Neuron,

Vol. 8. 891-897,

May,

1992, Copyright

0 1992 by Cell Press

Mutations in an S4 Segment of the Adult Skeletal Muscle Sodium Channel Cause Paramyotonia Congenita Louis j. Ptafek,*+ Alfred 1. George, Jr.,§iI Robert L. Barchi,§# Robert C. Criggs,** Jack E. Riggs,++ Margaret Robertson,+* and Mark F. Leppert+* *Department of Neurology +Department of Human Genetics *Howard Hughes Medical Institute University of Utah Health Sciences Center Salt Lake City, Utah 84132 §David Mahoney Institute of Neurological Sciences IlDepartment of Medicine #Department of Neurology University of Pennsylvania School of Medicine Philadelphia, Pennsylvania 19104 **Department of Neurology University of Rochester School of Medicine Rochester, New York 14642 ++Department of Neurology West Virginia University School of Medicine Morgantown, West Virginia 26506

The periodic paralyses are a group of autosomal dominant muscle diseases sharing a common feature of episodic paralysis. In one form, paramyotonia congenita (PC), the paralysis usually occurs with muscle cooling. Electrophysiologic studies of muscle from PC patients have revealed temperature-dependent alterations in sodium channel (NaCh) function. This observation led to demonstration of genetic linkage of a skeletal muscle NaCh gene to a PC disease allele. We now report the use of the single-strand conformation polymorphism technique to define alleles specific to PC patients from three families. Sequencing of these alleles defined base pair changes within the same codon, which resulted in two distinct amino acid substitutions for a highly conserved arginine residue in the S4 helix of domain 4 in the adult skeletal muscle NaCh. These data establish the chromosome 17q NaCh locus as the PC gene and represent two mutations causing the distinctive, temperature-sensitive PC phenotype. Introduction The periodic paralyses are a group of neuromuscular diseases with overlapping clinical and electrophysiological features and include hyperkalemic periodic paralysis (HYPP), hypokalemic periodic paralysis, and paramyotonia congenita (PC). Patients with these disorders share the common feature of episodic weakness. Some of these patients also demonstrate clinical and electrophysiological myotonia, a form of abnormal electrical activity consisting of repetitive action potentials on electromyography associated with delayed relaxation of muscle (Riggs and Griggs, 1979).

Attacks

of paralysis

and

myotonia

may

occur

sponta-

neously or may be precipitated by factors including exercise, alterations of extracellular potassium levels, and muscle cooling. The particular precipitants of attacks in patients are often useful in classifying such individuals clinically. For example, HYPP is one type in which potassium loading can precipitate attacks. Serum potassium levels may be normal or elevated during an attack, thus distinguishing such patients from those with hypokalemic periodic paralysis. PC is an autosomal dominant myotonic disorder characterized by cold-induced, prolonged, localized muscle contraction and weakness (Riggs and Griggs, 1979). Muscle activity aggravates the myotonia associated with PC (paradoxical myotonia), in contrast to the usual improvement with exercise seen in most myotonic disorders (classical myotonia). Most patientswithPCdemonstratesomedegreeofworsening of myotonia with potassium loading. Patients with PC may experience episodes of generalized weakness (periodic paralysis) unassociated with cold exposure. In the “pure” form of PC, these attacks of weakness areassociated with normo-or hypokalemia. However, there are patients with otherwise typical PC in whom attacks of generalized weakness can be precipitated by potassium loading (Riggs, 1988). Electrophysiological investigation of HYPP and PC muscle in vitro has demonstrated alteration of muscle membrane sodium conductance (Lehmann-Horn et al., 1981, 1987a, 1987b; Rude1 et al., 1989), suggesting that the molecular alteration may reside in a skeletal muscle sodium channel (NaCh) gene. This was supported by genetic linkage of SCN4A, the gene encoding the adult isoform of the NaCh a subunit, to HYPP (Fontaine et al., 1990; Pt%ek et al., 1991a; Ebers et al., 1991; Koch et al., 1991a) and PC (PtaEek et al., 1991b; Ebers et al., 1991; Koch et al., 1991b). An interesting potassium-sensitiveformof myotoniacongenitawithout periodic paralysis is also genetically linked to this locus (PtaEek et al., 1992). Identification of twodistinct mutations in SCN4A from HYPP patient DNA established SCN4A as the HYPP gene (Ptacek et al., 1991~; Rojas et al., 1991). The unique features of PC suggest that one or more mutations in SCNM, different from those causing HYPP, might be responsible for the disorder. Furthermore, identification of mutations in DNA from PC patients is required to demonstrate that SCN4A is the PC gene rather than a closely linked marker for another chromosome 17q gene. We therefore undertook a search for mutations in the human gene (SCN4A) that encodes the tetrodotoxin-sensitive adult skeletal muscle NaCh isoform (hSkM?), using singlestrand conformation polymorphism (SSCP) analysis (Orita et al., 1989a, 1989b) in an attempt to demonstrate that PC results from molecular alterations in this protein. SSCP analysis identifies most single or

