Research Article For reprint orders, please contact: [email protected]
Molecular diagnosis of bovine tuberculosis in bovine and human samples: implications for zoonosis Md Masudur Rahman*,1,2, Monira Noor1, Kazi Mehetazul Islam1, Md Bashir Uddin1,3, Ferdaus Mohd Altaf Hossain1,4, Mohammad Ali Zinnah5, Mohammad Al Mamun1, Mohammad Rafiqul Islam6, Seong Kug Eo4 & Hossam M Ashour**,7,8 Abstract Aim: To develop emerging diagnostic technique for bovine tuberculosis and to identify its potential risk factors. Materials & methods: Bacterial genomic DNA was isolated from bovine milk and human sputum samples and subjected to PCR using specific primer pairs. PCR results were validated using bacteriological cultures. Results: PCR amplification of the targeted DNA fragment of Mycobacterium bovis was successful in 12.33% (37/300) of the bovine samples. Interestingly, 500-bp DNA fragment was also amplified in 6.67% (6/90) of the sputum indicating the possibility of zoonotic transmission. Rearing of livestock in household, unpasteurized milk consumption and smoking were identified as potential risk factors. Conclusion: Results of the study may add value to bovine tuberculosis eradication campaigns to achieve the One Health initiative. Bovine tuberculosis (bTB) is caused primarily by Mycobacterium bovis, a Gram-positive acid-fast bacterium that affects domestic and wild mammalians as well as humans [1–3] . According to WHO, bTB is a neglected, endemic zoonosis in many countries. In Bangladesh, there is little information on the prevalence of bTB in livestock animals. Moreover, all the prevalence studies were made relying on dermal tuberculin test which may not represent exact prevalence rate of the disease. According to available reports, prevalence rate of bTB in cattle, buffalos, sheep and goats in Bangladesh were 33.73, 6.12, 9.15 and 1.29%, respectively [4,5] . This zoonotic disease constitutes a significant economic burden to the agricultural industries in many countries including Bangladesh. Infection most commonly occurs through the consumption of contaminated, unpasteurized dairy products. Infection can also occur from direct contact with a wound during slaughter, or by inhaling the bacteria in air exhaled by animals infected with M. bovis [6,7] . Transmission to humans makes it a public health problem. This is particularly important given that zoonotic TB, caused by transmission of M. bovis to humans, is clinically identical to infections caused by Mycobacterium tuberculosis (typical TB). Most of the world’s population live in countries in which there is limited control of bovine tuberculosis [8] . Thus, there is consensus regarding risks to human health on a global scale. The control of bTB relies on test and slaughter policies and abattoir surveillance. In spite of
Keywords
• bovine tuberculosis • molecular diagnosis • zoonotic transmission
Faculty of Veterinary & Animal Science, Sylhet Agricultural University, Sylhet 3100, Bangladesh Veterinary Research Institute, Hudcova 70, Brno 621 00, Czech Republic 3 College of Veterinary Medicine, Chungnam National University, Daejeon, Republic of Korea 4 College of Veterinary Medicine & Bio-Safety Research Institute, Chonbuk National University, Jeonju 561–756, Republic of Korea 5 Faculty of Veterinary Medicine & Animal Science, Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, Bangladesh 6 Animal Health Research Division, Bangladesh Livestock Research Institute, Savar, Dhaka, Bangladesh 7 Department of Pharmacy Practice, Eugene Applebaum College of Pharmacy & Health Sciences, Wayne State University, Detroit, MI 48202, USA 8 Department of Microbiology & Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt *Author for correspondence: [email protected] **Author for correspondence: [email protected] 1 2
10.2217/FMB.14.139 © 2015 Future Medicine Ltd
Future Microbiol. (2015) 10(4), 527–535
part of
ISSN 1746-0913
527
Research Article Rahman, Noor, Islam et al. extensive eradication efforts in many countries, bTB continues to be a global problem [9] . Currently available methods for bTB diagnosis include tuberculin skin tests, bacteriologic culturing, histopathology, serological tests and molecular PCR-based techniques [10] . However, no single method is sufficient for detecting all bTB-infected cattle [8] . The tuberculin skin test using a purified protein derivative of M. bovis origin (bovPPD) is the OIE prescribed test for international trade [11] . However, confirmation of the diagnosis is achieved by culture and biochemical assays as cattle infected with Mycobacterium avium, M, tuberculosis, M. avium paratuberculosis, Nocardia farcinius or other mycobacteria can also be reactive to bovPPD, leading to falsepositive results. The microbiological culture is highly specific. However, a positive result is time consuming and is typically achieved after the sacrifice of the animal. Thus, it is necessary to develop new diagnostic methods that identify M. bovis directly in milk or blood, without the need for microbiological culture. This is expected to also improve the predictive value of the tuberculin test by confirming the tuberculin-positive cases. A PCR-based method targeting the highly conserved sequence of the microorganism can be applied successfully for the diagnosis of tuberculosis [12,13] . A rational approach for preventing bTB and human infection by M. bovis and reducing its negative economic impact involves identification of risk factors for human transmission and implementation of eradication programs. Little or no data are available on this. Therefore, the present study was designed to evaluate a PCR-based diagnostic test specific for M. bovis for testing bovine and human biological samples for bTB and to identify potential risk factors for its human transmission.
Materials & methods ●●Sample collection
Three hundred bovine milk samples were aseptically collected from apparently healthy cows at government farms (50 samples) and private dairy farms (150 samples) and from cows showing clinical sign of debilitated condition, cough, decreasing milk production and labored respiration at individual farms (100 samples). Government and private dairy farms are defined as farms in which more than 100 cows are reared in an organized way. Individual farms are defined as those farms in which farmers rear one to ten cows in a nonorganized way at their house premises. Approximately 10–20 ml milk samples were collected from each cow and immediately transferred to the laboratory for further processing. In addition to bovine samples, 90 sputum samples were collected from tuberculosis-positive human patients admitted at the TB Hospital, Sylhet 3100, Bangladesh for treatment. Tuberculosis was diagnosed by chest radiograph and direct smear positivity for acid-fast bacilli (AFB) of sputum samples as reported by the respective physician of the hospital. Patients were requested to submit early morning sputum sample in a 50 ml screw-cap centrifuge tube (BD Falcon™, Becton Dickinson, NJ, USA) before they started antibiotic treatment for TB. A summary of sample collection is depicted in Table 1. ●●Extraction of bacterial genomic DNA from
collected bovine & human samples
Bacterial genomic DNA was isolated from bovine milk samples using Milk Bacterial DNA Isolation Kit (Norgen Biotek Corp. ON, Canada) according to the manufacturer’s instruction. Viscous human sputum samples were liquefied and homogenized by adding
Table 1. Biological samples from cows and human patients. Sampling location
Sample type
Samples (n)
Government Dairy Farm, Sylhet Kabir Dairy Farm, Major Tila, Sylhet Home Fresh Dairy Farm, Boro Bari Baluchar, Sylhet Dream Dairy Farm, Al-Isla, Sylhet Provati Dairy Farm, West Sibgonj, Sylhet BLRI Dairy Farm, Savar, Dhaka Individual farmers from Zonaki Area, Sylhet
Bovine milk† Bovine milk Bovine milk Bovine milk Bovine milk Bovine milk Bovine milk Total bovine milk samples Human sputum‡
50 25 25 25 25 50 100 300
TB Hospital, Sylhet
90
Cows from government/private dairy farms were apparently healthy whereas cows from individual farms were clinically sick. ‡ Sputum samples were collected from tuberculosis-positive human patients. †
528
Future Microbiol. (2015) 10(4)
future science group
Molecular diagnosis of bovine tuberculosis in bovine & human samples dithiothreitol (DTT) to the sample at a final concentration of 50 μg/ml and heating at 37°C for 20 min prior to DNA isolation. Bacterial genomic DNA was isolated from completely homogenized sputum samples using Sputum DNA Isolation Kit (Norgen Biotek Corp.) following the manufacturer’s instruction. Bacterial genomic DNA was extracted from M. bovis pure culture kindly provided by Laboratory of Animal Health, Bangladesh Livestock Research Institute, Savar, Dhaka and used as template for positive control to validate our PCR results. After elution, DNA concentration and purity were determined using NanoDrop TM 2000c (Thermo Scientific, DE, USA). DNA samples were kept at -20°C until use for PCR amplification.
