Developmental and Comparative Immunology 45 (2014) 278–290

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Molecular characterizations of grass carp (Ctenopharyngodon idella) TBK1 gene and its roles in regulating IFN-I pathway Xiaoli Feng, Jianguo Su ⇑, Chunrong Yang, Nana Yan, Youliang Rao, Xiaohui Chen College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling 712100, China

a r t i c l e

i n f o

Article history: Received 23 December 2013 Revised 6 March 2014 Accepted 26 March 2014 Available online 1 April 2014 Keywords: Grass carp (Ctenopharyngodon idella) TBK1 Genomic structure Promoter activity IFN-I pathway Grass carp reovirus

a b s t r a c t TANK-binding kinase 1 (TBK1), a kinase at the crossroads of multiple IFN-inducing signaling pathways, plays essential roles in both antiviral and antibacterial innate immunity in mammals. Here, TBK1 gene (10339 bp) was identified and characterized from grass carp Ctenopharyngodon idella (CiTBK1). The genomic sequence is shorter than other orthologs in vertebrate, and a promoter region is found in intron 1. mRNA expression of CiTBK1 was widespread in fifteen tissues investigated, and was up-regulated post GCRV challenge in vivo and in vitro, as well as after stimulation of viral/bacterial PAMPs in vitro. CiTBK1 mediates IFN-I signal pathway through over-expression experiment. Post GCRV challenge, CiTBK1 overexpression inhibits viral infection by induction of CiIFN-I and CiMx1 mainly via CiIRF7. In CiTBK1 overexpression cells, mRNA expressions of CiIRF3, CiIRF7 and CiIFN-I were inhibited, whereas CiMx1 was facilitated after poly I:C stimulation, comparing to those in control group. The result indicated that CiMx1 expression mediated by CiTBK1 is in IFN-I independent way after poly I:C stimulation. However, overexpression of CiTBK1 diminishes LPS-induced expressions of CiIRF3 and CiIRF7 but promotes the induction of CiIFN-I and CiMx1 in comparison with the control, which suggests that CiTBK1-triggered IFN-I activation is in IRF3/IRF7-independent manner after LPS stimulation. Notably, over-expression of CiTBK1 negatively regulated PGN-induced IRF3, IRF7, IFN-I and Mx1 immune response. Taken together, CiTBK1 participates in broad antiviral and antibacterial immune responses in different manners, and keeps regulatory balance that prevents harmful effects from excessive activation. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Innate immunity is the first line of host defense against invading pathogens, serving as the only defense weapon in invertebrates and a fundamental defense mechanism in vertebrates (Magnadottir, 2006). The recognition of non-self and danger signals is performed by a set of germ-line encoded pattern recognition receptors (PRRs) in innate immunity system. Currently, four major classes of PRRs have been identified, including toll-like receptors (TLRs), retinoic acid inducible gene I-like receptors (RLRs), nucleotide oligomerization domain-like receptors (NLRs) and C-type lectin receptors (Kumar et al., 2011). TLR pathways are mainly divided into two pathways: the myeloid differentiation factor 88 (MyD88)dependent and TIR-containing adapter inducing IFN-b (TRIF)dependent pathways. And RLRs activate the interferon-b promoter stimulator 1 (IPS-1)-mediated signaling cascades. Both TRIF and IPS-1 interact with TANK-binding kinase 1 (TBK1), one noncanonical member of the IjB kinase (IKK) family, to phosphorylate interferon regulatory factor 3/7 (IRF3/7) (Fitzgerald et al., 2003; ⇑ Corresponding author. Tel.: +86 29 87092139; fax: +86 29 87092164. E-mail address: [email protected] (J. Su). http://dx.doi.org/10.1016/j.dci.2014.03.018 0145-305X/Ó 2014 Elsevier Ltd. All rights reserved.

Kawai et al., 2005; Sato et al., 2003). Then phosphorylated IRF3 and IRF7 dimerize and translocate into the nucleus to regulate the expression of type I interferon (IFN-I) genes and IFN-stimulated genes (ISGs), such as ISG15 and myxovirus-resistance (Mx) (Zou et al., 2010). Mx proteins are crucial effectors of the innate antiviral response against a wide range of viruses (Peng et al., 2012). TBK1, also known as NF-jB-activating kinase (NAK) or TNFreceptor-associated factor 2 (TRAF2)-interacting kinase (T2K), is previously described as a kinase that mediated TANK’s ability to active nuclear factor-jB (NF-jB) (Pomerantz and Baltimore, 1999). It is now well established that TBK1 is responsible for the phosphorylation of IRF3 in response to stimulation of several receptors that induce the production of IFN-I, including TLR3, TLR4, RIG-I, melanoma differentiation-associated gene 5 (MDA5), as well as cytosolic DNA sensors that signal through mediator of IRF3 activation (MITA) (Helgason et al., 2013; Lam et al., 2014; Shu et al., 2013; Tanaka and Chen, 2012). TBK1, as a modulator of IFN-I levels, plays a central role in innate immunity. TBK1deficient cells fail to produce IFN-I in response to viral infection (Hemmi et al., 2004; Perry et al., 2004). In addition, TBK1 is essential for bridging innate and adaptive immunity in response to DNA vaccines (Ishii et al., 2008), and also plays an important role

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

in mediating autophagy in response to intracellular bacterial pathogens (Weidberg and Elazar, 2011). To date, TBK1 homologs have been identified in several fish species, such as zebrafish (Danio rerio) (Sullivan et al., 2007), common carp (Cyprinus carpio) (Feng et al., 2011), crucian carp (Carassius auratus) (Sun et al., 2011), Atlantic cod (Gadus morhua) (Chi et al., 2011), Atlantic salmon (Salmo salar, GenBank accession number NM001256722), tilapia (Oreochromis niloticus, GenBank accession number XM003458438), fugu (Takifugu rubripes, GenBank accession number XM003977165, predicted) and medaka (Oryzias latipes, GenBank accession number XM004084023, predicted). In Atlantic cod, TBK1 can be induced by synthetic dsRNA analog polyinosinic– polycytidylic acid sodium salt (poly I:C) stimulation in vivo (Chi et al., 2011). Similarly, common carp TBK1 is involved in antiviral response against spring viraemia of carp virus (SVCV, a negative single-stranded RNA virus) (Feng et al., 2011). Over-expression of crucian carp TBK1 results in a robust activation of IFN promoter (Sun et al., 2011). TBK1-mediated signaling pathway is still poorly understood in teleosts, compared to the investigation in mammals. Grass carp (Ctenopharyngodon idella) is one of the most economically important freshwater fish species in China. However, this species is susceptible to grass carp reovirus (GCRV), a double-stranded RNA (dsRNA) virus. Knowledge of immune defense mechanisms could help to prevent outbreaks of infectious diseases in fish farms. In the present study, the full-length cDNA and genomic DNA sequences of grass carp TBK1 (CiTBK1) were identified and the promoter activity was verified. The mRNA expression profiles of CiTBK1 were investigated in vivo and in vitro. To further understand the immune mechanism of CiTBK1, over-expression vector (pTBK1) was constructed and transfected into C. idella kidney (CIK) cells. The mRNA expression profiles of CiTBK1, CiIRF3, CiIRF7, CiIFN-I and CiMx1 were examined in CiTBK1 over-expressed CIK cells post GCRV challenge or viral/bacterial pathogen associated molecular patterns (PAMPs) stimulation. Besides, antiviral activity assay and virus yield were also conducted in CiTBK1 over-expression cells. The results will facilitate functional studies on TBK1 gene in teleosts and serve the immunological control of viral diseases. 2. Materials and methods 2.1. Fish, virus challenge and sample collection Grass carp maintenance, virus challenge and sample collection were carried out as previous report (Yang et al., 2013b).