Neuron

892

Exon

N-2

Exon N-l I

N3.f +

N-2., 4-

Exon N&f

+ N-l.‘

++ N-l I

N

Na.r +* Nb.,

4Nb.r

Na.f

5'

AGCGTCCTCACTAGCTTCTC

3'

Na.r

5'

ATGCCCGACTCCTTCTTGAC

3'

Nb.f

5'

CCTCCTCCTCCTCCTGGTCAT

3'

Nb.r

5'

GGGCTCGCTGCTCTCCTCTGT

3'

N-1.f

5'

CAACTCCTCCACATCCACTCC

3'

N-1.r

5'

GGTGCAGGGGCAGGTGTGTCC

3'

N-2.f

5'

TGGAGGCAGGAAGGGGAACT

3'

N-2.r

5'

GGCAGCACACACAGGACAGG

3'

Figure

1. SSCP Prtmers

PCR amplification of the three most 3’ exons of SCN4A was performed with four primer pairs. Na.f/Na.r and Nb.f/Nb.r were designed to allow amplification of the sequence of exon N that encodes S4-S6 of M&Ml domain 4; N-l.f/N-1.r and N-2.f/N-2.r were used to amplify D4iSl-S3 and the 3-4 interdomain, respectively. The sequence of these primers and their relationship to exons N-2, N-l, and N are shown.

multiple base changes in DNA fragments up to 400 bases in length (Orita et al., 1989a, 1989b). Sequence alterations are detected as shifts in electrophoretic mobility of single-strand DNA on nondenaturing acrylamide gels; the two complementary strands of a DNA segment usually resolve as two SSCP conformers of distinct mobilities. Base pair change variants are identified by differences in pattern among the DNAs of the sample set. SSCP has proven useful in the analysis of other disease-causing mutations, such as cystic fibrosis, neurofibromatosis type 1, familial polyposis, and HYPP, in which DNA sequence variations have been characterized successfully at the level of single base substitutions (Dean et al., 1990; Cawthon et al., 1990; Groden et al., 1991; Ptacek et al., 1991c). Results Evaluation of Patients PC patients in kindred 1637 have been reported previously (Rich, 1894; Ptdcek et al., 1991b). The affected individuals in this family have spontaneous episodic attacks of quadriparesis and myotonia that is provoked by muscle cooling. No potassium sensitivity has been reported by these patients, but formal potassium challenge has never been performed. Patients from kindred 1800 have been reported elsewhere (Riggs et al., 1977) and have similar cold-induced myotonia and attacks of periodic paralysis. Potassium loading in oneof these patients resulted in worsening of the myotonia but improvement of strength. Patients in kindred 1984 also have the pure form of PC with periodic paralysis and myotonia that is provoked by cooling. The patient whose DNA we studied has undergone a potassium challenge, which resulted in severe, generalized muscle stiffness and pain, a slight increase in myotonia, but no change in strength (Griggs, 1978). Partial Cenomic Organization of SCN4A Intron-exon boundaries in SCN4A were

determined

by sequencing genomic clone hlO.l (George et al., 1992a) with oligonucleotide primers designed from the cDNA sequence of hSkM7 (George et al., 1992b). Twelve exons encompassing codons 615-1837 and ranging in size from 54-2248 bp were defined in a region of approximately 20 kb. Three exons (enumerated in a 3’ to 5’ direction as N, 2248 bp; N-l, 270 bp; and N-2, 104 bp) contain the coding sequence corresponding to the carboxyl terminus, domain 4, and the interdomain 3-4 region. Four pairs of oligonucleotide primers (Figure 1) were designed for use in amplifying regions of these exons that encode domain 4 and the 3-4 interdomain. Identification of Nucleotide Alterations in PC Patient DNA The very high degree of conservation of DNA and amino acid sequence in the membrane-spanning segments of the NaCh and the presence of HYPP mutations in these regions led us toconcentrateour search for PC mutations in the repeat domains. Patients from all three PC families demonstrated aberrant conformers (Figure 2) when investigated with SSCP analysis with primer set Na.f/Na.r. No abnormalities were noted with SSCP using the remaining three primer sets (data not shown). The pattern of aberrant banding appeared similar in all three families studied, thus suggesting that all three families might have the same mutation. Alternatively, different mutations may yield the same aberrant bands if they alter the electrophoretie mobility similarly. The aberrant pattern seen in the three PC patients was not seen in the DNA of 106 unrelated, normal individuals whose DNA was evaluated by SSCP. Transmission of Disease Allele in PC Families The aberrant banding pattern was shown to cosegregate with the disease allele in kindreds 1637 and 1800. The aberrant conformers were present in all affected individuals in these families and in none of the unaffected family members (Figures 2a and 2b). DNA was