Research Article
for bTB at PCR assay were further processed for M. bovis isolation and identification as previously described [14] . Briefly, a volume of 5 ml of bovine milk or homogenized human sputum sample was decontaminated with 4% sodium hydroxide and then neutralized using concentrated hydrochloric acid. Suspensions were then centrifuged at 3000 ×g for 30 min and the sediment was inoculated onto LowensteinJensen and Coletsos media and incubated at 37°C for 8 weeks. M. bovis characterization was performed using the Ziehl-Neelsen staining, culture characteristics (growth rate, colony morphology) and standard biochemical tests (niacin production, nitrate reduction, catalase, aryl sulfatase activity, etc.) as recommended by the CDC, Atlanta, GA, USA, with appropriate control [15] .
●●PCR amplification
For PCR, a set of for ward ( JB21: TCGTCCGCTGATGCAAGTGC) and reverse ( JB22: CGTCCGCTGACCTCAAGAAAG) primers specific for M. bovis were designed as described previously [12,13] and primer annealing was checked using NCBI nucleotide BLAST software. The extracted bacterial DNA was subjected to the PCR amplification of the target sequence (500-bp) using specific primer pairs ( JB21 and JB22, Bioneer, Daedeok-gu, Daejeon, Republic of Korea) following previously described methods [13] with slight modification. The PCR reactions were performed in a final volume of 20 μl containing 1× reaction buffer (Promega, WI, USA), 2.5 U of Taq polymerase (Promega), 0.2 mM each deoxynucleoside triphosphate (dNTP), 1.5 mM magnesium chloride and 20 pmol of each primer. Target DNA was denatured by incubation for 10 min at 95°C before amplification for 30 cycles of 94°C for 1 min, annealing at 65°C for 1 min and extension at 72°C for 1 min followed by 72°C for 10 min (final extension) and holding at 4ºC until collection. All reactions were carried out in an automated thermal cycler (BioRad, CA, USA). Amplicons were subjected to 1.5% agarose gel electrophoresis and visualized with ethidium bromide by ultraviolet light using an image documentation system. ●●Isolation and identification of
M. bovis from bTB-positive samples by bacteriological culture & biochemical tests
To validate PCR assay, the samples (bovine milk and human sputum) that were positive
future science group
●●Risk factor analysis for bTB in human
& cattle
A questionnaire was developed including previously identified risk factors [16,17] . Interviewing data were collected from farm owners, individual farmers and tuberculosis-positive human patients while collecting biological samples. ●●Statistical analysis
Epidemiological data analysis was performed with the software package STATA 10.1 to identify the risk factors for bovine tuberculosis in human and cattle. Results ●●Identification of M. bovis from bovine milk
& human sputum samples
Milk samples collected from cows at different farming conditions were used for molecular diagnosis of bTB. Bacterial genomic DNA was extracted from the bovine milk samples followed by PCR amplification of target fragment (500 bp) using JB21 and JB22 primers specific for M. bovis. A DNA fragment of 500 bp was amplified from 37 milk samples out of 300 (12.33%) indicating bTB positivity (Figure 1 & Table 2) . To determine the possibility of zoonotic transmission of bTB to human, sputum samples from tuberculosis-positive human patients were evaluated by PCR using the same primer pair ( JB21 and JB22) specific for M. bovis. Interestingly, 500-bp DNA fragment was amplified (Figure 1 & Table 2) from six samples out of 90 (6.67%) indicating possible zoonotic transmission of bTB to humans. PCR data were
www.futuremedicine.com
529
Research Article Rahman, Noor, Islam et al.
M
S1
S2
P
N
M
500 bp
Figure 1. Ethidium bromide-stained 1.5% (w/v) agarose gel showing target amplicon of Mycobacterium bovis DNA amplified by PCR assay. Bacterial genomic DNA extracted from biological samples (suspected bovine milk and sputum of tuberculosis-positive human patients) were employed to amplify specific fragment of M. bovis DNA using specific primer pair. The arrow in agarose gel image indicates amplified specific DNA fragment (500 bp). Lanes M: size marker (100-bp ladder); S1: bovine milk sample; S2: human sputum from tuberculosispositive patient; P: positive control (bacterial DNA extracted from pure culture of M. bovis as template); N: Negative control (DNA-free water).
validated using bacteriologic culturing and biochemical tests. As shown in Table 2, M. bovis was isolated and identified from all samples (bovine milk and human sputum) that were positive for bTB by PCR assay. ●●Descriptive epidemiology of the risk
factors
A total of 300 bovine milk samples were collected, of which 200 samples were collected from apparently healthy cows of six different dairy farms (government and private) and 100 samples from cows of individual farmers showing clinical signs similar to bTB. bTB was not detected in cows of any government or private dairy farms. Conversely, bTB was detected in 37 cows of individual farmers (out of 100 cows). As bTB is a management-related disease, we studied different management factors. Good management practices were followed at all dairy farms in the study. However, at the farmers’ level, most farmers did not maintain good management practices, such as bio-security, balanced nutrition and proper ventilation (Table 3) . This is due to their lack of knowledge and due to poverty
530
Future Microbiol. (2015) 10(4)
conditions. We identified poor biosecurity and ill health due to poor nutrition as managementrelated risk factors for the outbreak of bTB at the farmers’ level (Table 3) . To determine bTB at the bovine–human interface and zoonotic transmission, we collected 90 sputum samples from tuberculosispositive human patients. These were subjected to molecular diagnosis of bTB by PCR using JB21 and JB22 primer pairs specific for the 500-bp fragment of M. bovis genome. Out of 90 tuberculosis-positive samples, six samples were positive for bTB. To determine the risk factors for the outbreak of tuberculosis and bTB in humans, we collected information from all 90 individual human patients admitted to the TB Hospital, Sylhet. This is summarized in Table 4. As shown in Table 4, people above 35 years old were more susceptible to tuberculosis and females were more frequently affected than males. Educational levels, rearing of livestock animals in household, consumption of unpasteurized milk, smoking and contact with TB patients were identified as major risk factors for tuberculosis in humans whereas rearing of livestock in household,
future science group
Molecular diagnosis of bovine tuberculosis in bovine & human samples consumption of unpasteurized milk and smoking were found to be risk factors for bTB in humans. Discussion Cases of human tuberculosis of bovine origin have long been reported causing severe negative impacts on public health and global economy [18–20] . In the present study, we diagnosed bTB directly in biological samples of bovine milk and human sputum using a PCR-based diagnostic assay targeting a unique 500-bp fragment of genomic DNA of the microorganism using JB21 and JB22 primers. We also identified risk factors of bTB that influence its possible zoonotic transmission in humans and cattle. ●●PCR-based diagnosis of bTB from
biological samples
We used a PCR-based diagnostic assay, in which we amplified a highly conserved 500-bp fragment [12,13] using JB21 and JB22 primers (Figure 1) . This is important for discrimination of M. bovis from M. avium, M. paratuberculosis or other related strains [21] . It is noteworthy that this sequence is also present in isolates from other mammals, such as sea lions and wild deer [22–24] . It is noteworthy that diagnosis was established with different methods and thus cannot be directly compared. ●●Prevalence of bovine tuberculosis in cattle
& humans
The prevalence of bTB in cattle (12.33%) was three- to fourfold higher than that reported by Boukary et al. in a study in Niger (3.6%) [17] but nearly threefold lower than that reported by Uddin et al. in Bangladesh [25] . The prevalence in cattle is influenced by the geographical situation of a country, temperature, precipitation, hygienic status of humans and animals and enforced regularity laws in Public Health and Veterinary Public Health sectors. False-positive reactions can sometimes influence the results of bovine tuberculin tests. We recorded a prevalence rate of 6.67% bTB in humans. This is consistent with previous findings [7] .
Research Article
●●Risk factors for bTB transmission in human
& cattle
We identified poor biosecurity and ill health due to poor nutrition as critical managementrelated risk factors of bTB infection in cattle at the farmers’ level. Previous research in Africa identified several environmental risk factors for transmission of bTB among animals, such as sharing water points, grazing or high promiscuity [26,27] . Several authors found a significant association between herd size and bTB infection among cattle and stated that as the herd size increased, there was a corresponding increase in the prevalence of bTB [17,28] . In this study, we detected bTB at individual farmers’ levels but not at organized dairy farms comprising herd size of 100–300 cattle. Strict biosecurity and proper quarantine practices were maintained at all the farms. Cleaveland et al. reported that cattle older than 10 years of age are at a higher risk of infection [29] . This might be due to the increased duration of exposure in older cattle [27,30] . We observed the same trend in our study. Moreover, we found that people above 35 years old were more susceptible to tuberculosis and females were more frequently affected than males. Educational levels, rearing of livestock animals in household, consumption of unpasteurized milk, smoking and contact with TB patient are major risk factors for tuberculosis in humans. On the other hand, rearing of livestock in household, consumption of unpasteurized milk and smoking are risk factors for bTB in humans. Raw milk consumption generally leads to more cases of human TB of animal origin [26] . Consumption of unpasteurized dairy products was a common practice among farmers in our study. Boukary et al. [17] reported that hygiene in households and consumption of raw milk are main determinants of M. bovis infection in humans. Others have drawn positive correlations between animal-to-human transmission of M. bovis and food habits or hygienic conditions in a population [28,29] .