279

2.3. Cloning the full-length cDNA of CiTBK1 A cDNA library was constructed with CIK cells post GCRV infection, using the Creator SMART cDNA Library Construction Kit (Clontech, USA). Random sequencing of the library using T7 primer yielded 10,228 successful sequencing reactions. BLAST analysis of all the expressed sequence tags (ESTs) revealed that one EST contig of 1710 bp was homologous to the TBK1 gene in C. auratus (GenBank accession number JF970228), and it was selected for further cloning of CiTBK1 gene. To obtain the 50 and 30 unknown sequences, rapid amplification of cDNA ends (RACE) was performed using the 50 RACE system (Invitrogen, USA) and 30 RACE method (Clontech). To get the 30 ends of CiTBK1, primer pairs TF829/UPM and TF830/NUP (Table 1) were employed for the primary PCR and the nested PCR, respectively. Similarly, the 50 end of CiTBK1 gene was obtained by nested PCR, using primer pairs TR856/AAP and TR857/AUAP (Table 1). The full-length cDNA sequence was confirmed by sequencing the PCR product amplified by primers TF891a and TR892a (Table 1) within the 50 and 30 untranslated regions (UTRs), respectively.

2.4. Detecting the introns and the 50 - flanking sequence of CiTBK1 genomic sequence Based on the CiTBK1 cDNA sequence, some primers were designed to amplify the genomic sequence gradually. Genomic DNA was extracted from grass carp spleen with the classical phenol– chlorophenol method. Six pairs of primers worked well, and six overlapping fragments which covered the full-length cDNA sequence were amplified and sequenced (Table 2). The introns were annotated by comparing the obtained sequence with the cDNA sequence. The 50 -flanking sequence of CiTBK1 gene was PCR-amplified from genomic DNA according to the protocol of Genome Walker™ Universal kit (Clontech). Briefly, four GenomeWalker libraries were constructed according to the manufacturer’s instruction. Two adjacent reverse primers TR915 and TR916 were designed at 50 -UTR region of CiTBK1 (Table 2), and used for two step-extending of 50 -flanking sequence in combination with the forward adaptor primers AP1 and AP2 for each library. The resulting PCR products were cloned into pMD18-T easy vector (TaKaRa, Japan), sequenced and overlapped with the above sequence.

2.5. Sequence analysis 2.2. Cells, treatment and sample preparation CIK cells, provided by China Center for Type Culture Collection, were cultured in medium DMEM (Sigma, USA) supplemented with 10% inactivated fetal calf serum, 100 U/ml of penicillin and 100 U/ ml of streptomycin sulfate at 28 °C in 6-well culture plates. All the following infections or stimulation were performed in four parallel wells. For viral infection, CIK cells were infected with GCRV at a multiplicity of infection (MOI) of 1. The control group was treated with phosphate buffer solution (PBS). For the time-dependent expression profiles, cells were gathered at 2, 8, 24, 48, 72 h post-infection by centrifuging at 1000 rpm for 8 min, and then RNA was isolated and transcribed. For PAMPs stimulation, cells incubated in 12-well plates were stimulated with 5 lg/ml (terminal concentration) of poly I:C (Sigma), 10 lg/ml (terminal concentration) of lipopolysaccharides (LPS, Sigma) or peptidoglycan (PGN, Sigma), respectively. The control groups were treated with the equal volume of PBS. Cells were collected at different time points post-stimulation.

The searches for nucleotide and protein sequence similarities were conducted with BLAST program (http://www.ncbi.nlm.nih. gov/blast). The promoter region was predicted by WWW Promoter Scan software (http://www-bimas.cit.nih.gov/molbio/proscan/). The CpG island was predicted by online software (http://www. urogene.org/methprimer/). The putative binding sites for transcription factors were predicted by TFSEARCH program (http:// www.cbrc.jp/research/db/TFSEARCH.html). Simple Sequence Repeat (SSR) was searched by SSRHunter Tool (http://en.bio-soft. net/dna/SSRHunter.html). The deduced amino acid sequence was analyzed with the Expert Protein Analysis System (http:// www.expasy.org/) and the Sequence Manipulation Suite programs (http://www.bioinformatics.org/sms/). The protein domain was predicted by Simple Modular Architecture Research Tool (SMART) (http://smart.emblheidelberg.de/) and putative Conserved Domain database (http://www.ncbi.nlm.nih.gov/Structure/cdd/docs/cdd_ search.html). Besides, genomic DNA sequences of several other TBK1 genes were acquired from NCBI (http://www.ncbi.nlm.nih. gov/).

280

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

Table 1 Primers used in gene cloning and expression analyses. Primer name

Sequence (50 ? 30 )

Amplicon length (bp) and application

CiTBK1 TF829(forward) TF830(forward) TR856(reverse) TR857(reverse) TF891a(forward) TR892a(reverse)

GACGCAGCAAGTGGGAACG TCCCTCAGAAGATGATGCCC AGCACCGCTCGCTCGTACATG CCCAGGCTTGATGTCTCGATG ACTGggtaccACGGAAGAGACTTTCGTGCT ACTGgggcccCCGCGTCTGATGTGTGTATT

30 RACE

TF927(forward) TR928(reverse)

CCAGGAGAAATGTTGGGGC TGTAGATGTGGTGGAGTGTCGC

2302 Sequence confirming and over-expression vector construction 113 qRT-PCR

18S rRNA 18F99(forward) 18R100(reverse)

ATTTCCGACACGGAGAGG CATGGGTTTAGGATACGCTC

90 qRT-PCR

EF1a EF125(forward) ER126(reverse)

CGCCAGTGTTGCCTTCGT CGCTCAATCTTCCATCCCTT

99 qRT-PCR

CiIRF3 IF960(forward) IR961(reverse)

ACTTCAGCAGTTTAGCATTCCC GCAGCATCGTTCTTGTTGTCA

207 qRT-PCR

CiIRF7 IF967a(forward) IR968a(reverse)

CGCCTGTGTTCGTCACTCGT GGTGGTTGGAAAGCGTATTGG

84 qRT-PCR

CiIFN-I IF590(forward) IR591(reverse)

AAGCAACGAGTCTTTGAGCCT GCGTCCTGGAAATGACCT

79 qRT-PCR

CiMx1 MF426(forward) MR427(reverse)

CTGGGGAGGAAGTAAAGTGTTCT CAGCATGGATTCTGCCTGG

392 qRT-PCR

VP4 VF146(forward) VR147(reverse)

CGAAAACCTACCAGTGGATAATG CCAGCTAATACGCCAACGAC

135 qRT-PCR 30 RACE

NUP

Long: CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT Short: CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT

50 RACE adaptor primer AAP AUAP

GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG GGCCACGCGTCGACTAGTAC

50 RACE

30 -RACE universal adaptor primers UPM

50 RACE

Note: The nucleotides in lowercase mark the site of restriction enzyme. ‘‘ACTG’’ in the 50 terminal represents protective base.

