Eur J Pediatr DOI 10.1007/s00431-013-2200-7
SHORT COMMUNICATION
Nevoid basal cell carcinoma syndrome with a unilateral giant ovarian fibroma in a Japanese 6-year-old girl Takahiro Jimbo & Kouji Masumoto & Yasuhisa Urita & Hajime Takayasu & Toko Shinkai & Toru Uesugi & Chikashi Gotoh & Naoya Sakamoto & Takato Sasaki & Tatsuyuki Oto & Takashi Fukushima & Emiko Noguchi & Yoshiro Nakano
Received: 9 September 2013 / Accepted: 22 October 2013 # Springer-Verlag Berlin Heidelberg 2013
Abstract Nevoid basal cell carcinoma syndrome (NBCCS) is characterized by basal cell carcinoma, skeletal abnormalities, benign tumors including ovarian fibroma, and various other phenotypic expressions. Ovarian fibromas in NBCCS before puberty are very rare. We report a 6-year-old prepubescent girl with NBCCS showing skeletal abnormalities, medulloblastoma, and ovarian fibromas. The patient was referred to our hospital owing to abdominal distension. On admission, a huge elastic hard tumor was palpable and computed tomography showed a huge tumor of the left ovary. We performed a left salpingo-oophorectomy and diagnosed the tumor as a benign fibroma. Further examination of the computed tomography images showed skeletal abnormalities. In addition, the patient had a history of medulloblastoma at the age of 4 years. Therefore, we diagnosed NBCCS. A genetic examination indicated a novel 1 bp deletion in exon 18 (c.3055delG). Sequence analysis of exon 18 using DNA from the ovarian tumor revealed a mutant allele (c.3055delG) dominant to the wildtype allele, thus suggesting loss of heterozygosity in the PTCH1 gene, which is known to be associated with NBCCS. Conclusion On the basis of our experience, physicians T. Jimbo (*) : K. Masumoto : Y. Urita : H. Takayasu : T. Shinkai : T. Uesugi : C. Gotoh : N. Sakamoto : T. Sasaki Department of Pediatric Surgery, Faculty of Medicine, University of Tsukuba, Tsukuba, Ibaraki 305-8576, Japan e-mail: [email protected] T. Oto : T. Fukushima Department of Pediatrics, Faculty of Medicine, University of Tsukuba, Tsukuba, Ibaraki 305-8576, Japan E. Noguchi Department of Medical Genetics, Faculty of Medicine, University of Tsukuba, Tsukuba, Ibaraki 305-8576, Japan Y. Nakano Department of Genetics, Hyogo College of Medicine, Nishinomiya, Hyogo 663-8501, Japan
treating pediatric ovarian tumors should be aware that such huge benign ovarian tumors may be a phenotype of NBCCS, as shown in our patient. In addition, genetic examination focusing on the PTCH1 gene might be important for diagnosis of NBCCS in pediatric patients.
Keywords Nevoid basal cell carcinoma syndrome . Ovarian fibroma . Prepuberty . PTCH1
Introduction Nevoid basal cell carcinoma syndrome (NBCCS) is a rare hereditary autosomal dominant disease with high penetrance that shows variable expressivity. The prevalence of NBCCS is estimated to be from 1 in 55,600 to 1 in 164,000 [3]. Previous studies reported that NBCCS is caused by a mutation in the patched 1gene (PTCH1), which is a tumor suppressor gene located on the long arm of chromosome 9 (9q22.3-q31) [4]. NBCCS is characterized by malignancies of the skin and other organs, skeletal abnormalities, and craniofacial anomalies [6]. Typically, benign and malignant tumors are often involved in the skin, bone, genitourinary system, and central nervous system. Universal criteria for the diagnosis of NBCCS have been established [9]. Ovarian fibroma is one of the minor criteria for NBCCS. Ovarian fibroma is a benign neoplasm of ovarian stromal cells, which most commonly arises after puberty. It accounts for approximately 4 % of ovarian neoplasms [11]. The occurrence of ovarian fibroma before puberty has been reported to follow either of two patterns: occurrence secondary to NBCCS or sporadic occurrence [8]. Herein, we report a prepubescent patient with NBCCS who developed a unilateral giant ovarian fibroma.