Table 2. Validation of PCR assay by bacteriological culture and biochemical tests. Species
Sample type
Samples (n)
Bovine tuberculosis-positive samples Isolation of Mycobacterium bovis by PCR, n (% positive) by bacteriology†
Bovine Human
Milk Sputum
300 90
37 (12.33) 6 (6.67)
37 6
Bacteriology was performed only with the samples positive for bovine tuberculosis by PCR.
†
future science group
www.futuremedicine.com
531
Research Article Rahman, Noor, Islam et al. We analyzed possible risk factors for M. bovis infection in cattle and its transmission in humans using univariable analysis as the sample size and number of bTB-positive cases were less. Therefore, we could not precisely address how each of the individual risk factor interacts. A more comprehensive study including large cohorts of samples and multivariable analysis of the risk factors could gain an understanding on how each of the individual risk factor interacts, for example, how does sex and education interact with household livestock and contact with TB patients. Positive correlations between animal-to-human transmission of bTB could also be made. Conclusion In this study, a PCR-based diagnostic assay for bTB was evaluated and validated using bovine milk and human sputum samples which may be used as rapid and specific diagnosis of bTB in cattle and humans. Early detection of M. bovis by PCR could be useful either as an epidemiological tool for field trials in cattle or in human clinical follow-up programs, in order to establish the real magnitude of bovine tuberculosis. Positive molecular diagnosis of bovine tuberculosis in bovine and human samples in Bangladesh is alarming and calls for stricter measures to minimize risk factors for human transmission. Risk factors identified in this study can be useful in preventing zoonotic transmission of bTB at the cattle–human interface and can be implicated
in implementation of control and eradication programs against bTB. Future perspective Animal and human health is inextricably interwoven and food animals, especially cattle serve as a reservoir of diseases of public health importance. WHO considered bovine tuberculosis as one of the seven neglected zoonotic diseases having great potential to infect humans. There is increasing evidence that bovine tuberculosis caused by M. bovis infections may be much more significant than generally considered. Though the incidence of bovine tuberculosis in developed countries is greatly reduced following implementation of eradication programs involving test and slaughter policy and milk pasteurization, the current increasing incidence of tuberculosis in the human population has given rise to a renewed interest in the zoonotic importance of M. bovis, especially in developing countries, as humans and animals are sharing the same microenvironment and dwelling premises, especially in rural areas. The direct correlation between M. bovis infection in cattle and the disease incidence in humans has been well documented in developed countries, whereas scanty information on this issue is available from developing countries. On the international scene, several fora and institutions like the Food and Agricultural Organization (FAO), World Organization for Animal Health (OIE) and WHO have stressed on the need to prevent and control tuberculosis in both humans
Table 3. Risk factor analysis of bovine tuberculosis at the level of individual farms.
532
Risk factors
Categories
Bovine tuberculosis positive cases, n (% positive)
Farmer’s educational level Knowledge on biosecurity Herd size Age class Balanced nutrition Biosecurity Proper ventilation
No education Primary school Secondary school Moderate Poor No 1–5 animals 6–10 animals 3–6 years 7–10 years 11–19 years Yes No Poor Moderate Yes No
17 (17) 11 (11) 9 (9) 5 (5) 9 (9) 23(23) 21 (21) 16 (16) 6 (6) 9 (9) 22 (22) 8 (8) 29 (29) 30 (30) 7 (7) 17 (17) 20 (20)
Future Microbiol. (2015) 10(4)
future science group
Molecular diagnosis of bovine tuberculosis in bovine & human samples
Research Article
Table 4. Risk factor analysis in tuberculosis-positive human patients. Risk factors
Categories
Tuberculosis-positive cases, n (% positive)
Bovine tuberculosis-positive cases (n)
Sex Age class Unpasteurized milk consumption
Female Male 35 years Yes No Yes No No education Primary school No Yes No Yes
57 (63.33) 33 (36.67) 12 (13.33) 33 (36.67) 45 (50) 51 (56.67) 39 (43.33) 57 (66.33) 33 (36.67) 63 (70) 27 (30) 45(50) 45 (50) 60 (66.67) 30 (33.33)
3 3 0 2 4 6 0 6 0 4 2 6 0 3 3
Livestock in household Educational levels Smoking Contact with tuberculosis patients
and animals both in developed and developing countries. According to their recommendations, strong disease surveillance programs using improved diagnostic tools in cattle and humans should be considered a priority, especially in developing countries where risk factors are present. In this study, a PCR-based diagnostic assay is introduced for rapid and specific diagnosis of bTB from biological samples in cattle and humans. Some locally operative risk factors for zoonotic TB in Bangladesh have also been identified in this study which may help to determine persons at risk and to develop appropriate control measures against tuberculosis in developing countries. Stronger intersectoral collaboration between the medical and veterinary professionals is of spark importance to combat against zoonotic bTB. International cooperation in all aspects of zoonotic bTB is essential to fight against the disease. Acknowledgements The authors thank the farmers and organization who participated in the study for their cooperation and time. The authors extend their grateful thanks to Ivan Rychlik, Veterinary Research Institute, Brno, Czech Republic for his critical comments on manuscript preparation. The authors gratefully acknowledge the Director General of Bangladesh Livestock Research Institute, Savar, Dhaka, Bangladesh for his kind permission to execute the research work and to provide laboratory facilities.
Disclosure The handling of animals in the study was performed in accordance with current Bangladesh legislation (Cruelty to
future science group
Animals Act 1920, Act No. 1 of 1920 of the Government of the People’s Republic of Bangladesh). Experiments with human samples were approved by the Ethics Committee of the Bangladesh Livestock Research Institute, Savar, Dhaka, Bangladesh. Animal experiments were approved by the Sylhet Agricultural University Institutional Animal Care and Use Committee, Sylhet, Bangladesh. Written permission was received from individual cow owner to collect and use bovine milk samples in this study.
Financial & competing interests disclosure This study was performed under the project “Molecular diagnosis of tuberculosis from bovine samples and their interface for zoonotic transmission” funded by the University Grants Commission (UGC) of Bangladesh (UGC Research Grant No, 5921) through Sylhet Agricultural University Research System (SAURES), Government of the People’s Republic of Bangladesh. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed. No writing assistance was utilized in the production of this manuscript.
Ethical conduct of research The authors state that they have obtained appropriate institutional review board approval or have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. In addition, for investigations involving human subjects, informed consent has been obtained from the participants involved.
www.futuremedicine.com
533
Research Article Rahman, Noor, Islam et al. Executive summary Aim ●●
To develop a PCR-based diagnostic test specific for Mycobacterium bovis for testing bovine and human biological samples for bovine tuberculosis (bTB).
●●
To identify potential risk factors for transmission of bTB in humans.
Materials & methods ●●
Bacterial genomic DNA was isolated from bovine milk samples and sputum samples collected from TB-positive human patients.
●●
PCR targeting to the highly conserved 500-bp fragment of M. bovis was performed using specific primer pairs.
●●
PCR results were validated using bacteriological culture and biochemical tests.
●●
Data collection and risk factor analysis for bTB in human and cattle were performed.
Results & conclusions ●●
PCR amplification of the targeted 500-bp DNA fragment of M. bovis was successful in 12.33% (37/300) of the bovine samples.
●●
500-bp DNA fragment of M. bovis was also amplified in 6.67% (6/90) of the human sputum samples tested.
●●
M. bovis was isolated and identified from all PCR-positive samples in bacteriological culture and biochemical tests.
●●
Poor biosecurity and ill health due to poor nutrition were identified as management-related risk factors for the outbreak of bTB at the farmers’ level.
●●
Rearing of livestock in household, consumption of unpasteurized milk and smoking were identified as risk factors for bTB in humans.
