T. Nguyen, R. Q. Snurr and J. T. Hupp, Nat. Chem., 2010, 2, 944. 12 Z. Y. Gu, C. X. Yang, N. Chang and X. P. Yan, Acc. Chem. Res., 2012, 45, 734. 13 L. E. Kreno, K. Leong, O. K. Farha, M. Allendorf, R. P. Van Duyne and J. T. Hupp, Chem. Rev., 2012, 112, 1105. 14 S. Jung, Y. Kim, S. J. Kim, T. H. Kwon, S. Huh and S. Park, Chem. Commun., 2011, 47, 2904. 15 W. L. Liu, S. H. Lo, B. Singco, C. C. Yang, H. Y. Huang and C. H. Lin, J. Mater. Chem. B, 2013, 1, 928. 16 X. Zhu, H. Y. Zheng, X. F. Wei, Z. Y. Lin, L. H. Guo, B. Qiu and G. N. Chen, Chem. Commun., 2013, 49, 1276. 17 X. Wei, L. Zheng, F. Luo, Z. Lin, L. Guo, B. Qiu and G. Chen, J. Mater. Chem. B, 2013, 1, 1812. 18 Z. Lin and G. Chen, Analyst, 2013, 138, 3490. 19 R. M. Kong, X. B. Zhang, Z. Chen, H. M. Meng, Z. L. Song, W. H. Tan, G. L. Shen and R. Q. Yu, Anal. Chem., 2011, 83, 7603. 20 D. S. Xiang, G. H. Zhou, M. Luo, X. H. Ji and Z. K. He, Analyst, 2012, 137, 3787. 21 C. H. Lu, J. Li, J. J. Liu, H. H. Yang, X. Chen and G. N. Chen, Chem. – Eur. J., 2010, 16, 4889. 22 S. J. Zhen, L. Q. Chen, S. J. Xiao, Y. F. Li, P. P. Hu, L. Zhan, L. Peng, E. Q. Song and C. Z. Huang, Anal. Chem., 2010, 82, 8432. 23 F. Li, Y. Huang, Q. Yang, Z. T. Zhong, D. Li, L. H. Wang, S. P. Song and C. H. Fan, Nanoscale, 2010, 2, 1021. 24 W. H. Wu, H. Y. Hu, F. Li, L. H. Wang, J. M. Gao, J. X. Lu and C. H. Fan, Chem. Commun., 2011, 47, 1201. 25 Y. Nagao, T. Kubo, K. Nakasuji, R. Ikeda, T. Kojima and H. Kitagawa, Synth. Met., 2005, 154, 89. 26 M. Fujishima, Y. Nagao, R. Ikeda, S. Kanda and H. Kitagawa, Synth. Met., 2003, 133, 433. 27 H. Kitagawa, Y. Nagao, M. Fujishima, R. Ikeda and S. Kanda, Inorg. Chem. Commun., 2003, 6, 346. 28 J. Brunner and R. Kraemer, J. Am. Chem. Soc., 2004, 126, 13626.
Analyst, 2014, 139, 1721–1725 | 1725
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
PAPER
Cite this: Analyst, 2014, 139, 1721
View Journal | View Issue
Metal–organic framework-based molecular beacons for multiplexed DNA detection by synchronous fluorescence analysis† Tai Ye, Yufei Liu, Ming Luo, Xia Xiang, Xinghu Ji,* Guohua Zhou and Zhike He* We report a new sensor combined two dimensional metal–organic framework (MOF), N,N-bis(2-hydroxyethyl)dithiooxamidato copper(II) (H2dtoaCu), with the hairpin-structured oligonucleotides and demonstrate its feasibility in detecting multiplexed sequence-specific DNA. The key component of this sensor (MOF– MBs) is the hairpin-structured fluorescent oligonucleotide that allows the MOFs to function as both a “nanoscaffold” for the oligonucleotide and a “nanoquencher” of the fluorophore. An oligonucleotide sequence fragment of wild-type HBV (T1) and a reverse-transcription oligonucleotide sequence of RNA fragment of HIV (T2) were used as model systems. While in the presence of the targets, the fluorescence of dyes was recovered by forming a double strand structure. Multiplex DNA detection can be realized by
Received 6th November 2013 Accepted 3rd January 2014
synchronous scanning fluorescence spectrometry, and there was no cross reaction between the two probes. Under the optimum conditions, the fluorescence intensities of two dyes all exhibit good linear dependence on their target DNA concentration in the range of 1–10 nM with the detection limit of 0.87
DOI: 10.1039/c3an02077k www.rsc.org/analyst
nM and 0.22 nM for T1 and T2, respectively. As a proof of concept, the MOF–MBs have been successfully used as a potential sensing platform for simultaneous detection of multiplexed DNA.
