InrernarionolJournalfor Primed in Great Britain
Parasilology
Vol. 22, No. 5, pp. 685-687,
1992 0
002~7519/92 $5.00 + o.cfJ Pergamon Press Lrd Sociery~oor Porasirology
1992 Ausrrolion
RESEARCHNOTE NUCLEOTIDE SEQUENCE OF A cDNA FROM ONCHOCERCA ENCODING A NOVEL REPETITIVE ANTIGEN
GZBSONZ
JULIAN CATMULL, ZHANG DAN and DAVID J. MILLER* Department of Chemistry and Biochemistry, James Cook University of North Queensland, Townsville, Queensland 4811, Australia (Received 24 March 1992; accepted 30 March 1992)
AbSfTaCt-CATMULL J., DANZ. and MILLER D.J. 1992. Nucleotide sequence of a cDNA from Onchocerca gibsoniencoding a novel repetitive antigen. International Journalfor Parasitology 22: 685-687. mRNA from uterine microfilariae of the cattle parasite Onchocerca gibsoni was used for the construction of cDNA libraries. A cDNA clone encoding an antigen recognized by serum from human individuals infected with O.volvulus was found to contain five copies of an 87 bp unit. These 87 bp units were present in the gensme in high copy number as long tandem arrays. These are the first cDNA sequence data obtained directly from larvae of any Onchocerca species.
INDEX KEY WORDS: Onchocerca gibsoni; cDNA library; microfilariae; antigen genes; repetitive sequences.
THE
microfilariae
the parasitic nematode are responsible for the pathological symptoms known as onchocerciasis, or ‘river blindness’, a disease which afflicts at least 18 million people throughout sub-Saharan Africa and Latin America. Determination of the antigen composition of the microfilariae is mandatory for understanding the mechanism(s) by which these larvae are able to evade the host immune system during this process. Immunological studies on O.voZvulus microfilariae have been limited by the availability of parasite material. Antigen analysis (Cabrera & Parkhouse, 1986, 1987; Parkhouse, Cabrera & Harnett, 1987) drug susceptibility (Copeman, 1979) and many other comparative studies have established that O.gibsoni, which commonly infects cattle in northern Australia, is the best available animal model for the human parasite. Here we report the generation of cDNA libraries for uterine microfilariae of O.gibsoni; this is the first time that cDNAs have been obtained directly from microfilariae of any Onchocerca species. Onchocerca gibsoni nodules were collected on the day of processing from brisket cuts at local abattoirs. After release from the fragmented female tissue, microfilariae were purified by centrifugation on Percoll step gradients (Catmull et al., in preparation). After centrifugation, the material was examined Onchocerca
of
voIvulus
*To whom all correspondence should be addressed. 685
microscopically and judged to be > 95% viable larvae. The pooled larval material (0.65 g from 50 to 70 Percoll gradients) was ground in a pestle and mortar with liquid nitrogen and extracted essentially as described by Donelson, Duke, Moser, Zeng, Erondu, Lucius, Renz, Karam & Flores (1988), except that 4 Mguanidine isothiocyanate was used. Yields of DNA and RNA were approximately 600 and 400 pg, respectively. Approximately 40 pg of unfractionated RNA was used for cDNA synthesis, using oligo (dT),2_,6 to prime Moloney murine reverse transcriptase, followed by second-strand synthesis by the Gubler & Hoffmann (1983) method. cDNAs were ligated into the EcoRI sites of pUCl8 or ;Igt 11, using EcoRI/NotI adaptors. The product encoded by the insert in cDNA clone OG#ll was recognized strongly by sera from individuals known to be infected by O.volvulus, whereas control sera (Tasmanian individuals) did not react. Dilutions of 1:200 of three pooled ‘Sowda’ sera (obtained by Dr B. Copeman from WHO) reacted strongly with the OG#ll encoded polypeptide, whereas pooled Tasmanian serum did not react significantly. Hence OG#l 1 encodes an antigen which is apparently common to O.gibsoni and O.volvulus. The nucleotide sequence of the 438 bp insert in cDNA clone OG#l 1 contained five copies of an 87 nt repetitive unit, individual copies varying at a maximum of four positions (Fig.1). The antigen thus consists of a 29 amino acid repeating unit. Very similar cDNA clones have been isolated from O.voZvuIus cDNA libraries (Catmull et al., in preparation).