●●
PCR-based diagnostic assay for bTB evaluated in this study on biological samples may be used for rapid and specific diagnosis of bTB in cattle and humans.
●●
Identified risk factors can be implicated in preventing zoonotic transmission of bTB at the cattle–human interface.
References
bovine and avian tuberculosis in sheep and goat population of Bangladesh. Sci. J. Microbiol. 2(1), 1–8 (2013).
Papers of special note have been highlighted as: • of interest; •• of considerable interest 1
2
3
4
5
534
Smith NH, Gordon SV, De La RuaDomenech R, Clifton-Hadley RS, Hewinson RG. Bottlenecks and broomsticks: the molecular evolution of Mycobacterium bovis. Nat. Rev. Microbiol. 4(9), 670–681 (2006).
6
7
Renwick AR, White PC, Bengis RG. Bovine tuberculosis in southern African wildlife: a multi-species host-pathogen system. Epidemiol. Infect. 135(4), 529–540 (2007). Oloya J, Opuda-Asibo J, Kazwala R et al. Mycobacteria causing human cervical lymphadenitis in pastoral communities in the Karamoja region of Uganda. Epidemiol. Infect. 136(5), 636–643 (2008). Hossain Ml, Khan Mfr, Nazir Khmnh, Rahman Mb. A cross sectional study on prevalence of bovine tuberculosis of buffaloes in Bangladesh. Microbes Health 1, 23–26 (2012). Rahman MM, Rahman KMF, Nazira NHKHM, Rahmana MB. Prevalence of
8
9
Ayele WY, Neill SD, Zinsstag J, Weiss MG, Pavlik I. Bovine tuberculosis: an old disease but a new threat to Africa. Int. J. Tuberc. Lung Dis. 8(8), 924–937 (2004). Wilkins MJ, Meyerson J, Bartlett PC et al. Human Mycobacterium bovis infection and bovine tuberculosis outbreak, Michigan, 1994–2007. Emerg. Infect. Dis. 14(4), 657–660 (2008). Vordermeier HM, Rhodes SG, Dean G et al. Cellular immune responses induced in cattle by heterologous prime-boost vaccination using recombinant viruses and bacille Calmette-Guerin. Immunology 112(3), 461–470 (2004). Schiller I, Oesch B, Vordermeier HM et al. Bovine tuberculosis: a review of current and emerging diagnostic techniques in view of their relevance for disease control and eradication. Transbound. Emerg. Dis. 57(4), 205–220 (2010).
Future Microbiol. (2015) 10(4)
•• An overview of current and emerging bovine tuberculosis (bTB) testing strategies/tools and their incorporation into the current control/eradication programs. 10 Medeiros Ldos S, Marassi CD, Figueiredo
EE, Lilenbaum W. Potential application of new diagnostic methods for controlling bovine tuberculosis in Brazil. Braz. J. Microbiol. 41(3), 531–541 (2010). 11 Cousins DV, Florisson N. A review of tests
available for use in the diagnosis of tuberculosis in non-bovine species. Rev. Sci. Tech. 24(3), 1039–1059 (2005). 12 Rodriguez JG, Mejia GA, Del Portillo P,
Patarroyo ME, Murillo LA. Species-specific identification of Mycobacterium bovis by PCR. Microbiology 141(Pt 9), 2131–2138 (1995). •
A fragment of approximately 500 bp was amplified from the genome of 15 different Mycobacterium bovis strains using random amplified polymorphic DNA.
13 Rodriguez JG, Fissanoti JC, Del Portillo P,
Patarroyo ME, Romano MI, Cataldi A.
future science group
Molecular diagnosis of bovine tuberculosis in bovine & human samples
•
Amplification of a 500-base-pair fragment from cultured isolates of Mycobacterium bovis. J. Clin. Microbiol. 37(7), 2330–2332 (1999).
18 Brett JL, Humble MW. Incidence of human
The presence of a 500-bp fragment that amplifies a region from the genome of M. bovis was evaluated by carrying out PCR on 121 M. bovis isolates.
19 De Kantor IN, Ritacco V. Bovine tuberculosis
14 Mishra A, Singhal A, Chauhan DS et al.
Direct detection and identification of Mycobacterium tuberculosis and Mycobacterium bovis in bovine samples by a novel nested PCR assay: correlation with conventional techniques. J. Clin. Microbiol. 43(11), 5670–5678 (2005). 15 Vestal AL. Procedures of isolation and
identification of mycobacteria. U.S. Department of Health, Education, and Welfare publication no. (CDC) 77–8230. Centers for Disease Control, GA, USA, 65–98 (1977). 16 Tschopp R, Bobosha K, Aseffa A et al. Bovine
tuberculosis at a cattle-small ruminanthuman interface in Meskan, Gurage region, Central Ethiopia. BMC Infect. Dis. 11, 318 (2011). •
Assessment of bTB prevalence at an intensive contact interface in cattle, small ruminants and suspected TB-lymphadenitis human patients.
17 Boukary AR, Thys E, Abatih E et al. Bovine
tuberculosis prevalence survey on cattle in the rural livestock system of Torodi (Niger). PloS ONE 6(9), e24629 (2011). •
Prevalence study of bTB infection in cattle and identification of risk factors for infection in human and cattle populations.
future science group
tuberculosis caused by Mycobacterium bovis. NZ Med. J. 104(904), 13–14 (1991). in Latin America and the Caribbean: current status, control and eradication programs. Vet. Microbiol. 40(1–2), 5–14 (1994). 20 Fanning A, Edwards S. Mycobacterium bovis
infection in human beings in contact with elk (Cervus elaphus) in Alberta, Canada. Lancet 338(8777), 1253–1255 (1991). 21 Bauerfeind R, Benazzi S, Weiss R, Schliesser
T, Willems H, Baljer G. Molecular characterization of Mycobacterium paratuberculosis isolates from sheep, goats, and cattle by hybridization with a DNA probe to insertion element IS900. J. Clin. Microbiol. 34(7), 1617–1621 (1996). •• Mycobactin J-dependent mycobacterial isolates from sheep, goat and cattle herds with Johne’s disease were tested for the repetitive insertion sequence IS900 of Mycobacterium paratuberculosis by PCR. 22 Bernardelli A, Bastida R, Loureiro J et al.
Tuberculosis in sea lions and fur seals from the south-western Atlantic coast. Rev. Sci. Tech. 15(3), 985–1005 (1996). 23 Cousins DV, Francis BR, Gow BL et al.
Tuberculosis in captive seals: bacteriological studies on an isolate belonging to the Mycobacterium tuberculosis complex. Res. Vet. Sci. 48(2), 196–200 (1990). 24 Romano MI, Alito A, Bigi F, Fisanotti JC,
Cataldi A. Genetic characterization of Mycobacteria from South American wild seals. Vet. Microbiol. 47(1–2), 89–98 (1995).
Research Article
25 Uddin Asmt AM, Khatun Mn, Mannan Ma,
Rahman Mm, Kabir Sml. Investigation of bovine tuberculosis in rangpur division of Bangladesh. J. Life Sci. Res. 1, 1–4 (2014). 26 Cosivi O, Grange JM, Daborn CJ et al.
Zoonotic tuberculosis due to Mycobacterium bovis in developing countries. Emerg. Infect. Dis. 4(1), 59–70 (1998). •• Review on information on zoonotic TB in developing countries, risk factor analysis and recommendation to assess the magnitude of the problem and control the disease in humans and animals. 27 Humblet MF, Boschiroli ML, Saegerman C.
Classification of worldwide bovine tuberculosis risk factors in cattle: a stratified approach. Vet. Res. 40(5), 50 (2009). •• Recommendations suggested to animal health professionals and scientists directly involved in the control and prevention of bTB in cattle. 28 Ameni G, Erkihun A. Bovine tuberculosis on
small-scale dairy farms in Adama Town, central Ethiopia, and farmer awareness of the disease. Rev. Sci. Tech. 26(3), 711–719 (2007). 29 Cleaveland S, Shaw DJ, Mfinanga SG et al.