Eur J Pediatr
Case report A 6-year-old girl was referred to our department because of an abdominal distension. She was the first child of a healthy, nonconsanguineous Japanese couple and had one healthy younger brother and one healthy younger sister. At the age of 4 months, she was diagnosed as having suspected macrocephaly and had been followed owing to asymptomatic overgrowth syndrome. At the age of 4 years, medulloblastoma had developed, for which she had received surgical treatment and chemoradiotherapy. At the age of 6 years, a distension occurred in the hypogastric region. On admission to our department, a huge painless elastic hard tumor was palpable in the lower abdomen. Ultrasonography and computed tomography (CT) showed a giant solid ovarian tumor (13 cm in diameter) of the left ovary with sporadic calcification and less fat component (summarized the findings of ultrasonography and CT). Serum levels of the tumor markers, α-fetoprotein and β-hCG, were within normal ranges, and the other blood test was normal. The preoperative diagnosis was a benign tumor of the left ovary. Owing to the huge size of the tumor, a laparotomy was performed and to confirm the diagnosis on day 1 after admission. On entering the abdominal cavity, the tumor was found to be originating from the left ovary; the contralateral ovary was intact. Thus, a left salpingooophorectomy was performed. The gross specimen consisted of a 13.5×10.5×9.0-cm solid tumor with multiple nodules (approximately 1 cm in diameter) on the surface (Fig. 1A). The cystic components of the tumor had a gelatinous appearance, while the solid components without normal ovarian parenchyma included diffuse sporadic calcifications. The pathologic findings showed the tumor to be a benign fibroma (Fig. 1B). The tumor had marked edema, which was formed by intersecting spindle cells with abundant myxoid stroma and diffuse calcifications. Immunohistochemical staining revealed that the spindle cells were positive for smooth muscle actin, Wilm’s tumor suppressor gene 1 (WT1) and anti-Ki-67 antibody (MIB-1; 10.6 % labeling index). Further examination of the CT images showed slight calcification of the falx cerebri and abnormalities of both the ribs (right fourth splayed rib and left fifth bifid rib) and third thoracic vertebral bodies. Therefore, we diagnosed NBCCS according to the following criteria: two major criteria (splayed or bifid ribs and calcification of the falx cerebri) and four minor criteria (ovarian fibroma, medulloblastoma, macrocephaly, and vertebral abnormality).
Genetic examination Informed consent for the genetic examination was obtained from the patient’s parents. The ethics committees of both the University of Tsukuba and Hyogo College of Medicine
approved all of the examination experiments. A QIAamp DNA Blood Micro Kit (Qiagen, Hilden, Germany) was used to extract DNA from the peripheral blood cells and a NucleoSpin Tissue kit (Takara Bio, Ohtsu, Japan) to extracted tissue DNA, according to the manufacturers’ instructions. The coding exons, including splicing sites, were PCR amplified and sequenced as previously described [12]. In addition, SNPs rs357565 and rs57585041, located in the 3′ region of the PTCH1 gene, were PCR amplified and sequenced using p r i m e r s r s 3 5 7 5 6 5 F : 5 ′ G C T C TAT C T G AT G G A G A G A G T T T TA G G 3 ′ a n d r s 3 5 7 5 6 5 RV: 5 ′ TCCTCATGAACCTGTGCAACAGGACATGGC3′. Mutation screening of all exons and exon–intron boundaries of the PTCH1 gene from the patient’s blood DNA was performed and indicated a novel 1 bp deletion (c.3055delG) in exon 18. Sequence analysis of exon 18 using DNA from the ovarian tumor revealed a mutant allele (c.3055delG) dominant to the wild-type allele, suggesting loss of heterozygosity of PTCH1 in the ovarian tumor (Fig. 1C). The loss of one PTCH1 allele was also confirmed by the sequence around rs357565, which is located at the 3′UTR of the PTCH1 gene, indicating loss of heterozygosity in the tumor sample.