1. Introduction Sensitive analysis of target DNA, especially for simultaneous detection of multiplexed DNA is important in clinical prediagnosis.1–3 For the analysis of DNA, many optical sensors had been fabricated with carbon nanomaterials, such as graphene,4 graphene oxide,5 carbon nanotube,6 etc. These carbon nanomaterials are applied in optical sensors as efficient quenchers or energy accepters, due to strong interaction between their hexagonal cells and the ring structures of nucleotides through p–p stacking interaction.7,8 Although these carbon nanomaterials were involved in biomolecule assays successfully, the high-quality preparation at the large-scale is still a challenge.9 MOFs are highly crystalline inorganic–organic hybrids that are constructed by assembling metal ions or metal-containing clusters with multidentate organic ligands via coordinate bonds.10 Owing to their large internal surface areas, extensive porosity, and high degree of crystallinity, MOFs show fabulous performance in gas storage11 and separation12 as well as heterogeneous catalysis.13 Lately, MOFs show potential
Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), College of Chemistry and Molecular Sciences, Wuhan University, Wuhan 430072, P.R. China. E-mail: [email protected]; Fax: +86-27-6875-4067; Tel: +8627-6875-6557 † Electronic supplementary information (ESI) available: Fluorescence recovery of T1 and T2 in 1% culture medium, the linear curve of determination for T1 and T2 and the interference of high concentration ss-DNA. See DOI: 10.1039/c3an02077k
This journal is © The Royal Society of Chemistry 2014
application in biology analysis.14,15 Zhu and co-workers had demonstrated MOFs can be utilized as a sensing platform for the detection of the HIV DNA and thrombin, with detection limits of 3 and 1.3 nM, respectively.16 Wei and co-workers utilized H5N1 antibody protected dye modied DNA probe from hydrolyzation by exonuclease I with a “turn-off” uorescence signal for H5N1 antibody detection.17 Chen and co-workers fabricated a new uorescence sensor with MOFs for sequencespecic recognition of duplex DNA. In the presence of the double stranded (ds-)DNA target, the TFO (triplex-forming oligonucleotide) could interact with the major groove in ds-DNA to form a rigid triplex-structure, resulting in the recovery of uorescence.18 The detection limit was as low as 1.3 nM with good selectivity. However, to the best of our knowledge, there is no report on using MOFs as a platform for multiplexed DNA detection yet. Molecular beacons (MBs) have very high selectivity in regard to the identication of a single base-pair mismatch.19,20 The classic MBs consist of an organic uorophore and a quencher in a hairpin-shaped oligonucleotide.21 However, low signal to noise, tedious modifying process, and easy digestion by nuclease, which conned MBs' application.22 In order to overcome these limitations, Li and co-workers utilized the longrange nanoscale energy transfer between uorophore and graphene to improve the sensitivity of MBs-based DNA detection.23 Similarly, a series of carbon materials, such as graphene oxide,24 carbon nanotube22 also show excellent performance in enhancing signal-to-noise of MBs. Compared with graphene,
Analyst, 2014, 139, 1721–1725 | 1721
View Article Online
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
Analyst
MOFs show similar two-dimension structure, and the ligands of MOFs usually contain a conjugated p-electron, which can absorb the loop area of MBs to the MOFs. Additionally, the metal cations of MOFs have intrinsic uorescence quenching ability. Thus the MOFs could efficiently quench the uorescence of the dye labeled on hairpin-shaped oligonucleotide. Regarding that, herein, we developed MOF-based MBs (MOF–MBs), and applied them for the multiplexed DNA detection by synchronous uorescence analysis. It was demonstrated by an oligonucleotide sequence of wild-type HBV fragment and a reverse-transcription oligonucleotide sequence of RNA fragment of HIV as model systems. In the absence of the targets, dyes labelled hairpin-shaped oligonucleotides are adsorbed on MOFs via interactions between DNA nucleotide bases and the conjugated p-electron rich MOFs, bringing carboxyuorescein (FAM)-tagged probes (PHBV) and 5(6)-carboxyrhodamine, triethylammonium salt (ROX)-tagged probes (PHIV) close to MOFs. As a result of that, their uorescence is quenched by MOFs. However, in the presence of the targets, PHBV and PHIV hybridized with their targets resulting in the formation of doublestranded DNA, causing the release of the probes from MOFs and the recovery of their uorescences. The uorescence signals of two uorophores can be obtained simultaneously using synchronous scanning uorescence spectrometry, as the wavelength intervals between the maximum excitation wavelength and maximum emission wavelength of FAM and ROX are very close. Thus, the simultaneous detection of two targets can be realized by measuring uorescence signals of FAM and ROX, respectively.