Paramyotonia 893

Congenita

Mutations

a. Kindred 1637

Figure

b. Kindred 1800

2. SSCP Conformers

from

the SCN4A

Gene

Specific

c. Kindred 1984

to PC Patients

The sequence corresponding to nt 43664615 of hSkM7 (George et al., 1992b) was PCR amplified with primers Na.f and Na.r. Each lane on the SSCP autoradiograph corresponds to the individual in the pedigree above. Open symbols represent unaffected individuals, while closed symbols represent affected people. The abnormal bands that were sequenced are denoted by the arrows. (a) Unique conformers occur in affected individuals from kindred 1637 but not in unaffected family members. (b) Unique conformers in kindred 1800 cosegregate with the disease allele. (c) Patient sample 13688 from kindred 1984demonstrates the abnormal conformers migrating at the same position. The following controls are included on this autoradiogram: A, HYPP patient #10263, kindred 1590; B, PC patient #13195, kindred 1800; and C, HYPP patient #13371, kindred 1891.

available for only one individual from kindred 1984 (patient #1368&T) and demonstrated the same abnormality (Figure 2~). Cosegregation of the aberrant pattern in these families supports the idea that the alterations resulting in SSCP mobility shifts are PC mutations. Aberrant bands must be sequenced to demonstrate molecular alterations responsible for

a.

Normal

b. Kindred

Figure

conformer

c. Kindred

1637 #I2088 *--pm GTTCTOTOT

d. Kindred

3. Sequences

of SSCP Aberrant

1800

#13195

1984 #I 3688 * OTTCClTGT

Bands

Sequence from the region corresponding to nt 4415-4423 (George et al., 1992b) of hSkM7 is shown. Altered nucleotides are indicated by an asterisk. Sequence of the sense strand is shown for (a) normal conformer, (b) patient Wl2088, kindred 1637, (c) patient #13195, kindred 1800, and (d) patient #13688, kindred 1984. Sequencing of the antisense strands yielded consistent results (data not shown).

mobility shifts. tions must be temperature-sensitive in vitro,

Ultimately, performed

expression to determine phenotype can

of such mutawhether the be reproduced

DNA Sequence of SSCP Conformers DNA eluted from the SSCP bands was sequenced and revealed three different patterns. The first (Figure 3a) corresponds to the normal hSkM7 sequence. The second (Figure 3b), present in patient #I2088 from kindred 1637, demonstrates a C to T transition at position 4419 of hSkM1 (George et al., 199213). When read in frame, this represents a first position change resulting in substitution of an arginine by a cysteine residue. The third pattern (Figures 3c and 3d), in patient #I3195 from kindred 1800 and patient #I3688 from kindred 1984, revealed a G to A transition at position 4420 of hSkM7 (George et al., 1992b). When read in frame, this second position change leads to substitution of the same arginine residue by a histidine. The normal hSkMl and mutant DNA sequence in the region of the mutations are aligned in Figure 4. These alterations occur in the same codon encoding a highly conserved arginine residue in the fourth putative membranespanning segment (S4) of domain 4 (Figure 5). These nucleotide substitutions occurred within the context of a CpG dimer. The majority of methylation in human DNA occurs on the cytosine in CpG dimer sequences; this interferes with efficient correction of C to T transitions resulting from 5-methyl cytosine deamination. These sites are, therefore, potential hot spots for mutation in either strand (Barker et al., 1984). One of the two mutations already described in HYPP demonstrated a C toT transition (PtaCek et al., 1991c).

Figure hSkM7

4. Alignment of DNA and PC Mutants

Sequence

(bp4410-4430)

of Normal

Mutation PC 1 occurs in kindred 1637, and mutation PC 2 was found in kindreds 1800 and 1984. The CGT codon encoding the arginine at position 1448 in the normal sequence, along with the two mutant codons, is enclosed by the rectangle. In PC 1, a C to T transition was found in the first position of this codon, thus encoding a cysteine residue. In PC 2, a G to A transition is noted at the second position of this codon, thus encoding a histidine residue.