Discussion We herein reported a Japanese girl of prepubescent age with NBCCS showing skeletal abnormalities, medulloblastoma, and an ovarian fibroma. NBCCS was first reported in 1894. Then in 1960, a dentist, Robert Gorlin, and a dermatologist, Robert Goltz, described a distinct syndrome consisting of the presence of multiple nevoid basal cell epitheliomas, jaw cysts, and bifid ribs [6]. Recently, diagnostic criteria for NBCCS, which we also used, were established by Kimonis et al. [3, 9]. The principal clinical characteristics of NBCCS are multiple basal cell carcinomas, odontogenic keratocysts, and palmoplantar pits [9]. Other than these known principal characteristics of NBCCS, various anomalies and tumors have been reported, including medulloblastoma and genitourinary, craniofacial, skeletal, and oropharyngeal anomalies [9]. Our patient also had two of the major clinical criteria for NBCCS (calcification of the falx cerebri and bifib or splayed ribs) and four of the minor critieria (medulloblastoma, ovarian fibroma, macrocephaly, and vertebral anomalies). The diagnosis of NBCCS in early childhood is often difficult because many of the clinical signs are absent in this period. In addition, the clinical presentations of NBCCS are very varied. Therefore, diagnosis of pediatric cases is rare, despite the importance of early diagnosis for better treatment and care of the patient. Basal cell carcinomas and odontogenic keratocysts are commonly seen in NBCCS. In fact, almost 80 % of patients with NBCCS have basal cell carcinomas and odontogenic keratocysts with the incidence increasing with age [5].
Eur J Pediatr
Fig. 1 A Operative findings of the left ovarian tumor. It was a huge solid tumor with multiple nodules (approximately1 cm in diameter) on the surface. B Pathologic findings after hematoxylin and eosin and immunohistochemical stainings using Ki-67 (MIB-1) antibodies. The tumor was composed of intersecting spindle cells with abundant myxoid stromata. The intersecting spindle cells were positive for Ki-67 antibodies. (a
Hematoxylin and eosin, b MIB1 labeling index=10.6 %) Magnification : a ×400, b ×100. C Sequence analysis of exon 18 using DNA from the ovarian tumor revealed a mutant allele (i.e., c.3055delG) dominant to the wild-type allele. The loss of one PTCH1 allele was also confirmed by the sequence around rs357565, which is located at the 3′UTR of the PTCH1 gene, indicating loss of heterozygosity in the tumor sample
However, our patient had neither odontogenic keratocysts nor basal cell carcinoma, which is most commonly located on the face, neck, and upper trunk. The absence of these conditions common to NBCCS in our patient might be due to her young age. Ovarian fibroma accounts for 4 % of all ovarian tumors and only 1.5 % of pediatric ovarian tumors [8]. The occurrence of ovarian fibromas in NBCCS was first described in 1963 by Clendenning et al. [2]. The ovarian fibroma of pediatric NBCCS has been shown to be large, bilateral, multiple, and nodular, and often calcified but rarely malignant [1].
Therefore, it is very important to preserve the normal ovarian tissue as early as possible in NBCCS pediatric patients to preserve their future reproductive potential. In the case reported herein, the diagnosis of NBCCS was finally confirmed by a loss-of-function mutation in the PTCH1 gene. PTCH1 modifies the hedgehog signaling pathway, a complex pathway responsible for development of NBCCS [7]. NBCCS is inherited in an autosomal dominant fashion with high penetrance, and in some NBCCS patients, the de novo mutation of the PTCH1 gene was found, as it was in our patient. None of our patient’s family members showed any typical diseases
Eur J Pediatr
associated with NBCCS. Therefore, we speculate that the 1 bp deletion (c.3055delG) indentified in our patient may be a de novo mutation. A recent study analyzing keratocystic odontogenic tumors showed that not only the standard two-hit model but also the one-hit model exhibiting haploinsufficiency or dominant-negative isoforms may be involved in inactivation of the PTCH1 [10]. Therefore, in our patient, this NBCCS might be caused by inactivation of the PTCH1 gene. Sequencing analysis showed that this patient’s PTCH1 gene had a c.3055delG mutation in one allele and the wildtype sequence in the other allele. The fibroma sample showed only one allele sequence with the c.3055delG mutation. These data suggest that this patient has a germline mutation in the PTCH1 gene and that the nonmutated allele was deleted in the fibroma sample. The deletion of 1 allele of the PTCH1 gene in the fibroma was confirmed by one allelic loss of SNPs in the PTCH1 region. The SNPs, rs2277184 in the 10th intron and rs2066829 in the 15th intron, were T/C and G/C in the blood sample but only T and G in the fibroma sample, respectively. In addition, rs357565, which is located in the 3′ untranslated region of the PTCH1 gene, was G/T in the blood sample but only T in the fibroma sample. These data revealed that this patient has a germline mutation of c3055delG and that at least the 3′ half of the other wild-type allele was deleted in the fibroma sample, suggesting that this fibroma might be caused by the loss of two functional PTCH1 alleles. On the basis of the genetic examinations conducted in our patient, the PTCH1 mutation is apparently compatible with the two-hit model, suggesting that the inactivation of the patient’s PTCH1 alleles was responsible for the huge ovarian tumor. Screening for mutation of the PTCH1 gene for suspected NBCCS cases may lead to early diagnosis of NBCCS and, in turn, to a better prognosis for patients, especially for young children. Acknowledgments We thank Drs. T. Hashimoto-Tamaoki, K. Noguchi, and M. Urade for their support. This work was supported in part by a Grantin-Aid for Scientific Research (no. 24592854) from the Japan Society for the Promotion of Science (to Y.N).