2. 2.1
Experimental section Apparatus and chemicals
DNA sequences were synthesized by Shanghai Sangon Biotechnology Co., Ltd (Shanghai, China): Molecular beacon probe of HBV (PHBV): 50 -TAT ATA GCA GAC ACA TCC AGC GAT AGC CAG GAC AAT ATA TA-FAM-30 Molecular beacon probe of HIV (PHIV): 50 -TTT AAA TGC ATC CAG GTC ATG TTA TTC CAA ATA TCT TCT TTT AAA-ROX-30 Target sequences of HBV and HIV: HBV (T1): 50 -TTG TCC TGG CTA TCG CTG GAT GTG TCT GC-30 HIV (T2): 50 -AGA AGA TAT TTG GAA TAA CAT GAC CTG GAT GCA-30 Single-base mismatched sequences (MT1) of HBV: MT1: 50 -TTG TCC TGG CTA TCA CTG GAT GTG TCT GC-30 Single-base mismatched sequences of HIV: MT1: 50 -AGA AGA TAT TTG GAA TTA CAT GAC CTG GAT GCA-30 No complementary single strand (ss) DNA: ss-DNA: TATATGGATGATGTGGTATT All DNA samples were dissolved in 20 mM Tris–HCl buffer solution (pH 8.0, 100 mM NaCl) and stored at 4 C for use. H2dtoaCu was synthesized according to the published procedure.25–27 4.0 mg H2dtoaCu powder was dispersed into
1722 | Analyst, 2014, 139, 1721–1725
Paper
20 mL double-distilled water with oscillation and ultrasound to form 0.2 mg ml1 MOFs aqueous solution and then stored at 4 C for later use. All other chemicals employed were of analytical grade. Fluorescence spectra were obtained in an RF-5301PC spectrophotometer (Shimadzu, Japan), with 10 nm band-pass spectrometer slits. The xed wavelength difference (Dl) of synchronous scanning uorescence spectroscopy was set at 22 nm. 2.2
Procedure for sample preparation
In a typical DNA assay, the uorescent probes (PHBV and PHIV, 5 nM) and their target DNA were incubated in a 20 mM Tris–HCl buffer for 30 min at room temperature to ensure complete hybridization. Then, 12 mg mL1 of MOFs was added. Aer 10 min incubation, uorescence measurements were performed with a quartz cuvette to quantify the targets.
3. 3.1
Results and discussion The principle of detection
The principle for multiplexed DNA detection with MOF-based MBs is depicted in Fig. 1. In the absence of targets, PHBV and PHIV were adsorbed on MOFs via interactions between DNA nucleotide bases and the conjugated p-electron rich MOFs, which brought the uorophores (FAM of PHBV and ROX of PHIV) close to the MOFs surface. Thus, the uorescence of FAM and ROX was quenched simultaneously by MOFs. However, in the presence of the targets, PHBV and PHIV hybridized with their targets resulting in the formation of ds-DNA far from MOFs and the uorescence of FAM and ROX is retained. In this strategy, the uorescence signals of FAM and ROX can be obtained simultaneously using synchronous scanning uorescence spectrometry, as the wavelength intervals between the maximum excitation wavelength and maximum emission wavelength of FAM and ROX are close between 23 nm and 20 nm, respectively. Thus, the simultaneous detections of T1 and T2 can be realized by measuring uorescence signals of FAM and ROX. 3.2
The uorescence quenching of probes by MOFs
The high quenching efficiency of probes based MOFs is the basis of the sensor. Compared with other MOFs, H2dtoaCu shows effective uorescence quenching ability.17 Therefore, the
Fig. 1
The principle of simultaneous detection T1 and T2.