2.6. Exploring the promoter activity

2.7. Quantification of gene expression

To analyze the core promoter region in the DNA fragment (-1194/1195) that containing 50 -flanking sequence, 50 -UTR and first intron, three vectors were constructed following the previous method (Su et al., 2009), including pTBK1-EGFP-I (-1194/1195, the full-length of DNA fragment before the initiator codon), pTBK1-EGFP-II (1194/2, the 50 -flanking sequence) and pTBK1EGFP-III (473/1087, the predicted promoter region) (Fig. 2A). The primer sequences were listed in Table 2. The PCR products of different constructs were digested with their respective restriction enzymes (KpnI and BamHI for pTBK1-EGFP-I, XhoI and BamHI for pTBK1-EGFP-II and pTBK1-EGFP-III) and then ligated to the pEGFP vector, a promoterless report vector which was obtained from pCMV-EGFP (Clontech) (Wang et al., 2012). All plasmid constructs were verified by sequencing. CIK cells (2  105 cells/ml) were transfected in 24-well plates with 0.5 lg of purified pTBK1-EGFP-I, pTBK1-EGFP-II, pTBK1EGFP-III and pEGFP (as a control) using FuGENEÒ HD Transfection Reagent (Roche, Switzerland), respectively. After 48 h, the transfected cells were stimulated with LPS. Finally, the photos were taken under fluorescence microscope (Nikon, Japan) at 72 h post transfection.

Quantitative real-time RT-PCR (qRT-PCR) was established in a CFX96™ Real-Time PCR Detection System (Bio-Rad, USA) to quantify mRNA expressions of CiTBK1, CiIRF3 (GenBank accession number JX999055), CiIRF7 (GenBank accession number GQ141741), CiIFN-I (GenBank accession number DQ357216), CiMx1 (GenBank accession number HQ245104) and VP4 (segment 6 of GCRV, outer capsid protein, GenBank accession number GQ469997) genes. 18S rRNA and EF1a genes were employed as internal control genes for cDNA normalization in vivo and in vitro, respectively (Su et al., 2011). The primers used in qRT-PCR were listed in Table 1. PCR system and protocols were same as previous report (Yang et al., 2013b). The expression profiles of all the target genes were calculated by the method of 2DDCT. The results were subjected to one-way analysis of variance (one-way ANOVA), followed by an unpaired, two-tailed t-test. p < 0.05 was considered statistically significant. 2.8. mRNA expression patterns of CiTBK1 gene in vivo and in vitro qRT-PCR was performed to investigate mRNA expression patterns of CiTBK1 gene in vivo. For tissue distribution analysis of

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

281

Table 2 Primers used for genomic sequence study and the construction of promoter vectors. Primer name

Sequence (50 ? 30 )

Amplicon length (bp) and application

TR915(reverse) TR916(reverse) TF981(forward) TR993(reverse) TF936(forward) TR937(reverse) TF952(forward) TR953(reverse)

AGCGGTTTATTATCGTGCTGTGACATG CAGTCAAAACATTGCATTGTTCCGTCT ACTGggtaccAAATCCTCGTTGATTCAGAAGC ACTGggatccGATGACTCTATAGATTCACCTG ACTGctcgagAAATCCTCGTTGATTCAGAAGC ACTGggatccCATCACATGAGACGCCGAG ACTGctcgagCCGCAGATCTGTGACGTC ACTGggatccTCATGTTTGGTCATGTACCAG

Genome walking 2409 pTBK1-EGFP-I 1216 pTBK1-EGFP-II 634 pTBK1-EGFP-III

TF893(forward) TR895(reverse) TF900(forward) TR914(reverse) TF901(forward) TR902(reverse) TF913(forward) TR810(reverse) TF903(forward) TR904(reverse) TF830 (forward) TR892(reverse)

CGGAAGAGACTTTCGTGCT CAGCATAGAGATCACCGGTT ACATCGTCAAGCTCTTCGC ACGGCTTCTCTGTGATGATC GAGCTCAGAGATGCCGAT AGATATCCCACGTCACCTG CGCAGGTGACGTGGGATA TGTCCTTCTTGAACTGCTGGTA TTCAAGAAGGACAAGGCC GCTCGGACTGAGATACGC TCCCTCAGAAGATGATGCCC CCGCGTCTGATGTGTGTATT

1609 50 UTR, exon 1, 2, 3 and intron 1, 2 1313 exon 3, 4, 5, 6, 7 and intron 3, 4, 5, 6 1501 exon 7,8,9,10, 11 and intron 7,8,9,10 1315 exon 11, 12, 13, 14, 15 and intron 11, 12, 13, 14 1441 exon 15, 16, 17, 18, 19 and intron 15, 16, 17, 18 1394 exon 19, 20, 21, intron 19, 20 and 30 UTR

Genome walking adaptor primer AP1 AP2

TTGACCCAAAATAAGCGGAGTCTAGC TGGATCAGTACAGCCACAAAGACGAA

Genome walking

Note: The nucleotides in lowercase mark the site of restriction enzyme. ‘‘ACTG’’ in the 50 terminal represents protective bases.

CiTBK1 mRNA, tissues including blood, brain, eye, foregut, midgut, hindgut, gas bladder, gill, head kidney, trunk kidney, heart, hepatopancreas, muscle, skin and spleen were obtained from five grass carp. To determine the effects of viral infection on CiTBK1 mRNA expression in the innate immune system, two representative immune tissues, spleen and head kidney, were employed. Fish (five for each time point) were sacrificed at 0, 6, 12, 24, 48 and 72 h post GCRV or PBS (as control) injection and tissues were collected and used for qRT-PCR. To explore the influences on CiTBK1 in vitro post GCRV challenge or viral/bacterial PAMPs stimulation, CIK cell line and qRT-PCR were employed. Four independent cell samples from each group were collected at different time points and mRNA levels of CiTBK1 were examined. 2.9. Plasmid construction and transfection of CIK cells for gene overexpression The open reading frame (ORF) region of CiTBK1 was amplified using LA TaqTM DNA polymerase (TaKaRa) by specific upstream primer TF891a (containing a KpnI site) and downstream primer TR892a (containing an ApaI site) (listed in Table 1). The PCR product was purified, digested with ApaI and KpnI enzymes (Fermentas, Canada), meanwhile, the purified plasmid of pCMV-SV40-CMVEGFP (abbreviation, pCMV) was also digested with the same enzymes (Yang et al., 2013b). Then the target fragments were purified and ligated with T4 DNA ligase. Finally, the recombinant plasmid was obtained and verified by sequencing. The expected plasmid was named as pCMV-TBK1-SV40-CMV-EGFP (abbreviation, pTBK1). Constructs (pCMV as control, pTBK1) were introduced into CIK cells by FuGENEÒ HD Transfection Reagent according to the manufacturer’s instructions. The concrete program was employed as previous study (Yang et al., 2013b). All the following experiments relied on stably transfected CIK cells. 2.10. GCRV and viral/bacterial PAMPs challenge, gene expression analyses and virus quantification in transfected cells To check the effects of viral and viral/bacterial PAMPs challenge on CiTBK1 signaling pathway, the stably transfected cell lines