J. CATMULL, Z. DAN andD.J.
686
MILLER
~GAAAAAGGCGGAAGTTAAGATGGAGCACCTAAGGAAGAAATAGTTG~GAGATG~GCCAAAAGAGAAGATTGTT~GAT LyrLysLysLysAlaGluValLysMe(GluGlnProLysGluGl"lleValGluGluMerLysProLysGluLyslleValGluAsp
~GAAAAAGGCGGAAGTTAAGATGGAGCAACCTAIlAGAAGATTGTTGAAGCGATGAAACCGGTTGTTGAAGAT LysLysLysLysAlaGluValLysMetGluGlnProLysGluGl”ll
eValGIuAlaMe~LyaProLysGluLysValValGIuAs~
FIG. 1. Nucleotideand predicted amino acidsequenceof cDNA clone pJCOG#l I. The 87 bp blocks of sequence are shown aligned. Across the five repeat units there are eight positions of nucleotide sequence variation; five of these are probably at the third position in the codon, whereas only three non-redundant substitutions occur.
(A)
(B)
FIG.~. Copy number estimation. A single nylon filter was loaded with O.gibsoni genomic DNA and excised clone pJCOG#l 1 insert, hybridized with radiolabelled excised
clone pJCOG#ll
insert, washed to high stringency and
exposed to autoradiography. Loadings were (A) excised clone pJCOG#l 1 insert DNA: 3, 1, 0.5, 0.3, 0.1, 0.05, 0.03, 0.01,0.005 pg, (B) genomic O.gibsoni DNA: 100, 75, 50,25, IO,8 pg.
Comparative hybridization experiments, in which slot blots of both genomic DNA and excised pJCOG#ll insert were probed with OG#ll insert (Fig.S), implied a copy number for the 87 bp repeat unit of approximately 700 per haploid genome, assuming a genome size similar to that of O.volvuZus (1.5 x 10’ base pairs; Donelson et al., 1988). Use of
excised OG#l 1 insert as hybridization probe against Southern blots of genomic digests generated complex patterns when using enzymes likely to cut within the 87 bp repeat units (Mae11 and AluI), whereas a wide range of other enzymes known not to cut within the units gave single hybridizing bands of > 10 kbp. These results implied that the 87 bp repeat units in clone OG#ll were present in the genome in long tandem arrays. Consistent with this pattern of organization, clones hybridizing strongly with OG#l 1occurred with low frequency (~0.2%) in an O.gibsoni aEMBL3 genome library. When used as a hybridization probe OG#ll detected less than 0.1 ng of O.gibsoni genomic DNA on slot blots; the sensitivity of this probe suggests that it would be suitable for detection of a single O.gibsoni or O.gutturosa larva (Murray, Post, Crampton, McCall & Kouyate, 1988) in limited samples of candidate insect vectors. Acknowledgmenrs-The authors gratefully acknowledge the assistance of S. More, A. Putra and M. Patterson in the collection and processing ofparasite material, and the overall support and assistance of B. Copeman. The excellent technical assistance of M. Flanagan is also acknowledged. REFERENCES CABRERA Z. & PARKHOUSE R.M.E. 1986. Identification of antigens of Onchocerca volvulusand Onchocerca gibsoni for diagnostic use. Molecular and Biochemical Parasitology 20: 225-23 1. CABRERA Z. & PARKHOUSE R.M.E. 1987. Isolation of an antigenic fraction for diagnosis of onchocerciasis. Parasite Immunology 9: 3948. COPEMAN D.B. 1979. An evaluation of the bovineOnchocerca gibsoni, Onchocerca gutrurosa model as a
Research Note
687
tertiary screen for drugs against Onchocerca volvulus in MURRAYK.A., POSTR.J., CRAMPTON J.M., MCCALLP.J. & man. Tropenmedizin und Parasitologic 30: 469474. KOUYATEB. 1988. Cloning and characterization of a DONELSON J.E., DUKEB.O.L., MOSERD., ZENGW., ERONDU species-specific repetitive DNA sequence from Onchocerca N.E., LUCIUSR., RENZA., KARAMM. & FLORES G.Z. 1988. armillata. Molecular and Biochemical Parasitology 301 Construction of Onchocerca volvulus cDNA libraries and 209-216. partial characterization of the cDNA for a major antigen. PARKHOUSER.M.E., CABRERAZ. & HARNEI-TW. 1987. Molecular and Biochemical Parasitology 31: 241-250. Onchocerca antigens in protection, diagnosis and pathology. GUBLERU.&HOFFMANNB.J. 1983.Asimpleandveryefficient In: Filariasis (Edited by EVEREDD. & CLARKS.), pp. 125method for generating cDNA libraries. Gene 25: 263-269. 145. Wiley, Chichester (Ciba Foundation Symposium 127).