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
Paper
concentration of MOFs is investigated as shown in Fig. 2. The results show that the uorescence intensities of two probes decreased quickly with the increased concentration of MOFs. As we know, the Cu complex with free coordination sites efficiently quench uorophores in hairpin-shaped oligonucleotide probes.28 In addition, the porous structure of MOFs was formed by more than one Cu complex which facilitated the design of MBs with very high signal to noise performance in DNA analysis. As shown in Fig. 2, the uorescence intensity of FAM decreases with the increase of concentration of MOFs from 3–15 mg mL1, and achieves the minimum at 15 mg mL1. At the same time, the uorescence intensity of ROX decreases with the increase of MOFs from 3–12 mg mL1, and the change of uorescence intensity (DF) was no longer changed when the concentration of MOFs was higher than 12 mg mL1. The maximal quenching efficiencies were about 85.0% for FAM, 91.1% for ROX, respectively. Considering the sensitivity of the assay, 12 mg mL1 of MOFs was selected for further experiments. 3.3
Fig. 3 Changes in the fluorescence spectra of the sensor upon increasing the concentration of T1: 0, 0.6, 1, 3, 5, 7, and 10 nM (from the bottom to the top). Insert: the linear curve of single determination for THBV.
The uorescence recovery of the sensor
We then explored the recovery of uorescence of MOF–MBs, taking an oligonucleotide sequence fragment of wild-type HBV as a model. As shown in Fig. 3, the uorescence intensity increased with the concentration of THBV raised from 0.6–10 nM, indicating that the probe freed from absorption was highly dependent on the concentration of the target DNA. The immersion of nucleotide bases into formed duplex structure protected the DNA from being absorbed. With the relative distance between ds-DNA and MOFs increasing, the photoinduced electron transfer-based quenching was weakened which is consistent with previous reports.16 As a result, the quantitative determination of oligonucleotide with developed MOF–MBs is feasible. 3.4
Analyst
Cross-reaction analysis
Before simultaneous detection of T1 and T2, it is necessary to demonstrate whether there is cross reaction between PHBV and
PHIV, as the cross-reaction is a crucial analytical parameter regarding the assay specicity and thus the reliability of the multiplex detection. As shown in Fig. 4, when T1 alone existed in the sample solution, increased uorescence emission of PHBV was observed. In contrast, when T2 alone existed in the analysis sample, only PHIV uorescence emission intensity increased. When both targets existed in the sample solution, the two distinguishing probe uorescence emissions increased at the same time. The uctuation of uorescence intensity between single detection and simultaneous detection was due to 12 mg mL1 of MOFs being an overdose for single detection. Herein, the MOFs were used as substrates for analyte detection, while in the proposed detection scheme, MOFs mainly served as a signal quencher for the free dyes labeled probes. Additionally, compared with ss-DNA probe, the hairpin-structured uorescent oligonucleotide has good selectivity. 3.5
Fig. 2 Fluorescence quenching of 5 nM probes (PHBV and PHIV) in the presence of MOFs with concentration of 0, 3, 6, 9, 12, 15, and 18 mg mL1. Insert: linear curve of fluorescence quenching for probes.
This journal is © The Royal Society of Chemistry 2014
The simultaneous detection of the targets
Fig. 5 characterizes the simultaneous detection ability of MOFbased MBs. The uorescence emission spectra of the multiplexed probes upon the addition of different concentrations of targets were recorded by synchronous scanning uorescence spectrometry. A gradual increase of uorescence intensity of two probes had been detected, with increasing targets concentrations in the range of 1–100 nM. As shown in the insert of Fig. 5, linear relationships between the uorescence change FT F0 and the concentration of two targets were obtained in the range of 1 nM to 10 nM. For T1, the tted regression equation is DF1 ¼ 58.77C1 33.29 with a correlation coefficient of 0.9920 (R2), and that of T2 is DF2 ¼ 43.19C2 1.529 with a correlation coefficient of 0.9816 (R2). The detection limit (3s) of T1 is estimated to be 0.87 nM and that of T2 is 0.22 nM, respectively. A series of parallel experiments (n ¼ 5) about 5 nM T1 and T2 were used for estimating the precision and the relative standard deviation (RSD) were 5.64% and 1.91%, respectively.