(transfected with pTBK1 or pCMV) were seeded into 24-well culture plates, challenged with GCRV at an MOI of 1, or stimulated with 5 lg/ml of poly I:C, 10 lg/ml of LPS or PGN, respectively. Samples were collected at 0, 6, 12, 24, 48 and 72 h post challenge. Total RNA was extracted and cDNA was prepared. mRNA expressions of CiTBK1, CiIRF3, CiIRF7, CiIFN-I and CiMx1 were investigated by qRT-PCR. The GCRV VP4 gene transcripts were examined by qRTPCR to quantify the virus yields. 2.11. Antiviral activity assay For further confirming the antiviral function in pTBK1transfected cells, antiviral activity assays were conducted in the transfected cell by 96-well plate staining method. Briefly, the transfected cells were seeded into 96-well plates at a concentration of 4  105 cells/ml and incubated for 24 h at 28 °C, then infected with 2-fold-diluted GCRV at the indicated titers in duplicate. After 60 h post-infection, cells were fixed with 10% paraformaldehyde for 10 min and stained with 0.05% (wt/vol) crystal violet (Sigma) for 30 min. Plates were washed with water and finally air dried, then photographed under a light box (Bio-Rad, USA). 3. Results 3.1. Sequences analyses of CiTBK1 The CiTBK1 cDNA (GenBank accession number JN704345) is 2840 bp in length with an ORF of 2184 bp encoding 727 amino acids (aa) (Protein ID., AFC88289), a 59 bp 50 UTR and a 597 bp 30 UTR with two RNA instability motifs (ATTTA), two canonical polyadenylation signal sequences (ATTAAA) and a poly(A) tail (Fig. S1). The putative protein had an estimated molecular weight (MW) of 83.766 kDa and a predicted isoelectric point (PI) of 6.45. Analysis of conserved domains revealed the presence of an S-TKc domain (Serine/Threonine protein kinases, catalytic domain), an ubiquitin domain and an ATP-binding site (LGQGATANV). BLASTP analysis showed that CiTBK1 had highest similarity to C. auratus TBK1 (99%) (Protein ID., AEN04475), followed by C. carpio TBK1 (96%) (Protein ID., ADZ55455).

282

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

The complete genomic sequence of CiTBK1 is 10339 bp in length, containing an 1194 bp 50 -flanking region, 21 exons and 20 introns. All exon–intron boundaries fitted the GT/AG rule (Fig. S1). Comparison of TBK1 genomic structures from C. idella, D. rerio, O. niloticus, O. latipes, Xenopus (Silurana) tropicalis, Gallus gallus, Mus musculus and Homo sapiens demonstrated that the genomic structure of CiTBK1 was same with D. rerio, G. gallus, M. musculus and H. sapiens that composed of 21 exons and 20 introns (Fig. 1). However, genome of XtTBK1 contained 22 exons, while OnTBK1 and OlTBK1 contained 20 exons. The lengths of most CDS (coding sequence) were conserved. Notably, the size of CiTBK1 genomic sequence was smaller than those of other species and the differences in length mainly resulted from various length in introns. 3.2. Prediction and verification of promoter Since transcription is a key process which is triggered by the promoter region, the 50 -flanking region of CiTBK1 was obtained. In the 50 -flanking region of CiTBK1, three gamma IFN activated sequence (GAS) site (TTNCNNNAA) and ten GAAA/TTTC motifs were identified (Fig. S1) (Li et al., 2012b). Also, transcription factor binding sites for HSF, CdxA, SRY, AP-1, C-Ets-, Sox-5, CRE-BP and MZF1 were predicted. Interestingly, the predicted promoter region locates in the intron 1 (Fig. S1). It was also speculated that there were some transcription factor binding sites. And a putative IFN-stimulated response element (ISRE) motif, which matched the core sequence of (G/A/T)GAAANNGAAA(G/C)(A/T/C) (Shi et al., 2013), was also found in this region (Fig. S1). Moreover, five CpG islands were found in the DNA fragment that before the initiator codon. To analyze the core promoter region, three vectors were constructed and transfected into CIK cells. The results showed that EGFP reporter gene expressed in pTBK1-EGFP-I and pTBK1-EGFPIII transfected cells (Fig. 2), but not in pTBK1-EGFP-II transfected cells (data not shown). The fluorescence in pTBK1-EGFP-I transfected cells seemed stronger than that in pTBK1-EGFP-III transfected cells and more EGFP positive cells were observed in pTBK1-EGFPI transfected cells (Fig. 2C). Furthermore, stronger fluorescence and higher percentage of EGFP positive cells were observed in cells stimulated by LPS than those in cell without stimulation (Fig. 2D).

3.3. Tissue distribution of CiTBK1 mRNA expression and the temporal expression of CiTBK1 mRNA in spleen and head kidney after GCRV challenge As shown in Fig. 3, CiTBK1 was widely expressed in all the examined tissues. CiTBK1 mRNA expressed predominantly in trunk kidney, foregut and spleen, and showed the least amount of expression in gas bladder. The mRNA expression profiles of CiTBK1 gene were found to be different in the two major immune organs post GCRV challenge (Fig. 4). In spleen, the expression level of CiTBK1 mRNA was reached a peak at 6 h (6.25 folds, p < 0.05), then decreased at 12 h and kept this level in the following tested period. In head kidney, mRNA expression of CiTBK1 was rapidly decreased at 6 h (0.30 folds, p < 0.05), then significantly enhanced and reached the peak at 12 h (6.76 folds, p < 0.05), followed by a drastic decline at 24 and 48 h, finally inhibited at 72 h. 3.4. Time dependent expression of CiTBK1 mRNA post GCRV infection and post poly I:C, LPS, PGN stimulation in vitro After GCRV infection, no significant change in mRNA level of CiTBK1 was noticed in the infected CIK cells until 72 h (Fig. 5A). For poly I:C stimulation, transcript of CiTBK1 was slightly elevated at 6 h and recovered to the control level at 12, 24, 48 h, then upregulated at 72 h (2.03 folds, p < 0.05) (Fig. 5B). As for responses to bacterial PAMPs, mRNA level of CiTBK1 was significantly up-regulated at 2 h post LPS stimulation and at 8 h for PGN stimulation respectively, and this trend continued in the following tested period (Fig. 5C and D). 3.5. The temporal expression profiles of genes in transfected cells post virus infection and PAMPs stimulation To further explore the CiTBK1-mediated immune response, mRNA expressions of CiTBK1, CiIRF3, CiIRF7, CiIFN-I and CiMx1 genes were quantified in cells transfected with pTBK1 and pCMV (control) (Figs. 6–9). mRNA expressions of CiTBK1 and CiIFN-I were

Fig. 1. Genomic structure of TBK1 genes. The lengths of the elements are shown in base pairs (bp), and the numbers above and below each schematic represent the lengths of exons and introns of corresponding gene, respectively. The accession numbers of TBK1 genes are as follows: C. idella JN70434, D. rerio NM001044748, O. niloticus XM003458438, O. latipes XM004069266, X. tropicalis NM001142180, G. gallus NM001199558, M. musculus NM019786, H. sapiens NM013254, respectively.

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

283

Fig. 2. Promoter activity investigation. (A) Schematic representation of the full-length and truncated DNA fragment from 1194 to 1195 bp. To analyze the core promoter region, a series of plasmids were constructed, including pTBK1-EGFP-I (1194/1195), pTBK1-EGFP-II (1194/2) and pTBK1-EGFP-III (473/1087). (B–D) Observation results for verifying the promoter activity in the DNA fragment (-1194/1195) under microscope. (B) CIK cells transfected with pEGFP; (C) CIK cells transfected with pTBK1-EGFP-I and pTBK1-EGFP-III. (D) CIK cells transfected with pTBK1-EGFP-I and pTBK1-EGFP-III and challenged with LPS. F, viewed under fluorescent microscope; L, viewed under light microscope; M, merging the photos taken under fluorescent microscope and light microscope.