Parasilology
Vol. 22, No. 5, pp. 685-687,
1992 0
002~7519/92 $5.00 + o.cfJ Pergamon Press Lrd Sociery~oor Porasirology
1992 Ausrrolion
RESEARCHNOTE NUCLEOTIDE SEQUENCE OF A cDNA FROM ONCHOCERCA ENCODING A NOVEL REPETITIVE ANTIGEN
GZBSONZ
JULIAN CATMULL, ZHANG DAN and DAVID J. MILLER* Department of Chemistry and Biochemistry, James Cook University of North Queensland, Townsville, Queensland 4811, Australia (Received 24 March 1992; accepted 30 March 1992)
AbSfTaCt-CATMULL J., DANZ. and MILLER D.J. 1992. Nucleotide sequence of a cDNA from Onchocerca gibsoniencoding a novel repetitive antigen. International Journalfor Parasitology 22: 685-687. mRNA from uterine microfilariae of the cattle parasite Onchocerca gibsoni was used for the construction of cDNA libraries. A cDNA clone encoding an antigen recognized by serum from human individuals infected with O.volvulus was found to contain five copies of an 87 bp unit. These 87 bp units were present in the gensme in high copy number as long tandem arrays. These are the first cDNA sequence data obtained directly from larvae of any Onchocerca species.
INDEX KEY WORDS: Onchocerca gibsoni; cDNA library; microfilariae; antigen genes; repetitive sequences.
THE
microfilariae
the parasitic nematode are responsible for the pathological symptoms known as onchocerciasis, or ‘river blindness’, a disease which afflicts at least 18 million people throughout sub-Saharan Africa and Latin America. Determination of the antigen composition of the microfilariae is mandatory for understanding the mechanism(s) by which these larvae are able to evade the host immune system during this process. Immunological studies on O.voZvulus microfilariae have been limited by the availability of parasite material. Antigen analysis (Cabrera & Parkhouse, 1986, 1987; Parkhouse, Cabrera & Harnett, 1987) drug susceptibility (Copeman, 1979) and many other comparative studies have established that O.gibsoni, which commonly infects cattle in northern Australia, is the best available animal model for the human parasite. Here we report the generation of cDNA libraries for uterine microfilariae of O.gibsoni; this is the first time that cDNAs have been obtained directly from microfilariae of any Onchocerca species. Onchocerca gibsoni nodules were collected on the day of processing from brisket cuts at local abattoirs. After release from the fragmented female tissue, microfilariae were purified by centrifugation on Percoll step gradients (Catmull et al., in preparation). After centrifugation, the material was examined Onchocerca
of
voIvulus
*To whom all correspondence should be addressed. 685
microscopically and judged to be > 95% viable larvae. The pooled larval material (0.65 g from 50 to 70 Percoll gradients) was ground in a pestle and mortar with liquid nitrogen and extracted essentially as described by Donelson, Duke, Moser, Zeng, Erondu, Lucius, Renz, Karam & Flores (1988), except that 4 Mguanidine isothiocyanate was used. Yields of DNA and RNA were approximately 600 and 400 pg, respectively. Approximately 40 pg of unfractionated RNA was used for cDNA synthesis, using oligo (dT),2_,6 to prime Moloney murine reverse transcriptase, followed by second-strand synthesis by the Gubler & Hoffmann (1983) method. cDNAs were ligated into the EcoRI sites of pUCl8 or ;Igt 11, using EcoRI/NotI adaptors. The product encoded by the insert in cDNA clone OG#ll was recognized strongly by sera from individuals known to be infected by O.volvulus, whereas control sera (Tasmanian individuals) did not react. Dilutions of 1:200 of three pooled ‘Sowda’ sera (obtained by Dr B. Copeman from WHO) reacted strongly with the OG#ll encoded polypeptide, whereas pooled Tasmanian serum did not react significantly. Hence OG#l 1 encodes an antigen which is apparently common to O.gibsoni and O.volvulus. The nucleotide sequence of the 438 bp insert in cDNA clone OG#l 1 contained five copies of an 87 nt repetitive unit, individual copies varying at a maximum of four positions (Fig.1). The antigen thus consists of a 29 amino acid repeating unit. Very similar cDNA clones have been isolated from O.voZvuIus cDNA libraries (Catmull et al., in preparation).