Analyst, 2014, 139, 1721–1725 | 1723
View Article Online
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
Analyst
Paper
Fig. 4 (A) Fluorescence spectra of (a) MBs probes, (b) MOF-MBs probes. (B) Fluorescence spectra of (a) MOF–MBs probes, (b) T1 and MOF–MBs probes. (C) Fluorescence spectra of (a) MOF–MBs probes, (b) T2 and MOF–MBs probes. (D) Fluorescence spectra of (a) MOF–MBs probes, (b) T1, T2 and MOF–MBs probes. The concentration of T1 and T2: 5 nM, the MOF–MBs probes consist of 12 mg mL1 of MOFs and 5 nM MBs for each target.
mismatched targets. As shown in Fig. 6, the uorescence signals for targets (T1 and T2) are approximately two times higher than those for their single-base mismatched targets under the same conditions. The results indicate that the proposed method can perfectly distinguish the complementary sequences from the single-base mismatched sequences. To study the inuence of high concentration ss-DNA on this approach, a certain amount of T1 and T2 in the presence of 10 fold and 100 fold ss-DNA was investigated. In the presence of 10 fold ss-DNA, the uorescence recovery shows less change than that of 100 fold ss-DNA
Fig. 5 Synchronous scanning fluorescence spectra of MOF–MBs with different concentrations of target DNA. Concentration of target DNA: 0, 1, 3, 5, 7, 10, 15, 20, 50 and 100 nM (from the bottom to the top). Insert: the linear curve of determination for T1 (a) and T2 (b).
To authenticate the feasibility of our approach in complex biological matrixes, a certain amount of T1 and T2 in 1% culture medium was investigated. The linear relationships between the uorescence change FT F0 and the concentration of two targets were obtained in the range of 1.6 nM to 10 nM (see Fig. S1 in ESI†). Consequently, this assay indicates the potential for applications in multiplexed DNA detection in complex matrix. 3.6
Selectivity analysis
According to the selectivity analysis procedure, the specicity of this method is investigated by challenging with single-base
1724 | Analyst, 2014, 139, 1721–1725
Fig. 6 Changes in fluorescence intensities of the MOF–MBs sensors (5 nM) toward targets DNA (5 nM) and single-base mismatched DNA (5 nM). Inset: fluorescence spectra of MOF–MBs (black line), MOF–MBs with single base mismatch of T1 and T2 (green line), and MOF–MBs with T1 and T2 (red line).
This journal is © The Royal Society of Chemistry 2014
View Article Online
Paper
(see Fig. S2 in ESI†). However, the results indicate the MOF– MBs show good interference tolerance.
Published on 07 January 2014. Downloaded by University of Illinois at Chicago on 26/10/2014 05:25:38.
4 Conclusions An MOF-based sensor was developed for dual-colour DNA detection with synchronous uorescence analysis. In the analysis of DNA, the MOF–MBs show graphene based sensor-like properties which enhance the signal to noise of individual MBs. MOF's convenient and simple synthesis in large scale overcomes the time-consuming preparation of graphene based sensors. Furthermore, as a sensing platform, MOF–MBs show no cross-reaction in multiplex DNA detection.
Acknowledgements This work was nancially supported by the National Key Scientic Program-Nanoscience and Nanotechnology (2011CB933600) and the National Science Foundation of China (21075093, 21275109 and 21205089).
Notes and references 1 X. Zuo, F. Xia, Y. Xiao and K. W. Plaxco, J. Am. Chem. Soc., 2010, 132, 1816. 2 F. Xia, X. Zuo, R. Yang, Y. Xiao, D. Kang, A. Vall´ ee-B´ elisle, X. Gong, J. D. Yuen, B. B. Y. Hsu, A. J. Heeger and K. W. Plaxco, Proc. Natl. Acad. Sci., 2010, 107, 10837. 3 L. Zhang, J. Zhu, S. Guo, T. Li, J. Li and E. Wang, J. Am. Chem. Soc., 2013, 135, 2403. 4 W. L. Wei and X. G. Qu, Small, 2012, 8, 2138. 5 K. P. Loh, Q. L. Bao, G. Eda and M. Chhowalla, Nat. Chem., 2010, 2, 1015. 6 H. Chen, J. Q. Wang, G. H. Liang, P. Zhang and J. L. Kong, Chem. Commun., 2012, 48, 269. 7 M. Zheng, A. Jagota, E. D. Semke, B. A. Diner, R. S. Mclean, S. R. Lustig, R. E. Richardson and N. G. Tassi, Nat. Mater., 2003, 2, 338. 8 M. Zheng, A. Jagota, M. S. Strano, A. P. Santos, P. Barone, S. G. Chou, B. A. Diner, M. S. Dresselhaus, R. S. McLean, G. B. Onoa, G. G. Samsonidze, E. D. Semke, M. Usrey and D. J. Walls, Science, 2003, 302, 1545.