Mycobacterium bovis in rural Tanzania: risk factors for infection in human and cattle populations. Tuberculosis 87(1), 30–43 (2007). 30 Tschopp R, Schelling E, Hattendorf J, Aseffa
A, Zinsstag J. Risk factors of bovine tuberculosis in cattle in rural livestock production systems of Ethiopia. Prev. Vet. Med. 89(3–4), 205–211 (2009).
www.futuremedicine.com
535
Molecular diagnosis of bovine tuberculosis in bovine and human samples: implications for zoonosis Md Masudur Rahman*,1,2, Monira Noor1, Kazi Mehetazul Islam1, Md Bashir Uddin1,3, Ferdaus Mohd Altaf Hossain1,4, Mohammad Ali Zinnah5, Mohammad Al Mamun1, Mohammad Rafiqul Islam6, Seong Kug Eo4 & Hossam M Ashour**,7,8 Abstract Aim: To develop emerging diagnostic technique for bovine tuberculosis and to identify its potential risk factors. Materials & methods: Bacterial genomic DNA was isolated from bovine milk and human sputum samples and subjected to PCR using specific primer pairs. PCR results were validated using bacteriological cultures. Results: PCR amplification of the targeted DNA fragment of Mycobacterium bovis was successful in 12.33% (37/300) of the bovine samples. Interestingly, 500-bp DNA fragment was also amplified in 6.67% (6/90) of the sputum indicating the possibility of zoonotic transmission. Rearing of livestock in household, unpasteurized milk consumption and smoking were identified as potential risk factors. Conclusion: Results of the study may add value to bovine tuberculosis eradication campaigns to achieve the One Health initiative. Bovine tuberculosis (bTB) is caused primarily by Mycobacterium bovis, a Gram-positive acid-fast bacterium that affects domestic and wild mammalians as well as humans [1–3] . According to WHO, bTB is a neglected, endemic zoonosis in many countries. In Bangladesh, there is little information on the prevalence of bTB in livestock animals. Moreover, all the prevalence studies were made relying on dermal tuberculin test which may not represent exact prevalence rate of the disease. According to available reports, prevalence rate of bTB in cattle, buffalos, sheep and goats in Bangladesh were 33.73, 6.12, 9.15 and 1.29%, respectively [4,5] . This zoonotic disease constitutes a significant economic burden to the agricultural industries in many countries including Bangladesh. Infection most commonly occurs through the consumption of contaminated, unpasteurized dairy products. Infection can also occur from direct contact with a wound during slaughter, or by inhaling the bacteria in air exhaled by animals infected with M. bovis [6,7] . Transmission to humans makes it a public health problem. This is particularly important given that zoonotic TB, caused by transmission of M. bovis to humans, is clinically identical to infections caused by Mycobacterium tuberculosis (typical TB). Most of the world’s population live in countries in which there is limited control of bovine tuberculosis [8] . Thus, there is consensus regarding risks to human health on a global scale. The control of bTB relies on test and slaughter policies and abattoir surveillance. In spite of
Keywords
• bovine tuberculosis • molecular diagnosis • zoonotic transmission
Faculty of Veterinary & Animal Science, Sylhet Agricultural University, Sylhet 3100, Bangladesh Veterinary Research Institute, Hudcova 70, Brno 621 00, Czech Republic 3 College of Veterinary Medicine, Chungnam National University, Daejeon, Republic of Korea 4 College of Veterinary Medicine & Bio-Safety Research Institute, Chonbuk National University, Jeonju 561–756, Republic of Korea 5 Faculty of Veterinary Medicine & Animal Science, Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, Bangladesh 6 Animal Health Research Division, Bangladesh Livestock Research Institute, Savar, Dhaka, Bangladesh 7 Department of Pharmacy Practice, Eugene Applebaum College of Pharmacy & Health Sciences, Wayne State University, Detroit, MI 48202, USA 8 Department of Microbiology & Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt *Author for correspondence: [email protected] **Author for correspondence: [email protected] 1 2
10.2217/FMB.14.139 © 2015 Future Medicine Ltd
Future Microbiol. (2015) 10(4), 527–535
part of
ISSN 1746-0913
527
Research Article Rahman, Noor, Islam et al. extensive eradication efforts in many countries, bTB continues to be a global problem [9] . Currently available methods for bTB diagnosis include tuberculin skin tests, bacteriologic culturing, histopathology, serological tests and molecular PCR-based techniques [10] . However, no single method is sufficient for detecting all bTB-infected cattle [8] . The tuberculin skin test using a purified protein derivative of M. bovis origin (bovPPD) is the OIE prescribed test for international trade [11] . However, confirmation of the diagnosis is achieved by culture and biochemical assays as cattle infected with Mycobacterium avium, M, tuberculosis, M. avium paratuberculosis, Nocardia farcinius or other mycobacteria can also be reactive to bovPPD, leading to falsepositive results. The microbiological culture is highly specific. However, a positive result is time consuming and is typically achieved after the sacrifice of the animal. Thus, it is necessary to develop new diagnostic methods that identify M. bovis directly in milk or blood, without the need for microbiological culture. This is expected to also improve the predictive value of the tuberculin test by confirming the tuberculin-positive cases. A PCR-based method targeting the highly conserved sequence of the microorganism can be applied successfully for the diagnosis of tuberculosis [12,13] . A rational approach for preventing bTB and human infection by M. bovis and reducing its negative economic impact involves identification of risk factors for human transmission and implementation of eradication programs. Little or no data are available on this. Therefore, the present study was designed to evaluate a PCR-based diagnostic test specific for M. bovis for testing bovine and human biological samples for bTB and to identify potential risk factors for its human transmission.
Materials & methods ●●Sample collection
Three hundred bovine milk samples were aseptically collected from apparently healthy cows at government farms (50 samples) and private dairy farms (150 samples) and from cows showing clinical sign of debilitated condition, cough, decreasing milk production and labored respiration at individual farms (100 samples). Government and private dairy farms are defined as farms in which more than 100 cows are reared in an organized way. Individual farms are defined as those farms in which farmers rear one to ten cows in a nonorganized way at their house premises. Approximately 10–20 ml milk samples were collected from each cow and immediately transferred to the laboratory for further processing. In addition to bovine samples, 90 sputum samples were collected from tuberculosis-positive human patients admitted at the TB Hospital, Sylhet 3100, Bangladesh for treatment. Tuberculosis was diagnosed by chest radiograph and direct smear positivity for acid-fast bacilli (AFB) of sputum samples as reported by the respective physician of the hospital. Patients were requested to submit early morning sputum sample in a 50 ml screw-cap centrifuge tube (BD Falcon™, Becton Dickinson, NJ, USA) before they started antibiotic treatment for TB. A summary of sample collection is depicted in Table 1. ●●Extraction of bacterial genomic DNA from
collected bovine & human samples
Bacterial genomic DNA was isolated from bovine milk samples using Milk Bacterial DNA Isolation Kit (Norgen Biotek Corp. ON, Canada) according to the manufacturer’s instruction. Viscous human sputum samples were liquefied and homogenized by adding
Table 1. Biological samples from cows and human patients. Sampling location
Sample type
Samples (n)
Government Dairy Farm, Sylhet Kabir Dairy Farm, Major Tila, Sylhet Home Fresh Dairy Farm, Boro Bari Baluchar, Sylhet Dream Dairy Farm, Al-Isla, Sylhet Provati Dairy Farm, West Sibgonj, Sylhet BLRI Dairy Farm, Savar, Dhaka Individual farmers from Zonaki Area, Sylhet
Bovine milk† Bovine milk Bovine milk Bovine milk Bovine milk Bovine milk Bovine milk Total bovine milk samples Human sputum‡
50 25 25 25 25 50 100 300
TB Hospital, Sylhet
90
Cows from government/private dairy farms were apparently healthy whereas cows from individual farms were clinically sick. ‡ Sputum samples were collected from tuberculosis-positive human patients. †
528
Future Microbiol. (2015) 10(4)
future science group
Molecular diagnosis of bovine tuberculosis in bovine & human samples dithiothreitol (DTT) to the sample at a final concentration of 50 μg/ml and heating at 37°C for 20 min prior to DNA isolation. Bacterial genomic DNA was isolated from completely homogenized sputum samples using Sputum DNA Isolation Kit (Norgen Biotek Corp.) following the manufacturer’s instruction. Bacterial genomic DNA was extracted from M. bovis pure culture kindly provided by Laboratory of Animal Health, Bangladesh Livestock Research Institute, Savar, Dhaka and used as template for positive control to validate our PCR results. After elution, DNA concentration and purity were determined using NanoDrop TM 2000c (Thermo Scientific, DE, USA). DNA samples were kept at -20°C until use for PCR amplification.