Discussion PC is a rare hereditary disease characterized by autosomal dominant transmission, myotonia that is accentuated by exposure to cold and worsened by exercise, and attacks of muscular weakness or flaccid paralysis that are induced by muscle cooling (Riggs and Griggs, 1979). Although often considered as a distinct clinical entity separate from the HYPPs, PC is now known to be one of a variety of related clinical syndromes including HYPP that are caused by structural lesions in the adult skeletal muscle voltagedependent NaCh. Voltage-dependent NaChs are intrinsic membrane proteins that consist of a single large polypeptidewith a molecular weight of -260,000, containing 1800-2000 aa and 25%-30% complex carbohydrate by weight. Within this large protein are four regions of internal homology, each encompassing 225-325 aa. Analysis of these repeat domains identifies at least six potential transmembrane helices at conserved locations in each domain. The most striking of these is the S4 helix, which contains a repeating (x-x-Arg/Lys) motif that results in the presence of a positively charged amino acid at every third position. This helix is thought to play a central role in voltage-dependent channel activation. While voltage-dependent NaChs from all species share a common architecture, there are multiple forms of NaChs that can be expressed in different tissues of a single species, or even at the same time within the same tissue (Barchi, 1987). These isoforms differ predominantly in the sequence of their amino and carboxyl termini and in the regions linking the internal repeat domains. At least six NaCh isoforms have been characterized in rat (Noda et al., 1986; Kayano et al., 1988; Trimmer et al., 1989; Rogart et al., 1989; Kallen et al., 1990), and the NaCh isoform expressed in human adult skeletal muscle (hSkM7) has recently been cloned and sequenced (George et al., 1992b). This channel isoform is the product of the SCN4A gene (George et al., 1991). In PC, cooling of skeletal muscle leads first to hyperexcitability and then, in some cases, to paralysis. In vitro, skeletal muscle from PC patients iselectrophysiologically normal at 37°C but depolarizes and be-

;‘ ;, .

Figure

5. NaCh

Model

with

Mutations

The channel consists of four homologous domains, each with six membrane-spanning segments. The portion of channel consisting of segments 3-5 in domain 4 is enlarged in the Inset to show the normal amino acid sequence in this region. .Arginine 1448 is shown in black along with the two substitutions at this location produced by the mutations reported here.

comes electrically unexcitable when the temperature is lowered to 27OC (Lehmann-Horn et al., 1987b). This depolarization is associated with the appearance of an abnormally large membrane conductance to sodium ions that can be blocked by tetrodotoxin and presumably involves voltage-dependent NaChs. Support for a roleof NaChs in the pathogenesisof this disease has recently been provided by genetic analyses in which tight linkage was demonstrated between the expression of the PC phenotype in affected families and the presence of characteristic restriction fragment length polymorphisms at the adult skeletal muscle NaCh gene locus (Ptatek et al., 1991b; Ebers et al., 1991). We now confirm this role by documenting specific mutations that occur in the NaCh gene SCN4A in PC patient DNA. The occurrence of nucleotide sequence alterations in the adult skeletal muscle NaCh that cosegregate with the PC phenotype in three unrelated families and the absence of these abnormalities in 106 unrelated normal individuals argue that mutations in hSkM7 are the molecular basis for this syndrome in these families. Both of the abnormalities described here result in similar SSCP mobility shifts. They both occur in the codon encoding arginine 1448, a residue that lies

Paramyotonia 895

Congenita

PC Mutation PC Mutation HSkMl Human

1 2

cardiac

Ra:

Skeletal

Rat

Brain

Rat Brain Rat Bra111 Electroplax Drosophila

NaCh

muscle Type I Type 2 Type 3 Eel Para Locus

Mutations

qKYFVSPTLF L-L TRTARTGR qKYFVSPTL F Ih IVIRLARIGR qKYFVSPTLF R IRLARIGR qKYFfSPTLF R IRLARIGR qKYFVSPTLF R IRLARIGR eKYF"SPTLF R IRLARIGR eKYFVSPTLF R IRLARIGR eKYFVSPTLF R IRLARIGR eKYFVSPTLF R IRLARIaR eKYFVSPTL1 R r vRvAkvGR

l -

vr.RLIrGAKG VL~%LIrGAKG vLRLIrGAKG iLRLIrGAKG vLRLIrGAKG iLRLIkGAKG iLRLIkGAKG iLRLIkGAKG "LRLIraAKG "LRLvkGAKG