Fig. 3. Tissue distribution of CiTBK1 transcripts. 18S rRNA was employed as an internal control. The fifteen examined tissues are indicated in abbreviation. BD: blood; BR: brain; EY: eye; FG: foregut; GB: gas bladder; GL: gill; HG: hindgut; HK: head kidney; HP: hepatopancreas; HT: heart; MG: midgut; MS: muscle; SK: skin; SP: spleen; TK: trunk kidney. Setting mRNA expression level in gas bladder as 1-fold, the mRNA expression levels of CiTBK1 in other tissues are relative to that in gas bladder. Error bars indicate standard error (SE) (n = 5). Detailed values are listed at the bottom of the figure.

increased (0 h) in experimental group compared to the control. Transcriptions of CiIRF7 and CiMx1 were weakly increased (0 h). However, mRNA expression of CiIRF3 was found to be inhibited (0 h). After GCRV infection, the expressions of all examined genes were induced in both transfected cells (Fig. 6). However, mRNA levels of the examined genes in pTBK1 transfected cells showed higher induction than those in pCMV transfected cells, except CiIRF3 gene. Post poly I:C stimulation, mRNA expression profiles of the examined genes were similar between experiment group and control group (Fig. 7). However, the induced extents of CiTBK1 and CiMx1 were higher in experiment group than those in control group, while CiIRF3, CiIRF7 and CiIFN-I were decreased in pTBK1transfected cells in comparison with the control.

After LPS stimulation (Fig. 8), CiTBK1, CiIFN-I and CiMx1 showed a much stronger induction in pTBK1-transfected cells than those in control group. However, transcription levels of CiIRF3 and CiIRF7 were lower in pTBK1-transfected cells than those in control group. Post PGN stimulation (Fig. 9), CiTBK1 was significantly induced in pTBK1-transfected cells. However, mRNA expression levels of CiIRF3, CiIRF7, CiIFN-I and CiMx1 genes in pTBK1 cells were all inhibited compared to the control. 3.6. Antiviral activity Cytopathic effect (CPE) assay showed that apoptosis of CiTBK1 over-expression cells was delayed after GCRV infection, compared with the cells transfected with pCMV (Fig. 10A). Consistently, the

284

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

expression of VP4 mRNA in cells transfected with pTBK1 was significantly inhibited compared with that in cells transfected with pCMV (Fig. 10B). These results indicated that CiTBK1 can inhibit GCRV replication. 4. Discussion

Fig. 4. mRNA expression profiles of CiTBK1 in spleen (A) and head kidney (B) at different time points after GCRV injection. The controls were injected with PBS. 18S rRNA was employed as an internal control. Asterisks (⁄) mark the significant difference between experimental and control group (p < 0.05). Error bars indicate SE (n = 5).

TBK1 has been extensively studied in mammals because of its important role as a molecular bridge, linking the TLRs (TLR3 and TLR4) and RLRs signals to the activation of transcriptional factors IRF3 and IRF7 for IFN-I production (Helgason et al., 2013). However, little is known about the immune function of TBK1 in teleosts. In the present study, a TBK1 gene was identified and characterized from grass carp. The protein kinase domain and the ubiquitin domain are conserved in CiTBK1 gene (Fig. S1). The kinase domain of TBK1 is essential for its mediated signaling pathway (Deng et al., 2008). It has been reported that TBK1s, an alternative splicing isoform of TBK1 that lacks the kinase domain, inhibits IRF3 nuclear translocation and leads to a shutdown of Sendai virus-triggered IFN-b production (Deng et al., 2008). The ubiquitin domain is a regulatory component of the TBK1 kinase involved in the control of the kinase activation, substrate presentation and downstream signaling pathways (Solis et al., 2007). The ubiquitin domain in TBK1 can interact with IRF3 transcription factor, deletion or mutation of the ubiquitin domain in TBK1 severely impairs kinase activation and substrate phosphorylation in cells (Solis et al., 2007). Since introns can be regarded as an important tool to study molecular evolution and some introns of certain genes could regulate the gene expression (Irimia and Roy, 2008), the genomic structure of CiTBK1 was determined in the present study. Based on the comparison, the genomic structure of TBK1 seems to be well conserved from fish to human (Fig. 1). Interestingly, the sizes of the introns in CiTBK1 are much shorter than those in other species and the average length of these introns is not long (313 bp), which

Fig. 5. CiTBK1 expression profiles in CIK cell culture post GCRV (A) challenge, poly I:C (B), LPS (C) and PGN (D) stimulations, respectively. EF1a was employed as an internal reference. Asterisks (⁄) mark the significant difference between experimental and control groups (p < 0.05). Error bars indicate SE (n = 4).

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

285

Fig. 6. The mRNA expressions of CiTBK1 (A), CiIRF3 (B), CiIRF7 (C), CiIFN-I (D) and CiMx1 (E) post GCRV challenge in pCMV (control) and pTBK1 stable transgenic cells. The mRNA expressions were measured at 0, 6, 12, 24, 48, 72 h post challenge. EF1a was used as an internal control to normalize the cDNA template. Asterisks (⁄) mark the significant difference between experimental and control groups (p < 0.05). Error bars indicate SE (n = 4).

may be beneficial to strong transcription in response to stress (Castillo-Davis et al., 2002). Moreover, CiTBK1 is intron rich that holds 20 introns. Genes with rapidly changing expression levels in response to stress contain significantly lower intron densities (Jeffares et al., 2008). It is possible because that TBK1 acts as a mediator in multiple signaling pathways, and should keep balance in the regulations (strong transcription and proper response speed). In addition, intron number and boundary strength are strongly correlated negatively (Irimia et al., 2007). Here, CiTBK1 has relatively large intron numbers and weak 50 splice sites (GTAAG), which suggest the possibility of frequent alternative splicing (Irimia et al., 2007). So far, alternative splicing has been described for various adaptors and transcription factors involved in antiviral response, such as IRF family (Karpova et al., 2001; Mancl et al., 2005). In CiTBK1 genomic sequence, GAS and GAAA/TTTC motifs locate in the 50 flank region. Interestingly, the predicted promoter region lies in the intron 1, where the predicted ISRE motif appears. The

three motifs are the characteristics of genes responsive to both IFN-I and IFN-II (Li et al., 2012b; Yang et al., 2013a). Construct pTBK1-EGFP-III exhibited the promoter activity, while the 50 -flanking fragment of CiTBK1 failed to induce the expression of EGFP gene (Fig. 2C), which indicated the presence of promoter region between 473 and 1087 bp is necessary for CiTBK1 promoter activity. For this result, possible reason may be that dual promoters exist for CiTBK1, one promoter upstream of exon 1 and a second, stronger promoter within intron 1, similar to that of human p53 oncogene (Reisman et al., 1988). In this study, the 50 -flanking fragment of CiTBK1 failed to induce the expression of EGFP gene. It is possible because that the promoter existed in this region requires the interaction with some enhancer elements. Indeed, the promoter activity in pTBK1-EGFP-I transfected cells seemed more obvious compared with that in pTBK1-EGFP-III transfected cells (Fig. 2C), suggesting the presence of some enhancer elements between 1194 and 472 bp or 1087 and 1195 bp. Furthermore, the EGFP expression promoted by constructs pTBK1-EGFP-I and pTBK1-EGFP-III could

286

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

Fig. 7. The mRNA expressions of CiTBK1 (A), CiIRF3 (B), CiIRF7 (C), CiIFN-I (D) and CiMx1 (E) post poly I:C stimulation in pCMV (control) and pTBK1 stable transgenic cells. The concentration of poly I:C was 5 lg/ml. Other captions were the same as Fig. 6.

be boosted by LPS stimulation, which suggested that CiTBK1 is involved in LPS-triggered immune response, and the following finding that CiTBK1 expression was up-regulated by LPS (Fig. 5C) is consistent with this result. CiTBK1 gene expressed in widespread tissues (Fig. 3), indicating it plays roles in multiple tissues. Ubiquitous expression of TBK1 has also been reported in other teleosts (Chi et al., 2011; Feng et al., 2011). However, different expression patterns are observed in different species. TBK1 is found to be predominantly expressed in the spleen of G. morhua (Chi et al., 2011) and in the liver of C. auratus (Feng et al., 2011). In this study, CiTBK1 was highly expressed in trunk kidney, followed by foregut, spleen and skin. The discrepancies among species in expression patterns might be a result of species variation and differences in developmental stage. Trunk kidney is an important immune organ in grass carp, and plays crucial roles in triggering anti-viral and anti-bacterial immune responses both in vivo and in vitro (Chen et al., 2013). Spleen is a crucial lymphoid organ of teleosts (Rauta et al., 2012). Foregut and skin are important immune barriers (Yang et al., 2013b). The high expressions in immune relevant tissues implied that TBK1 plays important roles in immune system of grass carp.