Conflict of interest The authors declare that they have no conflict of interest.
References 1. Ball A, Wenning J, Van Eyk N (2011) Ovarian fibromas in pediatric patients with basal cell nevus (Gorlin) syndrome. J Pediatr Adolesc Gynecol 24:e5–e7 2. Clendenning WE, Herd T Jr, Block JB (1963) Ovarian fibromas and mesenteric cysts: their association with hereditary basal cell cancer of the skin. Am J Obstet Gynecol 87:1008–1012 3. Evans DG, Ladusans EJ, Rimmer S, Burnell LD, Thakker N, Farndon PA (1993) Complications of the naevoid basal cell carcinoma syndrome: results of a population based study. J Med Genet 30:460–464 4. Farndon PA, Del Mastro RG, Evans DG, Kilpatrick MW (1992) Location of gene for Gorlin syndrome. Lancet 339:581–582 5. Finch T, Pushpanathan C, Brown K, El-Gohary Y (2012) Gorlin syndrome presenting with a unilateral ovarian fibroma in a 22-yearold woman: a case report. J Med Case Rep 6:148 6. Gorlin RJ, Goltz RW (1960) Multiple nevoid basal-cell epithelioma, jaw cysts and bifid rib. A syndrome. N Engl J Med 262:908–912 7. Hahn H, Wicking C, Zaphiropoulous PG, Gailani MR, Shanley S, Chidambaram A, Vorechovsky I, Holmberg E, Unden AB, Gillies S, Negus K, Smyth I, Pressman C, Leffell DJ, Gerrard B, Goldstein AM, Dean M, Toftgard R, Chenevix-Trench G, Wainwright B, Bale AE (1996) Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 85:841–851 8. Johnson AD, Hebert AA, Esterly NB (1986) Nevoid basal cell carcinoma syndrome: bilateral ovarian fibromas in a 3 1/2-year-old girl. J Am Acad Dermatol 14:371–374 9. Kimonis VE, Goldstein AM, Pastakia B, Yang ML, Kase R, DiGiovanna JJ, Bale AE, Bale SJ (1997) Clinical manifestations in 105 persons with nevoid basal cell carcinoma syndrome. Am J Med Genet 69:299–308 10. Pan S, Dong Q, Sun LS, Li TJ (2010) Mechanisms of inactivation of PTCH1 gene in nevoid basal cell carcinoma syndrome: modification of the two-hit hypothesis. Clin Cancer Res 16:442–450 11. Seracchioli R, Bagnoli A, Colombo FM, Missiroli S, Venturoli S (2001) Conservative treatment of recurrent ovarian fibromas in a young patient affected by Gorlin syndrome. Hum Reprod 16:1261–1263 12. Takahashi C, Kanazawa N, Yoshikawa Y, Yoshikawa R, Saitoh Y, Chiyo H, Tanizawa T, Hashimoto-Tamaoki T, Nakano Y (2009) Germline PTCH1 mutations in Japanese basal cell nevus syndrome patients. J Hum Genet 54:403–408
SHORT COMMUNICATION
Nevoid basal cell carcinoma syndrome with a unilateral giant ovarian fibroma in a Japanese 6-year-old girl Takahiro Jimbo & Kouji Masumoto & Yasuhisa Urita & Hajime Takayasu & Toko Shinkai & Toru Uesugi & Chikashi Gotoh & Naoya Sakamoto & Takato Sasaki & Tatsuyuki Oto & Takashi Fukushima & Emiko Noguchi & Yoshiro Nakano
Received: 9 September 2013 / Accepted: 22 October 2013 # Springer-Verlag Berlin Heidelberg 2013