This journal is © The Royal Society of Chemistry 2014
Analyst
9 S. J. Guo and S. J. Dong, Chem. Soc. Rev., 2011, 40, 2644. 10 J. Lee, O. K. Farha, J. Roberts, K. A. Scheidt, S. T. Nguyen and J. T. Hupp, Chem. Soc. Rev., 2009, 38, 1450. 11 O. K. Farha, A. O. Yazaydin, I. Eryazici, C. D. Malliakas, B. G. Hauser, M. G. Kanatzidis, S. T. Nguyen, R. Q. Snurr and J. T. Hupp, Nat. Chem., 2010, 2, 944. 12 Z. Y. Gu, C. X. Yang, N. Chang and X. P. Yan, Acc. Chem. Res., 2012, 45, 734. 13 L. E. Kreno, K. Leong, O. K. Farha, M. Allendorf, R. P. Van Duyne and J. T. Hupp, Chem. Rev., 2012, 112, 1105. 14 S. Jung, Y. Kim, S. J. Kim, T. H. Kwon, S. Huh and S. Park, Chem. Commun., 2011, 47, 2904. 15 W. L. Liu, S. H. Lo, B. Singco, C. C. Yang, H. Y. Huang and C. H. Lin, J. Mater. Chem. B, 2013, 1, 928. 16 X. Zhu, H. Y. Zheng, X. F. Wei, Z. Y. Lin, L. H. Guo, B. Qiu and G. N. Chen, Chem. Commun., 2013, 49, 1276. 17 X. Wei, L. Zheng, F. Luo, Z. Lin, L. Guo, B. Qiu and G. Chen, J. Mater. Chem. B, 2013, 1, 1812. 18 Z. Lin and G. Chen, Analyst, 2013, 138, 3490. 19 R. M. Kong, X. B. Zhang, Z. Chen, H. M. Meng, Z. L. Song, W. H. Tan, G. L. Shen and R. Q. Yu, Anal. Chem., 2011, 83, 7603. 20 D. S. Xiang, G. H. Zhou, M. Luo, X. H. Ji and Z. K. He, Analyst, 2012, 137, 3787. 21 C. H. Lu, J. Li, J. J. Liu, H. H. Yang, X. Chen and G. N. Chen, Chem. – Eur. J., 2010, 16, 4889. 22 S. J. Zhen, L. Q. Chen, S. J. Xiao, Y. F. Li, P. P. Hu, L. Zhan, L. Peng, E. Q. Song and C. Z. Huang, Anal. Chem., 2010, 82, 8432. 23 F. Li, Y. Huang, Q. Yang, Z. T. Zhong, D. Li, L. H. Wang, S. P. Song and C. H. Fan, Nanoscale, 2010, 2, 1021. 24 W. H. Wu, H. Y. Hu, F. Li, L. H. Wang, J. M. Gao, J. X. Lu and C. H. Fan, Chem. Commun., 2011, 47, 1201. 25 Y. Nagao, T. Kubo, K. Nakasuji, R. Ikeda, T. Kojima and H. Kitagawa, Synth. Met., 2005, 154, 89. 26 M. Fujishima, Y. Nagao, R. Ikeda, S. Kanda and H. Kitagawa, Synth. Met., 2003, 133, 433. 27 H. Kitagawa, Y. Nagao, M. Fujishima, R. Ikeda and S. Kanda, Inorg. Chem. Commun., 2003, 6, 346. 28 J. Brunner and R. Kraemer, J. Am. Chem. Soc., 2004, 126, 13626.
Analyst, 2014, 139, 1721–1725 | 1725