Post GCRV challenge, the temporal expression of CiTBK1 was significantly induced at early stage in vivo (Fig. 4), while only a tiny increase was detected at the relatively late stage in vitro (Fig. 5A). These results suggested that CiTBK1 gene participates in the GCRVrelated immune responses, and it seemed that CiTBK1 in vivo is more sensitive to GCRV than that in vitro. Similar to virus invasion, CiTBK1 also induces immune effect in response to dsRNA analog in vitro (Fig. 5B), which is different from that of GmTBK1 (Chi et al., 2011). LPS and PGN, as the major cell wall components of gram-negative and gram-positive bacteria respectively, are capable of stimulating the innate immune system through specific TLRs. In mammals, TBK1 mediates an early cellular response to bacterial infection (Radtke et al., 2007) and it can be activated by LPS treatment in primary human macrophages (Solis et al., 2007). In this study, CiTBK1 mRNA was significantly induced by both LPS and PGN (Fig. 5C and D), suggesting that TBK1 plays a vital role in response to both gram-negative and gram-positive bacterial PAMPs in teleosts. In mammals, IRF3 and IRF7 are involved in TBK1-mediated IFN signaling. In teleosts, over-expression of fish TBK1 and IRF3/IRF7

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

287

Fig. 8. The mRNA expressions of CiTBK1 (A), CiIRF3 (B), CiIRF7 (C), CiIFN-I (D) and CiMx1 (E) after LPS stimulation in pCMV (control) and pTBK1 stable transgenic cells. The concentration of LPS was 10 lg/ml. Other captions were the same as Fig. 6.

alone significantly activates IFN promoter or ISG expression (Sun et al., 2011; Zhang and Gui, 2012). Moreover, crucian carp TBK1 and IRF3 are verified to form a complex, and IRF3 activates IFN promoter (Sun et al., 2011). To disclose the mechanism of CiTBK1mediated IFN response, mRNA expression profiles of some key genes were investigated in cells over-expressing CiTBK1 post GCRV challenge or viral/bacterial PAMPs stimulation (Figs. 6–9). mRNA level of CiIRF3 was inhibited in CiTBK1 transgenic cells without challenge. For this result, possible reason may be that CiTBK1 activated some molecules which inhibited the transcription of CiIRF3. In CiTBK1 genomic sequence, three characteristic motifs (GAS, GAAA/TTTC and ISRE) responsive to IFN implied that CiTBK1 participates in the IFN response (Li et al., 2012b; Yang et al., 2013a). As anticipated, the transcription level of CiIFN-I is tightly co-related with the expressions of CiTBK1, even without PAMPs presence, confirming that grass carp possess a conserved TBK1-mediated IFN-I response. Meanwhile, the IFN-inducible gene CiMx1 also weakly increased.

In stably transfected cells, the examined genes were all up-regulated in cells transfected with pCMV post challenge, indicating that grass carp may possess a conserved TBK1-IRF3/IRF7-IFN-I signaling cascade in response to virus and viral/bacterial PAMPs challenge. In CiTBK1 over-expressing cells infected with GCRV, the expression levels of the CiIRF7, CiIFN-I and CiMx1 genes were significantly increased (Fig. 6C–E), which indicated that CiTBK1 can enhance antiviral immune responses. The delayed appearance of CPE and inhibition of GCRV yield in CiTBK1 over-expression cells (Fig. 10A and B) further demonstrated the antiviral activities of CiTBK1. Notably, the expression of CiIRF3 was inhibited at early stage upon virus infection, while was up-regulated at late phrase (Fig. 6B). It seemed that the inhibition of CiIRF3 was abolished at late phrase to maintain the host innate antiviral response. In mammals, both IRF3 and IRF7 are essential in IFN-I induction, IFN-b is firstly induced by IRF3 and IFN-a is then induced by IRF7 (Sato et al., 2000). However, fish IFN-I genes cannot be classified into IFN-a or IFN-b. Based on protein sequences and phylogenetic

288

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

Fig. 9. The mRNA expressions of CiTBK1 (A), CiIRF3 (B), CiIRF7 (C), CiIFN-I (D) and CiMx1 (E) after PGN stimulation in pCMV (control) and pTBK1 stable transgenic cells. The concentration of PGN was 10 lg/ml. Other captions were the same as Fig. 6.

analyses, fish IFNs can be classified into two groups: group I containing two cysteine residues and group II containing four cysteine residues (Zou et al., 2007). Zebrafish IFN1 and CiIFN-I with two cysteine residues belong to group I, and zebrafish IFN3 with four cysteines belongs to group II (Li et al., 2012a; Zhang and Gui, 2012). Previous study shows that zebrafish IFN1 and crucian carp IFN1 are primarily regulated by IRF3 and IRF7 resembling that of the IFNb, and zebrafish IFN3 is regulated by IRF7 resembling those of IFN-a genes (Sun et al., 2011). The results here suggested that CiIFN-I is mainly controlled by CiIRF7 upon virus infection. This is consistent with the precious study that CiIRF7 acts as a positive regulator on the transcription of CiIFN-I (Li et al., 2012a). Post poly I:C stimulation, over-expression of CiTBK1 diminished poly I:C-induced expression of CiIRF3, CiIRF7 and CiIFN-I (Fig. 7B– D). It has been demonstrated that the activity of IRF3 and IRF7 may be indirectly down-regulated through a number of emerging mechanisms that act at the level of TLR-dependent and/or RIG-Idependent signaling (Hiscott, 2007). The ubiquitin-editing enzyme A20, which is identified as a poly I:C- or LPS-inducible protein, effi-

ciently blocks RIG-I-mediated activation of IRF3/IRF7-dependent promoters but only weakly interferes with TLR3-TRIF-mediated IFN activation (Lin et al., 2006). Interestingly, poly I:C-triggered CiMx1 induction was significantly enhanced in CiTBK1 overexpression cells (Fig. 7E). Mx is known as an IFN-inducible gene, but it is not induced only by IFN-I. It is possible that CiMx1 induction by poly I:C in CiTBK1 transfected cells can be an IFN-independent pathway, similar to that of Atlantic salmon Mx by salmon anemia virus challenge and Japanese flounder Mx by poly I:C infection (Kileng et al., 2007; Ohtani et al., 2010). In addition, compared to GCRV challenge, much lower mRNA levels of CiIFN-I and CiMx1 were observed after poly I:C stimulation in CiTBK1 over-expression cells. These results indicated that CiTBK1 triggers a stronger response to virus invasion relative to nucleic acids, and CiTBK1-mediated signaling is regulated by both nucleic acids and capsids of GCRV. Furthermore, the role of CiTBK1 in LPS-trigger IFN response was investigated. In mammals, TLR4 is involved in recognition of bacterial LPS, whereas TLR4 in zebrafish has no function in LPS