Abstract Nevoid basal cell carcinoma syndrome (NBCCS) is characterized by basal cell carcinoma, skeletal abnormalities, benign tumors including ovarian fibroma, and various other phenotypic expressions. Ovarian fibromas in NBCCS before puberty are very rare. We report a 6-year-old prepubescent girl with NBCCS showing skeletal abnormalities, medulloblastoma, and ovarian fibromas. The patient was referred to our hospital owing to abdominal distension. On admission, a huge elastic hard tumor was palpable and computed tomography showed a huge tumor of the left ovary. We performed a left salpingo-oophorectomy and diagnosed the tumor as a benign fibroma. Further examination of the computed tomography images showed skeletal abnormalities. In addition, the patient had a history of medulloblastoma at the age of 4 years. Therefore, we diagnosed NBCCS. A genetic examination indicated a novel 1 bp deletion in exon 18 (c.3055delG). Sequence analysis of exon 18 using DNA from the ovarian tumor revealed a mutant allele (c.3055delG) dominant to the wildtype allele, thus suggesting loss of heterozygosity in the PTCH1 gene, which is known to be associated with NBCCS. Conclusion On the basis of our experience, physicians T. Jimbo (*) : K. Masumoto : Y. Urita : H. Takayasu : T. Shinkai : T. Uesugi : C. Gotoh : N. Sakamoto : T. Sasaki Department of Pediatric Surgery, Faculty of Medicine, University of Tsukuba, Tsukuba, Ibaraki 305-8576, Japan e-mail: [email protected] T. Oto : T. Fukushima Department of Pediatrics, Faculty of Medicine, University of Tsukuba, Tsukuba, Ibaraki 305-8576, Japan E. Noguchi Department of Medical Genetics, Faculty of Medicine, University of Tsukuba, Tsukuba, Ibaraki 305-8576, Japan Y. Nakano Department of Genetics, Hyogo College of Medicine, Nishinomiya, Hyogo 663-8501, Japan
treating pediatric ovarian tumors should be aware that such huge benign ovarian tumors may be a phenotype of NBCCS, as shown in our patient. In addition, genetic examination focusing on the PTCH1 gene might be important for diagnosis of NBCCS in pediatric patients.
Keywords Nevoid basal cell carcinoma syndrome . Ovarian fibroma . Prepuberty . PTCH1
Introduction Nevoid basal cell carcinoma syndrome (NBCCS) is a rare hereditary autosomal dominant disease with high penetrance that shows variable expressivity. The prevalence of NBCCS is estimated to be from 1 in 55,600 to 1 in 164,000 [3]. Previous studies reported that NBCCS is caused by a mutation in the patched 1gene (PTCH1), which is a tumor suppressor gene located on the long arm of chromosome 9 (9q22.3-q31) [4]. NBCCS is characterized by malignancies of the skin and other organs, skeletal abnormalities, and craniofacial anomalies [6]. Typically, benign and malignant tumors are often involved in the skin, bone, genitourinary system, and central nervous system. Universal criteria for the diagnosis of NBCCS have been established [9]. Ovarian fibroma is one of the minor criteria for NBCCS. Ovarian fibroma is a benign neoplasm of ovarian stromal cells, which most commonly arises after puberty. It accounts for approximately 4 % of ovarian neoplasms [11]. The occurrence of ovarian fibroma before puberty has been reported to follow either of two patterns: occurrence secondary to NBCCS or sporadic occurrence [8]. Herein, we report a prepubescent patient with NBCCS who developed a unilateral giant ovarian fibroma.