Research Article
for bTB at PCR assay were further processed for M. bovis isolation and identification as previously described [14] . Briefly, a volume of 5 ml of bovine milk or homogenized human sputum sample was decontaminated with 4% sodium hydroxide and then neutralized using concentrated hydrochloric acid. Suspensions were then centrifuged at 3000 ×g for 30 min and the sediment was inoculated onto LowensteinJensen and Coletsos media and incubated at 37°C for 8 weeks. M. bovis characterization was performed using the Ziehl-Neelsen staining, culture characteristics (growth rate, colony morphology) and standard biochemical tests (niacin production, nitrate reduction, catalase, aryl sulfatase activity, etc.) as recommended by the CDC, Atlanta, GA, USA, with appropriate control [15] .
●●PCR amplification
For PCR, a set of for ward ( JB21: TCGTCCGCTGATGCAAGTGC) and reverse ( JB22: CGTCCGCTGACCTCAAGAAAG) primers specific for M. bovis were designed as described previously [12,13] and primer annealing was checked using NCBI nucleotide BLAST software. The extracted bacterial DNA was subjected to the PCR amplification of the target sequence (500-bp) using specific primer pairs ( JB21 and JB22, Bioneer, Daedeok-gu, Daejeon, Republic of Korea) following previously described methods [13] with slight modification. The PCR reactions were performed in a final volume of 20 μl containing 1× reaction buffer (Promega, WI, USA), 2.5 U of Taq polymerase (Promega), 0.2 mM each deoxynucleoside triphosphate (dNTP), 1.5 mM magnesium chloride and 20 pmol of each primer. Target DNA was denatured by incubation for 10 min at 95°C before amplification for 30 cycles of 94°C for 1 min, annealing at 65°C for 1 min and extension at 72°C for 1 min followed by 72°C for 10 min (final extension) and holding at 4ºC until collection. All reactions were carried out in an automated thermal cycler (BioRad, CA, USA). Amplicons were subjected to 1.5% agarose gel electrophoresis and visualized with ethidium bromide by ultraviolet light using an image documentation system. ●●Isolation and identification of
M. bovis from bTB-positive samples by bacteriological culture & biochemical tests
To validate PCR assay, the samples (bovine milk and human sputum) that were positive
future science group
●●Risk factor analysis for bTB in human
& cattle
A questionnaire was developed including previously identified risk factors [16,17] . Interviewing data were collected from farm owners, individual farmers and tuberculosis-positive human patients while collecting biological samples. ●●Statistical analysis
Epidemiological data analysis was performed with the software package STATA 10.1 to identify the risk factors for bovine tuberculosis in human and cattle. Results ●●Identification of M. bovis from bovine milk
& human sputum samples
Milk samples collected from cows at different farming conditions were used for molecular diagnosis of bTB. Bacterial genomic DNA was extracted from the bovine milk samples followed by PCR amplification of target fragment (500 bp) using JB21 and JB22 primers specific for M. bovis. A DNA fragment of 500 bp was amplified from 37 milk samples out of 300 (12.33%) indicating bTB positivity (Figure 1 & Table 2) . To determine the possibility of zoonotic transmission of bTB to human, sputum samples from tuberculosis-positive human patients were evaluated by PCR using the same primer pair ( JB21 and JB22) specific for M. bovis. Interestingly, 500-bp DNA fragment was amplified (Figure 1 & Table 2) from six samples out of 90 (6.67%) indicating possible zoonotic transmission of bTB to humans. PCR data were
www.futuremedicine.com
529
Research Article Rahman, Noor, Islam et al.
M
S1
S2
P
N
M
500 bp
Figure 1. Ethidium bromide-stained 1.5% (w/v) agarose gel showing target amplicon of Mycobacterium bovis DNA amplified by PCR assay. Bacterial genomic DNA extracted from biological samples (suspected bovine milk and sputum of tuberculosis-positive human patients) were employed to amplify specific fragment of M. bovis DNA using specific primer pair. The arrow in agarose gel image indicates amplified specific DNA fragment (500 bp). Lanes M: size marker (100-bp ladder); S1: bovine milk sample; S2: human sputum from tuberculosispositive patient; P: positive control (bacterial DNA extracted from pure culture of M. bovis as template); N: Negative control (DNA-free water).
validated using bacteriologic culturing and biochemical tests. As shown in Table 2, M. bovis was isolated and identified from all samples (bovine milk and human sputum) that were positive for bTB by PCR assay. ●●Descriptive epidemiology of the risk
factors
A total of 300 bovine milk samples were collected, of which 200 samples were collected from apparently healthy cows of six different dairy farms (government and private) and 100 samples from cows of individual farmers showing clinical signs similar to bTB. bTB was not detected in cows of any government or private dairy farms. Conversely, bTB was detected in 37 cows of individual farmers (out of 100 cows). As bTB is a management-related disease, we studied different management factors. Good management practices were followed at all dairy farms in the study. However, at the farmers’ level, most farmers did not maintain good management practices, such as bio-security, balanced nutrition and proper ventilation (Table 3) . This is due to their lack of knowledge and due to poverty
530
Future Microbiol. (2015) 10(4)
conditions. We identified poor biosecurity and ill health due to poor nutrition as managementrelated risk factors for the outbreak of bTB at the farmers’ level (Table 3) . To determine bTB at the bovine–human interface and zoonotic transmission, we collected 90 sputum samples from tuberculosispositive human patients. These were subjected to molecular diagnosis of bTB by PCR using JB21 and JB22 primer pairs specific for the 500-bp fragment of M. bovis genome. Out of 90 tuberculosis-positive samples, six samples were positive for bTB. To determine the risk factors for the outbreak of tuberculosis and bTB in humans, we collected information from all 90 individual human patients admitted to the TB Hospital, Sylhet. This is summarized in Table 4. As shown in Table 4, people above 35 years old were more susceptible to tuberculosis and females were more frequently affected than males. Educational levels, rearing of livestock animals in household, consumption of unpasteurized milk, smoking and contact with TB patients were identified as major risk factors for tuberculosis in humans whereas rearing of livestock in household,
future science group
Molecular diagnosis of bovine tuberculosis in bovine & human samples consumption of unpasteurized milk and smoking were found to be risk factors for bTB in humans. Discussion Cases of human tuberculosis of bovine origin have long been reported causing severe negative impacts on public health and global economy [18–20] . In the present study, we diagnosed bTB directly in biological samples of bovine milk and human sputum using a PCR-based diagnostic assay targeting a unique 500-bp fragment of genomic DNA of the microorganism using JB21 and JB22 primers. We also identified risk factors of bTB that influence its possible zoonotic transmission in humans and cattle. ●●PCR-based diagnosis of bTB from
biological samples
We used a PCR-based diagnostic assay, in which we amplified a highly conserved 500-bp fragment [12,13] using JB21 and JB22 primers (Figure 1) . This is important for discrimination of M. bovis from M. avium, M. paratuberculosis or other related strains [21] . It is noteworthy that this sequence is also present in isolates from other mammals, such as sea lions and wild deer [22–24] . It is noteworthy that diagnosis was established with different methods and thus cannot be directly compared. ●●Prevalence of bovine tuberculosis in cattle
& humans
The prevalence of bTB in cattle (12.33%) was three- to fourfold higher than that reported by Boukary et al. in a study in Niger (3.6%) [17] but nearly threefold lower than that reported by Uddin et al. in Bangladesh [25] . The prevalence in cattle is influenced by the geographical situation of a country, temperature, precipitation, hygienic status of humans and animals and enforced regularity laws in Public Health and Veterinary Public Health sectors. False-positive reactions can sometimes influence the results of bovine tuberculin tests. We recorded a prevalence rate of 6.67% bTB in humans. This is consistent with previous findings [7] .
Research Article
●●Risk factors for bTB transmission in human
& cattle
We identified poor biosecurity and ill health due to poor nutrition as critical managementrelated risk factors of bTB infection in cattle at the farmers’ level. Previous research in Africa identified several environmental risk factors for transmission of bTB among animals, such as sharing water points, grazing or high promiscuity [26,27] . Several authors found a significant association between herd size and bTB infection among cattle and stated that as the herd size increased, there was a corresponding increase in the prevalence of bTB [17,28] . In this study, we detected bTB at individual farmers’ levels but not at organized dairy farms comprising herd size of 100–300 cattle. Strict biosecurity and proper quarantine practices were maintained at all the farms. Cleaveland et al. reported that cattle older than 10 years of age are at a higher risk of infection [29] . This might be due to the increased duration of exposure in older cattle [27,30] . We observed the same trend in our study. Moreover, we found that people above 35 years old were more susceptible to tuberculosis and females were more frequently affected than males. Educational levels, rearing of livestock animals in household, consumption of unpasteurized milk, smoking and contact with TB patient are major risk factors for tuberculosis in humans. On the other hand, rearing of livestock in household, consumption of unpasteurized milk and smoking are risk factors for bTB in humans. Raw milk consumption generally leads to more cases of human TB of animal origin [26] . Consumption of unpasteurized dairy products was a common practice among farmers in our study. Boukary et al. [17] reported that hygiene in households and consumption of raw milk are main determinants of M. bovis infection in humans. Others have drawn positive correlations between animal-to-human transmission of M. bovis and food habits or hygienic conditions in a population [28,29] .