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

289

Wan for technical advice and assistance in experiments. This study was supported by Program for New Century Excellent Talents in University (NCET-08-0466) and Chinese Universities Scientific Fund (QN2009022). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.dci.2014.03.018. References

Fig. 10. Antiviral activity assay and the virus quantities in pCMV (control) and pTBK1 transfected cells post GCRV infection. (A) In antiviral activity assay, the steadily transfected cells were seeded into 96-well plates, and then infected with 2fold-diluted GCRV in duplicate. After 60 h post-infection, cells were fixed with 10% paraformaldehyde and stained with 0.05% (wt/vol) crystal violet. (B) The virus quantities in pCMV (control) and pTBK1 transfected cells post GCRV infection. EF1a was used as an internal control. Asterisks (⁄) mark the significant difference between experimental and control groups (p < 0.05). Error bars indicate SE (n = 4).

recognition and is not present in most other fish species (Sepulcre et al., 2009; Zhang and Gui, 2012). In teleosts, upon LPS stimulation, goldfish TLR22 mRNA expression is significantly up-regulated in cultured macrophages (Stafford et al., 2003), as well as orangespotted grouper TLR22 in head kidney leukocytes (Ding et al., 2012). In grass carp, the mRNA transcriptions of CiTLR3, CiTLR22, CiRIG-I, CiMDA5 and CiLGP2 were all up-regulated by LPS stimulation (Chen et al., 2013). Here, upon LPS stimulation, the transcripts of CiIRF3 and CiIRF7 decreased in CiTBK1 over-expression cells compared with those in control group (Fig. 8B and C). However, the expression levels of CiIFN-I and CiMx1 were highly induced (Fig. 8D and E). It is known that zebrafish TRIF activates IFN-I in an IRF3/7-independent manner because DrTRIF does not contain the TRAF6-binding motif, which is crucial for IRF3 activation in mammals (Sullivan et al., 2007; Zhang and Gui, 2012). The N-terminal region of CiTRIF also lacks the TRAF6-binding motif (Yang et al., 2013a). Thus, it is possible that CiTBK1-medidate IFN-I expression can be induced by LPS stimulation through an IRF3/IRF7-independent pathway. Finally, the role of CiTBK1 in PGN-trigger IFN response was also investigated. Notably, over-expression of CiTBK1 significantly blocked and delayed PGN-triggered immune response (Fig. 9). This may be a negative mechanism to prevent harmful effects resulting from excessive activation. In summary, a full-length genomic sequence of TBK1 was identified and characterized from grass carp. CiTBK1 exhibits extraordinary broad roles in innate immune responses, responding to not only dsRNA virus or synthetic dsRNA but also bacterial PAMPs. Moreover, CiTBK1 keeps regulatory balance that limits the extent which can be activated in response to different challenges. Further investigation is needed to clarify the accurate regulatory mechanism involved in the TBK1-mediated signaling.

Acknowledgements The authors would like to thank Miss Qingmei Li, Miss Yixuan Zhang, Miss Xueying Shang, Mr Lijun Chen and Mr Quanyuan

Castillo-Davis, C.I., Mekhedov, S.L., Hartl, D.L., Koonin, E.V., Kondrashov, F.A., 2002. Selection for short introns in highly expressed genes. Nat. Genet. 31, 415–418. Chen, L., Li, Q., Su, J., Yang, C., Li, Y., Rao, Y., 2013. Trunk kidney of grass carp (Ctenopharyngodon idella) mediates immune responses against GCRV and viral/ bacterial PAMPs in vivo and in vitro. Fish Shellfish Immunol. 34, 909–919. Chi, H., Zhang, Z., Bogwald, J., Zhan, W., Dalmo, R.A., 2011. Cloning, expression analysis and promoter structure of TBK1 (TANK-binding kinase 1) in Atlantic cod (Gadus morhua L.). Fish Shellfish Immunol. 30, 1055–1063. Deng, W., Shi, M., Han, M., Zhong, J., Li, Z., Li, W., Hu, Y., Yan, L., Wang, J., He, Y., Tang, H., Deubel, V., Luo, X., Ning, Q., Sun, B., 2008. Negative regulation of virustriggered IFN-beta signaling pathway by alternative splicing of TBK1. J. Biol. Chem. 283, 35590–35597. Ding, X., Lu, D.Q., Hou, Q.H., Li, S.S., Liu, X.C., Zhang, Y., Lin, H.R., 2012. Orangespotted grouper (Epinephelus coioides) toll-like receptor 22: molecular characterization, expression pattern and pertinent signaling pathways. Fish Shellfish Immunol. 33, 494–503. Feng, H., Liu, H., Kong, R., Wang, L., Wang, Y., Hu, W., Guo, Q., 2011. Expression profiles of carp IRF-3/-7 correlate with the up-regulation of RIG-I/MAVS/TRAF3/ TBK1, four pivotal molecules in RIG-I signaling pathway. Fish Shellfish Immunol. 30, 1159–1169. Fitzgerald, K.A., McWhirter, S.M., Faia, K.L., Rowe, D.C., Latz, E., Golenbock, D.T., Coyle, A.J., Liao, S.M., Maniatis, T., 2003. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4, 491–496. Helgason, E., Phung, Q.T., Dueber, E.C., 2013. Recent insights into the complexity of Tank-binding kinase 1 signaling networks: the emerging role of cellular localization in the activation and substrate specificity of TBK1. FEBS Lett. 587, 1230–1237. Hemmi, H., Takeuchi, O., Sato, S., Yamamoto, M., Kaisho, T., Sanjo, H., Kawai, T., Hoshino, K., Takeda, K., Akira, S., 2004. The roles of two IkappaB kinase-related kinases in lipopolysaccharide and double stranded RNA signaling and viral infection. J. Exp. Med. 199, 1641–1650. Hiscott, J., 2007. Triggering the innate antiviral response through IRF-3 activation. J. Biol. Chem. 282, 15325–15329. Irimia, M., Roy, S.W., 2008. Spliceosomal introns as tools for genomic and evolutionary analysis. Nucleic Acids Res. 36, 1703–1712. Irimia, M., Penny, D., Roy, S.W., 2007. Coevolution of genomic intron number and splice sites. Trends Genet. 23, 321–325. Ishii, K.J., Kawagoe, T., Koyama, S., Matsui, K., Kumar, H., Kawai, T., Uematsu, S., Takeuchi, O., Takeshita, F., Coban, C., Akira, S., 2008. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature 451, 725–729. Jeffares, D.C., Penkett, C.J., Bahler, J., 2008. Rapidly regulated genes are intron poor. Trends Genet. 24, 375–378. Karpova, A.Y., Ronco, L.V., Howley, P.M., 2001. Functional characterization of interferon regulatory factor 3a (IRF-3a), an alternative splice isoform of IRF-3. Mol. Cell. Biol. 21, 4169–4176. Kawai, T., Takahashi, K., Sato, S., Coban, C., Kumar, H., Kato, H., Ishii, K.J., Takeuchi, O., Akira, S., 2005. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat. Immunol. 6, 981–988. Kileng, O., Brundtland, M.I., Robertsen, B., 2007. Infectious salmon anemia virus is a powerful inducer of key genes of the type I interferon system of Atlantic salmon, but is not inhibited by interferon. Fish Shellfish Immunol. 23, 378–389. Kumar, H., Kawai, T., Akira, S., 2011. Pathogen recognition by the innate immune system. Int. Rev. Immunol. 30, 16–34. Lam, E., Stein, S., Falck-Pedersen, E., 2014. Adenovirus detection by the cGAS/STING/ TBK1 DNA sensing cascade. J. Virol. 88, 974–981. Li, D., Tan, W., Ma, M., Yu, X., Lai, Q., Wu, Z., Lin, G., Hu, C., 2012a. Molecular characterization and transcription regulation analysis of type I IFN gene in grass carp (Ctenopharyngodon idella). Gene 504, 31–40. Li, S., Sun, F., Zhang, Y.B., Gui, J.F., Zhang, Q.Y., 2012b. Identification of DreI as an antiviral factor regulated by RLR signaling pathway. PLoS ONE 7, e32427. Lin, R., Yang, L., Nakhaei, P., Sun, Q., Sharif-Askari, E., Julkunen, I., Hiscott, J., 2006. Negative regulation of the retinoic acid-inducible gene I-induced antiviral state by the ubiquitin-editing protein A20. J. Biol. Chem. 281, 2095–2103. Magnadottir, B., 2006. Innate immunity of fish (overview). Fish Shellfish Immunol. 20, 137–151. Mancl, M.E., Hu, G., Sangster-Guity, N., Olshalsky, S.L., Hoops, K., FitzgeraldBocarsly, P., Pitha, P.M., Pinder, K., Barnes, B.J., 2005. Two discrete promoters regulate the alternatively spliced human interferon regulatory factor-5 isoforms. J. Biol. Chem. 280, 21078–21090.