Eur J Pediatr
Case report A 6-year-old girl was referred to our department because of an abdominal distension. She was the first child of a healthy, nonconsanguineous Japanese couple and had one healthy younger brother and one healthy younger sister. At the age of 4 months, she was diagnosed as having suspected macrocephaly and had been followed owing to asymptomatic overgrowth syndrome. At the age of 4 years, medulloblastoma had developed, for which she had received surgical treatment and chemoradiotherapy. At the age of 6 years, a distension occurred in the hypogastric region. On admission to our department, a huge painless elastic hard tumor was palpable in the lower abdomen. Ultrasonography and computed tomography (CT) showed a giant solid ovarian tumor (13 cm in diameter) of the left ovary with sporadic calcification and less fat component (summarized the findings of ultrasonography and CT). Serum levels of the tumor markers, α-fetoprotein and β-hCG, were within normal ranges, and the other blood test was normal. The preoperative diagnosis was a benign tumor of the left ovary. Owing to the huge size of the tumor, a laparotomy was performed and to confirm the diagnosis on day 1 after admission. On entering the abdominal cavity, the tumor was found to be originating from the left ovary; the contralateral ovary was intact. Thus, a left salpingooophorectomy was performed. The gross specimen consisted of a 13.5×10.5×9.0-cm solid tumor with multiple nodules (approximately 1 cm in diameter) on the surface (Fig. 1A). The cystic components of the tumor had a gelatinous appearance, while the solid components without normal ovarian parenchyma included diffuse sporadic calcifications. The pathologic findings showed the tumor to be a benign fibroma (Fig. 1B). The tumor had marked edema, which was formed by intersecting spindle cells with abundant myxoid stroma and diffuse calcifications. Immunohistochemical staining revealed that the spindle cells were positive for smooth muscle actin, Wilm’s tumor suppressor gene 1 (WT1) and anti-Ki-67 antibody (MIB-1; 10.6 % labeling index). Further examination of the CT images showed slight calcification of the falx cerebri and abnormalities of both the ribs (right fourth splayed rib and left fifth bifid rib) and third thoracic vertebral bodies. Therefore, we diagnosed NBCCS according to the following criteria: two major criteria (splayed or bifid ribs and calcification of the falx cerebri) and four minor criteria (ovarian fibroma, medulloblastoma, macrocephaly, and vertebral abnormality).
Genetic examination Informed consent for the genetic examination was obtained from the patient’s parents. The ethics committees of both the University of Tsukuba and Hyogo College of Medicine
approved all of the examination experiments. A QIAamp DNA Blood Micro Kit (Qiagen, Hilden, Germany) was used to extract DNA from the peripheral blood cells and a NucleoSpin Tissue kit (Takara Bio, Ohtsu, Japan) to extracted tissue DNA, according to the manufacturers’ instructions. The coding exons, including splicing sites, were PCR amplified and sequenced as previously described [12]. In addition, SNPs rs357565 and rs57585041, located in the 3′ region of the PTCH1 gene, were PCR amplified and sequenced using p r i m e r s r s 3 5 7 5 6 5 F : 5 ′ G C T C TAT C T G AT G G A G A G A G T T T TA G G 3 ′ a n d r s 3 5 7 5 6 5 RV: 5 ′ TCCTCATGAACCTGTGCAACAGGACATGGC3′. Mutation screening of all exons and exon–intron boundaries of the PTCH1 gene from the patient’s blood DNA was performed and indicated a novel 1 bp deletion (c.3055delG) in exon 18. Sequence analysis of exon 18 using DNA from the ovarian tumor revealed a mutant allele (c.3055delG) dominant to the wild-type allele, suggesting loss of heterozygosity of PTCH1 in the ovarian tumor (Fig. 1C). The loss of one PTCH1 allele was also confirmed by the sequence around rs357565, which is located at the 3′UTR of the PTCH1 gene, indicating loss of heterozygosity in the tumor sample.