Table 2. Validation of PCR assay by bacteriological culture and biochemical tests. Species
Sample type
Samples (n)
Bovine tuberculosis-positive samples Isolation of Mycobacterium bovis by PCR, n (% positive) by bacteriology†
Bovine Human
Milk Sputum
300 90
37 (12.33) 6 (6.67)
37 6
Bacteriology was performed only with the samples positive for bovine tuberculosis by PCR.
†
future science group
www.futuremedicine.com
531
Research Article Rahman, Noor, Islam et al. We analyzed possible risk factors for M. bovis infection in cattle and its transmission in humans using univariable analysis as the sample size and number of bTB-positive cases were less. Therefore, we could not precisely address how each of the individual risk factor interacts. A more comprehensive study including large cohorts of samples and multivariable analysis of the risk factors could gain an understanding on how each of the individual risk factor interacts, for example, how does sex and education interact with household livestock and contact with TB patients. Positive correlations between animal-to-human transmission of bTB could also be made. Conclusion In this study, a PCR-based diagnostic assay for bTB was evaluated and validated using bovine milk and human sputum samples which may be used as rapid and specific diagnosis of bTB in cattle and humans. Early detection of M. bovis by PCR could be useful either as an epidemiological tool for field trials in cattle or in human clinical follow-up programs, in order to establish the real magnitude of bovine tuberculosis. Positive molecular diagnosis of bovine tuberculosis in bovine and human samples in Bangladesh is alarming and calls for stricter measures to minimize risk factors for human transmission. Risk factors identified in this study can be useful in preventing zoonotic transmission of bTB at the cattle–human interface and can be implicated
in implementation of control and eradication programs against bTB. Future perspective Animal and human health is inextricably interwoven and food animals, especially cattle serve as a reservoir of diseases of public health importance. WHO considered bovine tuberculosis as one of the seven neglected zoonotic diseases having great potential to infect humans. There is increasing evidence that bovine tuberculosis caused by M. bovis infections may be much more significant than generally considered. Though the incidence of bovine tuberculosis in developed countries is greatly reduced following implementation of eradication programs involving test and slaughter policy and milk pasteurization, the current increasing incidence of tuberculosis in the human population has given rise to a renewed interest in the zoonotic importance of M. bovis, especially in developing countries, as humans and animals are sharing the same microenvironment and dwelling premises, especially in rural areas. The direct correlation between M. bovis infection in cattle and the disease incidence in humans has been well documented in developed countries, whereas scanty information on this issue is available from developing countries. On the international scene, several fora and institutions like the Food and Agricultural Organization (FAO), World Organization for Animal Health (OIE) and WHO have stressed on the need to prevent and control tuberculosis in both humans
Table 3. Risk factor analysis of bovine tuberculosis at the level of individual farms.
532
Risk factors
Categories
Bovine tuberculosis positive cases, n (% positive)
Farmer’s educational level Knowledge on biosecurity Herd size Age class Balanced nutrition Biosecurity Proper ventilation
No education Primary school Secondary school Moderate Poor No 1–5 animals 6–10 animals 3–6 years 7–10 years 11–19 years Yes No Poor Moderate Yes No
17 (17) 11 (11) 9 (9) 5 (5) 9 (9) 23(23) 21 (21) 16 (16) 6 (6) 9 (9) 22 (22) 8 (8) 29 (29) 30 (30) 7 (7) 17 (17) 20 (20)
Future Microbiol. (2015) 10(4)
future science group
Molecular diagnosis of bovine tuberculosis in bovine & human samples
Research Article
Table 4. Risk factor analysis in tuberculosis-positive human patients. Risk factors
Categories
Tuberculosis-positive cases, n (% positive)
Bovine tuberculosis-positive cases (n)
Sex Age class Unpasteurized milk consumption
Female Male 35 years Yes No Yes No No education Primary school No Yes No Yes
57 (63.33) 33 (36.67) 12 (13.33) 33 (36.67) 45 (50) 51 (56.67) 39 (43.33) 57 (66.33) 33 (36.67) 63 (70) 27 (30) 45(50) 45 (50) 60 (66.67) 30 (33.33)
3 3 0 2 4 6 0 6 0 4 2 6 0 3 3
Livestock in household Educational levels Smoking Contact with tuberculosis patients
and animals both in developed and developing countries. According to their recommendations, strong disease surveillance programs using improved diagnostic tools in cattle and humans should be considered a priority, especially in developing countries where risk factors are present. In this study, a PCR-based diagnostic assay is introduced for rapid and specific diagnosis of bTB from biological samples in cattle and humans. Some locally operative risk factors for zoonotic TB in Bangladesh have also been identified in this study which may help to determine persons at risk and to develop appropriate control measures against tuberculosis in developing countries. Stronger intersectoral collaboration between the medical and veterinary professionals is of spark importance to combat against zoonotic bTB. International cooperation in all aspects of zoonotic bTB is essential to fight against the disease. Acknowledgements The authors thank the farmers and organization who participated in the study for their cooperation and time. The authors extend their grateful thanks to Ivan Rychlik, Veterinary Research Institute, Brno, Czech Republic for his critical comments on manuscript preparation. The authors gratefully acknowledge the Director General of Bangladesh Livestock Research Institute, Savar, Dhaka, Bangladesh for his kind permission to execute the research work and to provide laboratory facilities.
Disclosure The handling of animals in the study was performed in accordance with current Bangladesh legislation (Cruelty to
future science group
Animals Act 1920, Act No. 1 of 1920 of the Government of the People’s Republic of Bangladesh). Experiments with human samples were approved by the Ethics Committee of the Bangladesh Livestock Research Institute, Savar, Dhaka, Bangladesh. Animal experiments were approved by the Sylhet Agricultural University Institutional Animal Care and Use Committee, Sylhet, Bangladesh. Written permission was received from individual cow owner to collect and use bovine milk samples in this study.
Financial & competing interests disclosure This study was performed under the project “Molecular diagnosis of tuberculosis from bovine samples and their interface for zoonotic transmission” funded by the University Grants Commission (UGC) of Bangladesh (UGC Research Grant No, 5921) through Sylhet Agricultural University Research System (SAURES), Government of the People’s Republic of Bangladesh. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed. No writing assistance was utilized in the production of this manuscript.
Ethical conduct of research The authors state that they have obtained appropriate institutional review board approval or have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. In addition, for investigations involving human subjects, informed consent has been obtained from the participants involved.
www.futuremedicine.com
533
Research Article Rahman, Noor, Islam et al. Executive summary Aim ●●
To develop a PCR-based diagnostic test specific for Mycobacterium bovis for testing bovine and human biological samples for bovine tuberculosis (bTB).
●●
To identify potential risk factors for transmission of bTB in humans.
Materials & methods ●●
Bacterial genomic DNA was isolated from bovine milk samples and sputum samples collected from TB-positive human patients.
●●
PCR targeting to the highly conserved 500-bp fragment of M. bovis was performed using specific primer pairs.
●●
PCR results were validated using bacteriological culture and biochemical tests.
●●
Data collection and risk factor analysis for bTB in human and cattle were performed.
Results & conclusions ●●
PCR amplification of the targeted 500-bp DNA fragment of M. bovis was successful in 12.33% (37/300) of the bovine samples.
●●
500-bp DNA fragment of M. bovis was also amplified in 6.67% (6/90) of the human sputum samples tested.
●●
M. bovis was isolated and identified from all PCR-positive samples in bacteriological culture and biochemical tests.
●●
Poor biosecurity and ill health due to poor nutrition were identified as management-related risk factors for the outbreak of bTB at the farmers’ level.
●●
Rearing of livestock in household, consumption of unpasteurized milk and smoking were identified as risk factors for bTB in humans.