IRTLLFALMM IRTLLFALMM IRTLLFALMM IRTLLFALMM IRTLLFALMM IRTLLFALMM IRTLLFALMM IRTLLFALMM IRTLLFALMM IRTLLFALaM

m/s4 -

within the S4 segment of hSkM1 domain 4. This residue is absolutely conserved in all known NaCh sequences across highly divergent species (Figure 6). The mutations replace this arginine residue with either cysteine or histidine and therefore neutralize this highly conserved S4 positive charge (the charge on histidine [pKa = 61 will be dependent on its local environment, but is not likely to have a strong positive charge). The location of the two PC NaCh mutations is distinct from the two reported HYPP mutations (PtZek et al., 1991c; Rojas et al., 1991), and this molecular heterogeneity is likely to be responsible for differences in the clinical presentation of these two syndromes. The two hSkM1 mutations described in this paper probably do not account for all cases of PC, since we have been unable to detect the same SSCP abnormality in three other families with the same disease phenotype (unpublished data). Although the exact functional consequences of neutralizing arginine 1448 in hSkM7 can only be revealed by a detailed electrophysiologic study of the mutant channel itself, some insight can be gained from studies of the effects of S4 segment mutations in other voltage-dependent sodium and potassium channels. Site-directed mutagenesis experiments involving the S4 segment of the rat brain II NaCh and the Shaker B potassium channel support the hypothesis that this segment does act as the voltage sensor in the biophysical mechanism of activation (Stuhmer et al., 1989; Papazian et al., 1991). Substitution of a neutral amino acid for individual positively charged residuesinS4ofdomainsland2oftheratbrain Ilchannel decreases the steepness of the voltage dependence of activation and shifts the midpoint of the activation curve along the voltage axis (Stuhmer et al., 1989). Mutations neutralizing charges in the Shaker potassium channel S4 have a less predictable effect, but also shift both the slope of the activation curve and the location of the curve on the voltage axis. In addition, S4 mutations in the Shaker potassium channel indicate coupling between channel activation and inactivation. A characteristic of the PC phenotype is the presence of both cold-induced myotonia and intermittent weakness, suggesting that a single mutation near the amino terminus of the S4 helix of domain 4can, under different physiological circumstances, lead to either repetitive NaCh activation or failure of activation and

Figure 6. Alignment of NaCh Amino Acid Sequences from Various Species Showing High Degree of Amino Acid Homology Highly conserved residues are denoted by capital letters; nonconserved amino acids are represented by lower case letters. The amino acid position where the substitution occurs is enclosed in the rectangle. The normal residue for the eieht normal channels listed is arainine. This arainine is replaced by a cyst;ine in PC 1 a& by a histidine in PC 2.

paralysis. Although repetitive activity could result from a shift in the voltage dependence either of activation to more negative potentials or of inactivation to more positive potentials, the persistent sodium currents reported in electrophysiological recordings from PC muscle (Lehmann-Horn et al., 1987b) suggest that channel inactivation may be the process that is primarily affected. It has been shown that failure of NaCh inactivation, even in a small percentage of the channel population, can lead to membrane depolarization, inactivation of the other normal NaChs, and muscle paralysis (Cannon et al., 1991). Given the effects of S4 mutations in Shaker, it is also possible that the mutations described here could affect both inactivation and activation. However, sincethese mutations insert different amino acids than the substitution studied at the comparable location in Shaker, this point can only be resolved through the study of the mutated PC channel expressed in vitro. The temperature sensitivity of symptoms is an interesting aspect of the PC phenotype, and we can speculate as to how this relates to NaCh defects. Structural changes due to the mutations reported here might alter the relative energy levels of various conformations associated with different NaCh gating modes. If the factors stabilizing such states differ in their entropic contributions between mutant and wild-type channels, changes in temperature may differentially affect the preferred channel conformation in each case, and lower temperatures might serve to stabilize the mutant channel in a state associated with an abnormal gating mode. This might be anticipated if, for example, hydrophobic interactions play a prominent role in stabilizing a particular conformation. Alternatively, the mutations may render the channel abnormally sensitive to other cellular processes that are themselves temperature sensitive, such as phosphorylation or G protein interaction. Ultimately, the correlation between the mutations described here and the pathophysiology of excitation in PC will require the expression and analysis of human skeletal muscle NaChs in which this mutation has been introduced. Experimental

Procedures

Identification of PC Patients PC patients with well-documented disease were identified through the Muscular Dystrophy Association clinics at the University of Utah, the University of Rochester, and the University