Discussion We herein reported a Japanese girl of prepubescent age with NBCCS showing skeletal abnormalities, medulloblastoma, and an ovarian fibroma. NBCCS was first reported in 1894. Then in 1960, a dentist, Robert Gorlin, and a dermatologist, Robert Goltz, described a distinct syndrome consisting of the presence of multiple nevoid basal cell epitheliomas, jaw cysts, and bifid ribs [6]. Recently, diagnostic criteria for NBCCS, which we also used, were established by Kimonis et al. [3, 9]. The principal clinical characteristics of NBCCS are multiple basal cell carcinomas, odontogenic keratocysts, and palmoplantar pits [9]. Other than these known principal characteristics of NBCCS, various anomalies and tumors have been reported, including medulloblastoma and genitourinary, craniofacial, skeletal, and oropharyngeal anomalies [9]. Our patient also had two of the major clinical criteria for NBCCS (calcification of the falx cerebri and bifib or splayed ribs) and four of the minor critieria (medulloblastoma, ovarian fibroma, macrocephaly, and vertebral anomalies). The diagnosis of NBCCS in early childhood is often difficult because many of the clinical signs are absent in this period. In addition, the clinical presentations of NBCCS are very varied. Therefore, diagnosis of pediatric cases is rare, despite the importance of early diagnosis for better treatment and care of the patient. Basal cell carcinomas and odontogenic keratocysts are commonly seen in NBCCS. In fact, almost 80 % of patients with NBCCS have basal cell carcinomas and odontogenic keratocysts with the incidence increasing with age [5].
Eur J Pediatr
Fig. 1 A Operative findings of the left ovarian tumor. It was a huge solid tumor with multiple nodules (approximately1 cm in diameter) on the surface. B Pathologic findings after hematoxylin and eosin and immunohistochemical stainings using Ki-67 (MIB-1) antibodies. The tumor was composed of intersecting spindle cells with abundant myxoid stromata. The intersecting spindle cells were positive for Ki-67 antibodies. (a
Hematoxylin and eosin, b MIB1 labeling index=10.6 %) Magnification : a ×400, b ×100. C Sequence analysis of exon 18 using DNA from the ovarian tumor revealed a mutant allele (i.e., c.3055delG) dominant to the wild-type allele. The loss of one PTCH1 allele was also confirmed by the sequence around rs357565, which is located at the 3′UTR of the PTCH1 gene, indicating loss of heterozygosity in the tumor sample
However, our patient had neither odontogenic keratocysts nor basal cell carcinoma, which is most commonly located on the face, neck, and upper trunk. The absence of these conditions common to NBCCS in our patient might be due to her young age. Ovarian fibroma accounts for 4 % of all ovarian tumors and only 1.5 % of pediatric ovarian tumors [8]. The occurrence of ovarian fibromas in NBCCS was first described in 1963 by Clendenning et al. [2]. The ovarian fibroma of pediatric NBCCS has been shown to be large, bilateral, multiple, and nodular, and often calcified but rarely malignant [1].
Therefore, it is very important to preserve the normal ovarian tissue as early as possible in NBCCS pediatric patients to preserve their future reproductive potential. In the case reported herein, the diagnosis of NBCCS was finally confirmed by a loss-of-function mutation in the PTCH1 gene. PTCH1 modifies the hedgehog signaling pathway, a complex pathway responsible for development of NBCCS [7]. NBCCS is inherited in an autosomal dominant fashion with high penetrance, and in some NBCCS patients, the de novo mutation of the PTCH1 gene was found, as it was in our patient. None of our patient’s family members showed any typical diseases
Eur J Pediatr
associated with NBCCS. Therefore, we speculate that the 1 bp deletion (c.3055delG) indentified in our patient may be a de novo mutation. A recent study analyzing keratocystic odontogenic tumors showed that not only the standard two-hit model but also the one-hit model exhibiting haploinsufficiency or dominant-negative isoforms may be involved in inactivation of the PTCH1 [10]. Therefore, in our patient, this NBCCS might be caused by inactivation of the PTCH1 gene. Sequencing analysis showed that this patient’s PTCH1 gene had a c.3055delG mutation in one allele and the wildtype sequence in the other allele. The fibroma sample showed only one allele sequence with the c.3055delG mutation. These data suggest that this patient has a germline mutation in the PTCH1 gene and that the nonmutated allele was deleted in the fibroma sample. The deletion of 1 allele of the PTCH1 gene in the fibroma was confirmed by one allelic loss of SNPs in the PTCH1 region. The SNPs, rs2277184 in the 10th intron and rs2066829 in the 15th intron, were T/C and G/C in the blood sample but only T and G in the fibroma sample, respectively. In addition, rs357565, which is located in the 3′ untranslated region of the PTCH1 gene, was G/T in the blood sample but only T in the fibroma sample. These data revealed that this patient has a germline mutation of c3055delG and that at least the 3′ half of the other wild-type allele was deleted in the fibroma sample, suggesting that this fibroma might be caused by the loss of two functional PTCH1 alleles. On the basis of the genetic examinations conducted in our patient, the PTCH1 mutation is apparently compatible with the two-hit model, suggesting that the inactivation of the patient’s PTCH1 alleles was responsible for the huge ovarian tumor. Screening for mutation of the PTCH1 gene for suspected NBCCS cases may lead to early diagnosis of NBCCS and, in turn, to a better prognosis for patients, especially for young children. Acknowledgments We thank Drs. T. Hashimoto-Tamaoki, K. Noguchi, and M. Urade for their support. This work was supported in part by a Grantin-Aid for Scientific Research (no. 24592854) from the Japan Society for the Promotion of Science (to Y.N).