●●
PCR-based diagnostic assay for bTB evaluated in this study on biological samples may be used for rapid and specific diagnosis of bTB in cattle and humans.
●●
Identified risk factors can be implicated in preventing zoonotic transmission of bTB at the cattle–human interface.
References
bovine and avian tuberculosis in sheep and goat population of Bangladesh. Sci. J. Microbiol. 2(1), 1–8 (2013).
Papers of special note have been highlighted as: • of interest; •• of considerable interest 1
2
3
4
5
534
Smith NH, Gordon SV, De La RuaDomenech R, Clifton-Hadley RS, Hewinson RG. Bottlenecks and broomsticks: the molecular evolution of Mycobacterium bovis. Nat. Rev. Microbiol. 4(9), 670–681 (2006).
6
7
Renwick AR, White PC, Bengis RG. Bovine tuberculosis in southern African wildlife: a multi-species host-pathogen system. Epidemiol. Infect. 135(4), 529–540 (2007). Oloya J, Opuda-Asibo J, Kazwala R et al. Mycobacteria causing human cervical lymphadenitis in pastoral communities in the Karamoja region of Uganda. Epidemiol. Infect. 136(5), 636–643 (2008). Hossain Ml, Khan Mfr, Nazir Khmnh, Rahman Mb. A cross sectional study on prevalence of bovine tuberculosis of buffaloes in Bangladesh. Microbes Health 1, 23–26 (2012). Rahman MM, Rahman KMF, Nazira NHKHM, Rahmana MB. Prevalence of
8
9
Ayele WY, Neill SD, Zinsstag J, Weiss MG, Pavlik I. Bovine tuberculosis: an old disease but a new threat to Africa. Int. J. Tuberc. Lung Dis. 8(8), 924–937 (2004). Wilkins MJ, Meyerson J, Bartlett PC et al. Human Mycobacterium bovis infection and bovine tuberculosis outbreak, Michigan, 1994–2007. Emerg. Infect. Dis. 14(4), 657–660 (2008). Vordermeier HM, Rhodes SG, Dean G et al. Cellular immune responses induced in cattle by heterologous prime-boost vaccination using recombinant viruses and bacille Calmette-Guerin. Immunology 112(3), 461–470 (2004). Schiller I, Oesch B, Vordermeier HM et al. Bovine tuberculosis: a review of current and emerging diagnostic techniques in view of their relevance for disease control and eradication. Transbound. Emerg. Dis. 57(4), 205–220 (2010).
Future Microbiol. (2015) 10(4)
•• An overview of current and emerging bovine tuberculosis (bTB) testing strategies/tools and their incorporation into the current control/eradication programs. 10 Medeiros Ldos S, Marassi CD, Figueiredo
EE, Lilenbaum W. Potential application of new diagnostic methods for controlling bovine tuberculosis in Brazil. Braz. J. Microbiol. 41(3), 531–541 (2010). 11 Cousins DV, Florisson N. A review of tests
available for use in the diagnosis of tuberculosis in non-bovine species. Rev. Sci. Tech. 24(3), 1039–1059 (2005). 12 Rodriguez JG, Mejia GA, Del Portillo P,
Patarroyo ME, Murillo LA. Species-specific identification of Mycobacterium bovis by PCR. Microbiology 141(Pt 9), 2131–2138 (1995). •
A fragment of approximately 500 bp was amplified from the genome of 15 different Mycobacterium bovis strains using random amplified polymorphic DNA.
13 Rodriguez JG, Fissanoti JC, Del Portillo P,
Patarroyo ME, Romano MI, Cataldi A.
future science group
Molecular diagnosis of bovine tuberculosis in bovine & human samples
•
Amplification of a 500-base-pair fragment from cultured isolates of Mycobacterium bovis. J. Clin. Microbiol. 37(7), 2330–2332 (1999).
18 Brett JL, Humble MW. Incidence of human
The presence of a 500-bp fragment that amplifies a region from the genome of M. bovis was evaluated by carrying out PCR on 121 M. bovis isolates.
19 De Kantor IN, Ritacco V. Bovine tuberculosis
14 Mishra A, Singhal A, Chauhan DS et al.
Direct detection and identification of Mycobacterium tuberculosis and Mycobacterium bovis in bovine samples by a novel nested PCR assay: correlation with conventional techniques. J. Clin. Microbiol. 43(11), 5670–5678 (2005). 15 Vestal AL. Procedures of isolation and
identification of mycobacteria. U.S. Department of Health, Education, and Welfare publication no. (CDC) 77–8230. Centers for Disease Control, GA, USA, 65–98 (1977). 16 Tschopp R, Bobosha K, Aseffa A et al. Bovine
tuberculosis at a cattle-small ruminanthuman interface in Meskan, Gurage region, Central Ethiopia. BMC Infect. Dis. 11, 318 (2011). •
Assessment of bTB prevalence at an intensive contact interface in cattle, small ruminants and suspected TB-lymphadenitis human patients.
17 Boukary AR, Thys E, Abatih E et al. Bovine
tuberculosis prevalence survey on cattle in the rural livestock system of Torodi (Niger). PloS ONE 6(9), e24629 (2011). •
Prevalence study of bTB infection in cattle and identification of risk factors for infection in human and cattle populations.
future science group
tuberculosis caused by Mycobacterium bovis. NZ Med. J. 104(904), 13–14 (1991). in Latin America and the Caribbean: current status, control and eradication programs. Vet. Microbiol. 40(1–2), 5–14 (1994). 20 Fanning A, Edwards S. Mycobacterium bovis
infection in human beings in contact with elk (Cervus elaphus) in Alberta, Canada. Lancet 338(8777), 1253–1255 (1991). 21 Bauerfeind R, Benazzi S, Weiss R, Schliesser
T, Willems H, Baljer G. Molecular characterization of Mycobacterium paratuberculosis isolates from sheep, goats, and cattle by hybridization with a DNA probe to insertion element IS900. J. Clin. Microbiol. 34(7), 1617–1621 (1996). •• Mycobactin J-dependent mycobacterial isolates from sheep, goat and cattle herds with Johne’s disease were tested for the repetitive insertion sequence IS900 of Mycobacterium paratuberculosis by PCR. 22 Bernardelli A, Bastida R, Loureiro J et al.
Tuberculosis in sea lions and fur seals from the south-western Atlantic coast. Rev. Sci. Tech. 15(3), 985–1005 (1996). 23 Cousins DV, Francis BR, Gow BL et al.
Tuberculosis in captive seals: bacteriological studies on an isolate belonging to the Mycobacterium tuberculosis complex. Res. Vet. Sci. 48(2), 196–200 (1990). 24 Romano MI, Alito A, Bigi F, Fisanotti JC,
Cataldi A. Genetic characterization of Mycobacteria from South American wild seals. Vet. Microbiol. 47(1–2), 89–98 (1995).
Research Article
25 Uddin Asmt AM, Khatun Mn, Mannan Ma,
Rahman Mm, Kabir Sml. Investigation of bovine tuberculosis in rangpur division of Bangladesh. J. Life Sci. Res. 1, 1–4 (2014). 26 Cosivi O, Grange JM, Daborn CJ et al.
Zoonotic tuberculosis due to Mycobacterium bovis in developing countries. Emerg. Infect. Dis. 4(1), 59–70 (1998). •• Review on information on zoonotic TB in developing countries, risk factor analysis and recommendation to assess the magnitude of the problem and control the disease in humans and animals. 27 Humblet MF, Boschiroli ML, Saegerman C.
Classification of worldwide bovine tuberculosis risk factors in cattle: a stratified approach. Vet. Res. 40(5), 50 (2009). •• Recommendations suggested to animal health professionals and scientists directly involved in the control and prevention of bTB in cattle. 28 Ameni G, Erkihun A. Bovine tuberculosis on
small-scale dairy farms in Adama Town, central Ethiopia, and farmer awareness of the disease. Rev. Sci. Tech. 26(3), 711–719 (2007). 29 Cleaveland S, Shaw DJ, Mfinanga SG et al.
Mycobacterium bovis in rural Tanzania: risk factors for infection in human and cattle populations. Tuberculosis 87(1), 30–43 (2007). 30 Tschopp R, Schelling E, Hattendorf J, Aseffa
A, Zinsstag J. Risk factors of bovine tuberculosis in cattle in rural livestock production systems of Ethiopia. Prev. Vet. Med. 89(3–4), 205–211 (2009).
www.futuremedicine.com
535