Neuron 896

of West Virginia. Each patient was examined by one of the authors (L. J. P., R. C. G., and J. E. R.). All family members, including unaffected individuals and spouses, were examined whenever possible. All human tissue samples used in this project were obtained with the approval of the Institutional Review Board at the University of Utah Health Sciences Center. Tissue Culture Epstein-Barr virus was used to transform lymphocytes from normal and PC individuals. These lymphoblastoid cell lines then were cultured at 37OC, 5% CO2 in RPMI 1640 medium (Cellgroi Mediatech) containing 1% Nutridoma (Boehringer Mannheim), 5% fetal bovine serum (Hyclone), and 50 Ulmlgentamicin sulfate. Patient DNA was obtained directly from peripheral blood by phenol-chloroform extraction. PCR Amplification DNA samples were amplified for SSCP analysis using the polymerase chain reaction (PCR) (3 min at 94OC, 1 time; 1 min at 94OC, 1 min at annealing temperature, 1 min at 72OC, 30 times). The annealing temperature for each reaction was bT-8°C below the T, for the primers. The reaction mixture was made up of the following: 200 ng of DNA, 0.5 uM of each primer, 70 uM of each deoxynucleoside triphosphate, 10 mM Tris (pH 8.3), 50 mM KCI, 1.5 mM MgCI,, 0.01% gelatin, 0.25 U of Taq polymerase, and 0.1 ul of [a-32P]dCTP (3000 Cilml) in a volume of 10 ~1. SSCP Gel Analysis PCR products were diluted in 50 ul of a mixture containing 0.1% SDSandlOmM EDTA. Fivemicrolitersofthismixturewasfurther diluted with 6 ul of running buffer (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, 0.05% xylene cyanol). Products were denatured at 94OC for 3 min and kept on ice until 3 ul of each sample was loaded onto 5% polyacrylamidegels. Twoconditions were run for each set of reactions: a 90 mM Tris-borate (pH 7.5), 2 mM EDTA gel at 4OC and a 90 mM Tris-borate (pH 7.5), 2 mM EDTA, 10% glycerol gel at room temperature. Electrophoresis was carried out for both conditions at a constant power of 40 W. After electrophoresis, gels were transferred to Whatmann 3MM paper and dried on vacuum slab dryers. Autoradiography with Kodak X-Omat AR film was performed with intensifying screens for 24-36 hr. Sequencing of SSCP Conformers Individual SSCP bands were cut directly from the dried gels, placed in 100 ul of distilled water, shaken for 30 min at room temperature, and centrifuged briefly. A 10 ul aliquot of this supernatant was used for PCR amplification with primers 5’upNa.f 3’ and 5’rpNa.r 3’ (up- and rp- represent the -2lM13 universal and reverse primer sequences, respectively). Reaction mixture was as follows: 0.5 uM of each primer, 10 mM Tris (pH 8.3), 50 mM KCI, 1.5 mM MgCb, 0.01% gelatin, 2.5 nmol of dNTP mixture. Samples were vortexed, spun down, placed on ice, and overlayered with mineral oil. Two units of Taq polymerase were added to each reaction. Reactions were placed in a preheated DNA thermal cycler at 94OC and run with the following parameters: 94OC, 1 min; 55OC, 1 min; 72OC, 1 min (30 times). Amplified products were resolved on 4% agarose gels (Maniatis et al., 1982) and isolated from the gel with Geneclean (Bio 101, La Jolla, CA). These products were sequenced using the dideoxy termination method (Sanger et al., 1977), with fluorescently tagged Ml3 universal or reverse sequencing primers on an applied Biosystems model 373A DNA sequencer (Applied Biosystems, Foster City, CA). Acknowledgments Theauthors aregrateful to the families who participated in these studies and to Sharon Austin, Nancy Chaney, Keith Johnson, Edward Meenen, Diane Storvick, and Minalee Woodward for technical assistance. The authors appreciate helpful discussions with Barry Ganetzky, Mark Keating, Jack Petajan, Andrew Thliveris, and Ray White. This investigation was supported by Na-

tional Institutes of Health grants 1 Kll HD00940-01 (to L. J. P.). NS-18013 (to R. L. B.), and AR-01862 (to A. L. C.); by Public Health Service research grants MOI-RR00064 (University of Utah) and MOI-RR0004 (University of Rochester) from the National Center for Research Resources; by the Howard Hughes Medical Institute; by the Utah Technology Access Center (NIH grant 8 RO’I HG00367 from the Center for Human Genome Research); and by grants from the Muscular Dystrophy Association (to L. J. P. and R. L. B.) and the PEW Charitable Trust (R. L. B.). A. L. C. is a Lucille P. Markey Scholar, and this work was supported in part by a grant from the Lucille P. Markey Charitable Trust. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received

January

13, 1992; revrsed

February

20, 1992.