Conflict of interest The authors declare that they have no conflict of interest.
References 1. Ball A, Wenning J, Van Eyk N (2011) Ovarian fibromas in pediatric patients with basal cell nevus (Gorlin) syndrome. J Pediatr Adolesc Gynecol 24:e5–e7 2. Clendenning WE, Herd T Jr, Block JB (1963) Ovarian fibromas and mesenteric cysts: their association with hereditary basal cell cancer of the skin. Am J Obstet Gynecol 87:1008–1012 3. Evans DG, Ladusans EJ, Rimmer S, Burnell LD, Thakker N, Farndon PA (1993) Complications of the naevoid basal cell carcinoma syndrome: results of a population based study. J Med Genet 30:460–464 4. Farndon PA, Del Mastro RG, Evans DG, Kilpatrick MW (1992) Location of gene for Gorlin syndrome. Lancet 339:581–582 5. Finch T, Pushpanathan C, Brown K, El-Gohary Y (2012) Gorlin syndrome presenting with a unilateral ovarian fibroma in a 22-yearold woman: a case report. J Med Case Rep 6:148 6. Gorlin RJ, Goltz RW (1960) Multiple nevoid basal-cell epithelioma, jaw cysts and bifid rib. A syndrome. N Engl J Med 262:908–912 7. Hahn H, Wicking C, Zaphiropoulous PG, Gailani MR, Shanley S, Chidambaram A, Vorechovsky I, Holmberg E, Unden AB, Gillies S, Negus K, Smyth I, Pressman C, Leffell DJ, Gerrard B, Goldstein AM, Dean M, Toftgard R, Chenevix-Trench G, Wainwright B, Bale AE (1996) Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 85:841–851 8. Johnson AD, Hebert AA, Esterly NB (1986) Nevoid basal cell carcinoma syndrome: bilateral ovarian fibromas in a 3 1/2-year-old girl. J Am Acad Dermatol 14:371–374 9. Kimonis VE, Goldstein AM, Pastakia B, Yang ML, Kase R, DiGiovanna JJ, Bale AE, Bale SJ (1997) Clinical manifestations in 105 persons with nevoid basal cell carcinoma syndrome. Am J Med Genet 69:299–308 10. Pan S, Dong Q, Sun LS, Li TJ (2010) Mechanisms of inactivation of PTCH1 gene in nevoid basal cell carcinoma syndrome: modification of the two-hit hypothesis. Clin Cancer Res 16:442–450 11. Seracchioli R, Bagnoli A, Colombo FM, Missiroli S, Venturoli S (2001) Conservative treatment of recurrent ovarian fibromas in a young patient affected by Gorlin syndrome. Hum Reprod 16:1261–1263 12. Takahashi C, Kanazawa N, Yoshikawa Y, Yoshikawa R, Saitoh Y, Chiyo H, Tanizawa T, Hashimoto-Tamaoki T, Nakano Y (2009) Germline PTCH1 mutations in Japanese basal cell nevus syndrome patients. J Hum Genet 54:403–408