290

X. Feng et al. / Developmental and Comparative Immunology 45 (2014) 278–290

Ohtani, M., Hikima, J., Kondo, H., Hirono, I., Jung, T.S., Aoki, T., 2010. Evolutional conservation of molecular structure and antiviral function of a viral RNA receptor, LGP2, in Japanese flounder, Paralichthys olivaceus. J. Immunol. 185, 7507–7517. Peng, L., Yang, C., Su, J., 2012. Protective roles of grass carp Ctenopharyngodon idella Mx isoforms against grass carp reovirus. PLoS ONE 7, e52142. Perry, A.K., Chow, E.K., Goodnough, J.B., Yeh, W.C., Cheng, G., 2004. Differential requirement for TANK-binding kinase-1 in type I interferon responses to tolllike receptor activation and viral infection. J. Exp. Med. 199, 1651–1658. Pomerantz, J.L., Baltimore, D., 1999. NF-kappaB activation by a signaling complex containing TRAF2, TANK and TBK1, a novel IKK-related kinase. EMBO J. 18, 6694–6704. Radtke, A.L., Delbridge, L.M., Balachandran, S., Barber, G.N., O’Riordan, M.X., 2007. TBK1 protects vacuolar integrity during intracellular bacterial infection. PLoS Pathog. 3, e29. Rauta, P.R., Nayak, B., Das, S., 2012. Immune system and immune responses in fish and their role in comparative immunity study: a model for higher organisms. Immunol. Lett. 148, 23–33. Reisman, D., Greenberg, M., Rotter, V., 1988. Human p53 oncogene contains one promoter upstream of exon 1 and a second, stronger promoter within intron 1. Proc. Natl. Acad. Sci. USA 85, 5146–5150. Sato, M., Suemori, H., Hata, N., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N., Taniguchi, T., 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFNalpha/beta gene induction. Immunity 13, 539–548. Sato, S., Sugiyama, M., Yamamoto, M., Watanabe, Y., Kawai, T., Takeda, K., Akira, S., 2003. Toll/IL-1 receptor domain-containing adaptor inducing IFN-beta (TRIF) associates with TNF receptor-associated factor 6 and TANK-binding kinase 1, and activates two distinct transcription factors, NF-kappa B and IFN-regulatory factor-3, in the Toll-like receptor signaling. J. Immunol. 171, 4304–4310. Sepulcre, M.P., Alcaraz-Perez, F., Lopez-Munoz, A., Roca, F.J., Meseguer, J., Cayuela, M.L., Mulero, V., 2009. Evolution of lipopolysaccharide (LPS) recognition and signaling: fish TLR4 does not recognize LPS and negatively regulates NF-kappaB activation. J. Immunol. 182, 1836–1845. Shi, J., Zhang, Y.B., Zhang, J.S., Gui, J.F., 2013. Expression regulation of zebrafish interferon regulatory factor 9 by promoter analysis. Dev. Comp. Immunol. 41, 534–543. Shu, C., Sankaran, B., Chaton, C.T., Herr, A.B., Mishra, A., Peng, J., Li, P., 2013. Structural insights into the functions of TBK1 in innate antimicrobial immunity. Structure 21, 1137–1148.

Solis, M., Romieu-Mourez, R., Goubau, D., Grandvaux, N., Mesplede, T., Julkunen, I., Nardin, A., Salcedo, M., Hiscott, J., 2007. Involvement of TBK1 and IKKepsilon in lipopolysaccharide-induced activation of the interferon response in primary human macrophages. Eur. J. Immunol. 37, 528–539. Stafford, J.L., Ellestad, K.K., Magor, K.E., Belosevic, M., Magor, B.G., 2003. A toll-like receptor (TLR) gene that is up-regulated in activated goldfish macrophages. Dev. Comp. Immunol. 27, 685–698. Su, J., Yang, C., Zhu, Z., Wang, Y., Jang, S., Liao, L., 2009. Enhanced grass carp reovirus resistance of Mx-transgenic rare minnow (Gobiocypris rarus). Fish Shellfish Immunol. 26, 828–835. Su, J., Zhang, R., Dong, J., Yang, C., 2011. Evaluation of internal control genes for qRTPCR normalization in tissues and cell culture for antiviral studies of grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 30, 830–835. Sullivan, C., Postlethwait, J.H., Lage, C.R., Millard, P.J., Kim, C.H., 2007. Evidence for evolving Toll-IL-1 receptor-containing adaptor molecule function in vertebrates. J. Immunol. 178, 4517–4527. Sun, F., Zhang, Y.B., Liu, T.K., Shi, J., Wang, B., Gui, J.F., 2011. Fish MITA serves as a mediator for distinct fish IFN gene activation dependent on IRF3 or IRF7. J. Immunol. 187, 2531–2539. Tanaka, Y., Chen, Z.J., 2012. STING specifies IRF3 phosphorylation by TBK1 in the cytosolic DNA signaling pathway. Sci. Signal. 5, ra20. Wang, L., Su, J., Yang, C., Wan, Q., Peng, L., 2012. Genomic organization, promoter activity of grass carp MDA5 and the association of its polymorphisms with susceptibility/resistance to grass carp reovirus. Mol. Immunol. 50, 236–243. Weidberg, H., Elazar, Z., 2011. TBK1 mediates crosstalk between the innate immune response and autophagy. Sci. Signal. 4, pe39. Yang, C., Li, Q., Su, J., Chen, X., Wang, Y., Peng, L., 2013a. Identification and functional characterizations of a novel TRIF gene from grass carp (Ctenopharyngodon idella). Dev. Comp. Immunol. 41, 222–229. Yang, C., Peng, L., Su, J., 2013b. Two HMGB1 genes from grass carp Ctenopharyngodon idella mediate immune responses to viral/bacterial PAMPs and GCRV challenge. Dev. Comp. Immunol. 39, 133–146. Zhang, Y.B., Gui, J.F., 2012. Molecular regulation of interferon antiviral response in fish. Dev. Comp. Immunol. 38, 193–202. Zou, J., Tafalla, C., Truckle, J., Secombes, C.J., 2007. Identification of a second group of type I IFNs in fish sheds light on IFN evolution in vertebrates. J. Immunol. 179, 3859–3871. Zou, J., Bird, S., Secombes, C., 2010. Antiviral sensing in teleost fish. Curr. Pharm. Des. 16, 4185–4193.