References Barchi, R. L. (1987). Sodium channel diversity: subtle on a complex theme. Trends Neurosci. 70, 221-223.

variations

Barker, D., Schafer, M., and White, R. (1984). Restriction containing CpC show a higher frequency of polymorphism human DNA. Cell 36, 131-138. Cannon, channel induced

S. C., Brown, R. H.,Jr., defect in hyperkalemic failure of inactivation.

sites in

and Corey, D. P. (1991). A sodium periodic paralysis: potassiumNeuron 6, 619-626.

Cawthon, R. M., Weiss, R., Xu, C., Viskochil, D., Culver, M., Stevens, J., Robertson, M., Dunn, D., Cesteland, R., O’Connell, P., and White, R. (1990). A major segment of the neurofibromatosis type 1 gene: cDNA sequence, genomic structure, and point mutations. Cell 62, 193-201. Dean, M., White, M. B., Amos, J., Gerrard, B., Stewart, C., Khaw, K.-T., and Leppert, M. (1990). Multiple mutations in highly conserved residues are found in mildly affected cystic fibrosis patients Cell 61, 863-870. Ebers, G. C., George, A. L., Barchi, Kallen, R. G., Lathrop,C.M.,Beckmann, W. F., Campbell, R. D., and Hudson, congenita and hyperkalemic periodic adult muscle sodium channel gene.

R. L., Ting-Passador, 5. S., J. S., Hahn,A. F., Brown, A. J. (1991). Paramyotonia paralysis are linked to the Ann. Neural. 30, 810-816.

Fontaine, B., Khurana, T. S., Hoffman, E. P., Bruns, C.. Harries. J, L., Trofatter, J. A., Hanson, M. P., Rich, J., McFarlane, H.. Yasek, D. M., Romano, D., Gusella, J., and Brown, R. (1990). Hyperkalemic periodic paralysis and the adult muscle sodium channel gene. Science 250, 1000-1002. George, A. L., Ledbetter, D. H., Kallen, R. G., and Barchr, R. L. (1991). Assignment of a human skeletal muscle sodium channel alpha subunit gene (SCMA) to 17q23.1-25.3. Cenomics 9, 555556. George, structure skeletal

A. L., Kallen, R. G., and Barchi, and partial genomic organization muscle sodium channel. Biophys.

R. L. (1992a). Primary of the adult human J. 61, A108.

George,A. L., Komrsarof, J., Kallen, R. C., and Barchr, R. L. (1992b). Primary structure of the adult human skeletal muscle voltagedependent Nat channel. Ann. Neural. 37, 131-137. Criggs, Effects

R. C., Moxley, of acetarolamide

R. T., Riggs, J. E., and Engel, W. K. (1978). on myotonia. Ann. Neural. 3, 531-537.

Groden, J., Thliveris, A., Samowitz, W., Carlson, M., Celbert, L., Albertsen, H., Joslyn, G., Stevens, J., Spirio, L., Robertson, M., Sargeant, L., Krapcho, K., Wolff, E., Burt, R., Hughes, J. P., Warrington, J., McPherson, J., Wasmuth, J., Le Paslrer, D., Abderrahim, H., Cohen, D., Leppert, M., and White, R. (1991). Identification and characterization of the familial adenomatous polyposis coli gene. Cell 66, 589-600. Kallen, R. G., Sheng, 7. H., Yang, J., Chen, L., Rogart, R. B., and Barchi, R. L. (1990). Primary structure and expression of a sodium channel characteristic of denervated and immature rat skeletal muscle. Neuron 4. 233-242.

Paramyotonia 097

Congenita

Mutations

Kayano, T., Noda, M., Flockerzi, V., Takahashi, H., and Numa, S. (1988). Primary structureof rat brain sodium channel III deduced from the cDNA sequence. FEBS Lett. 228, 187-194. Koch, M. Rudel, R., F. (1991a). ralysis to

C., Ricker, K., Otto, M., Grimm, T., Hoffman, E. P., Bender, K., 2011, B., Harper, P. S., and Lehmann-Horn, Confirmation of linkage of hyperkalemic periodic pachromosome 17. J. Med. Genet. 28, 583-586.

Koch, M. C., Ricker, K., Otto, M., Grimm, T., Bender, K., Zoll, B., Harper, P. S., Lehmann-Horn, F., Rudel, R., and Hoffman, E. P. (1991b). Linkage data suggesting allelic heterogeneity for paramyotonia congenita and hyperkalemic periodic paralysis on chromosome 17. Hum. Cenet. 88, 71-74. Lehmann-Horn, F., Rudel, R., Denglar, A., and Ricker, K. (1981). Membrane congenita with and without myotonia Muscle Nerve 4, 396-406.

R., Lorkovic, H., Haass, defects in paramyotonia in a warm environment.

Lehmann-Horn, F., Kuther, G., Ricker, K., Crafe, P., Ballanyi, K., and Rudel, R. (1987a). Adynamia episodica hereditaria with myotonia: a non-inactivating sodium current and the effect of extracellular pH. Muscle Nerve IO, 363-374. Lehmann-Horn, F., Rtidel, R., and Ricker, K. (1987b3. Membrane defects in paramyotonia congenita (Eulenburg). Muscle Nerve 70, 633-641. Maniatis, T., Fritsch, E., and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp. 150-169. Noda, M., Ikeda, T., Kayanao,T., Suzuki, H., Takahashi, H., Kurasaki, M., Takasashi, H., and Numa, S. (1986). Existence of distinct sodium channel messenger RNA’s in rat brain. Nature 320,188192 Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya, T. (1989a). Detection of polymorphisms of human DNA by gel electrophoresis as single strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86, 2766-2770. Orita, M., Suzuki, Y., Sekiya, T., and Hayashi, K. (1989b). Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5, 874879. Papazian, D. M., Timpe, L. C., Jan, Y. N., and Jan, L. Y. (1991). Alteration of voltage-dependence of Shaker potassium channel by mutations in the S4 sequence. Nature 349, 305-310. Ptdcek, L. J., Tyler, F., Trimmer, M. (1991a). Analysis in a large pedigree supports tight linkage J. Hum. Cenet. 49, 378-382.

J. S., Agnew, hyperkalemic to a sodium

W. S., and Leppert, periodic paralysis channel locus. Am.

Ptdcek, L. J., Trimmer, J. S., Agnew, W. S., Roberts, J. W., Petajan, J. H., and Leppert, M. (1991b). Paramyotonia congenita and hyperkalemic periodic paralysis map to the same sodium channel gene locus. Am. J. Hum. Cenet. 49,851-854. Ptacek, L. J., George, A. L., Jr., Criggs, R. C., Tawil, R., Kallen, R. G., Barchi, R. L., Robertson, M., and Leppert, M. F. (1991~). identification of a mutation in the gene causing hyperkalemic periodic paralysis. Cell 67, 1021-1027. Ptacek, L. J., Tawil, R., Griggs, R. C., Storvick, D., and Leppert, M. F. (1992). Linkage of atypical myotonia congenita to a sodium channel locus. Neurology 42, 431-433. Rich, Med. Riggs, 498.

E. C. (1894). A unique News 65, 210-213. J. E. (1988).

The

Riggs, J. E., and Griggs, the periodic paralyses. Riggs, J. E., Griggs, induced weakness Med. 86, 169-173.

form

periodic

of motor

paralysis

due to cold.

paralyses.

Neural.

Clin.

R. C. (1979). Diagnosis Clin. Neuropharmacol.

R. C., and Moxley, in paramyotonia

6, 485-

and treatment 4, 123-138.

of

R.T. (1977). Acetazolamidecongenita. Ann. Intern.

Rogart, R. B., Cribbs, L. L., Muglia, L. K., Kephart, D. D., and Kaiser, M. W. (1989). Molecular cloning of a putative tetrodotoxin-resistant rat heart sodium channel isoform. Proc. Natl. Acad. Sci. USA 86, 8170-8174.

Rojas, C. V., Wang, B. R.,and Brown, R. muscle Na channel ralysis. Nature 354,

J., Schwartz, L. S., Hoffmann, H. (1991).Amet-to-val mutation alpha-subunit in hyperkalemic 387-389.

E. P., Powell, in theskeletal periodic pa-

Rtidel, R., Ruppersberg, J. P., and Spittelmeister, W. (1989). Abnormalities of the fast sodium current in myotonic dystrophy, recessive generalized myotonia, and adynamia episodica. Muscle Nerve 72, 281-287. Sanger, F., Nicklen, with chain-terminating 5463-5467.

S., and Coulson, A. (1977). DNA inhibitors. Proc. Natl. Acad.

sequencing Sci. USA 74,

Stuhmer, W., Conti, F., Suzuki, H., Wang, X., Noda, N., Kubo, H., and Numa, S. (1989). Structural parts activation and inactivation of the sodium channel. 597-603.

M., Yahagi, involved in Nature 339,

Trimmer, J. S., Cooperman, S. S., Tomiko, S. A., Zhou, J., Crean, S. M., Boyle, M. B., Kallen, R.G., Sheng,Z., Barchi, R. L., Sigworth, F. J., Goodman, R. H., Agnew, W. S., and Mandel G. (1989). Primary structureand functional expression of a mammalian skeletal muscle sodium channel. Neuron 3, 33-49.