J. CATMULL, Z. DAN andD.J.
686
MILLER
~GAAAAAGGCGGAAGTTAAGATGGAGCACCTAAGGAAGAAATAGTTG~GAGATG~GCCAAAAGAGAAGATTGTT~GAT LyrLysLysLysAlaGluValLysMe(GluGlnProLysGluGl"lleValGluGluMerLysProLysGluLyslleValGluAsp
~GAAAAAGGCGGAAGTTAAGATGGAGCAACCTAIlAGAAGATTGTTGAAGCGATGAAACCGGTTGTTGAAGAT LysLysLysLysAlaGluValLysMetGluGlnProLysGluGl”ll
eValGIuAlaMe~LyaProLysGluLysValValGIuAs~
FIG. 1. Nucleotideand predicted amino acidsequenceof cDNA clone pJCOG#l I. The 87 bp blocks of sequence are shown aligned. Across the five repeat units there are eight positions of nucleotide sequence variation; five of these are probably at the third position in the codon, whereas only three non-redundant substitutions occur.
(A)
(B)
FIG.~. Copy number estimation. A single nylon filter was loaded with O.gibsoni genomic DNA and excised clone pJCOG#l 1 insert, hybridized with radiolabelled excised
clone pJCOG#ll
insert, washed to high stringency and
exposed to autoradiography. Loadings were (A) excised clone pJCOG#l 1 insert DNA: 3, 1, 0.5, 0.3, 0.1, 0.05, 0.03, 0.01,0.005 pg, (B) genomic O.gibsoni DNA: 100, 75, 50,25, IO,8 pg.
Comparative hybridization experiments, in which slot blots of both genomic DNA and excised pJCOG#ll insert were probed with OG#ll insert (Fig.S), implied a copy number for the 87 bp repeat unit of approximately 700 per haploid genome, assuming a genome size similar to that of O.volvuZus (1.5 x 10’ base pairs; Donelson et al., 1988). Use of
excised OG#l 1 insert as hybridization probe against Southern blots of genomic digests generated complex patterns when using enzymes likely to cut within the 87 bp repeat units (Mae11 and AluI), whereas a wide range of other enzymes known not to cut within the units gave single hybridizing bands of > 10 kbp. These results implied that the 87 bp repeat units in clone OG#ll were present in the genome in long tandem arrays. Consistent with this pattern of organization, clones hybridizing strongly with OG#l 1occurred with low frequency (~0.2%) in an O.gibsoni aEMBL3 genome library. When used as a hybridization probe OG#ll detected less than 0.1 ng of O.gibsoni genomic DNA on slot blots; the sensitivity of this probe suggests that it would be suitable for detection of a single O.gibsoni or O.gutturosa larva (Murray, Post, Crampton, McCall & Kouyate, 1988) in limited samples of candidate insect vectors. Acknowledgmenrs-The authors gratefully acknowledge the assistance of S. More, A. Putra and M. Patterson in the collection and processing ofparasite material, and the overall support and assistance of B. Copeman. The excellent technical assistance of M. Flanagan is also acknowledged. REFERENCES CABRERA Z. & PARKHOUSE R.M.E. 1986. Identification of antigens of Onchocerca volvulusand Onchocerca gibsoni for diagnostic use. Molecular and Biochemical Parasitology 20: 225-23 1. CABRERA Z. & PARKHOUSE R.M.E. 1987. Isolation of an antigenic fraction for diagnosis of onchocerciasis. Parasite Immunology 9: 3948. COPEMAN D.B. 1979. An evaluation of the bovineOnchocerca gibsoni, Onchocerca gutrurosa model as a
Research Note
687
tertiary screen for drugs against Onchocerca volvulus in MURRAYK.A., POSTR.J., CRAMPTON J.M., MCCALLP.J. & man. Tropenmedizin und Parasitologic 30: 469474. KOUYATEB. 1988. Cloning and characterization of a DONELSON J.E., DUKEB.O.L., MOSERD., ZENGW., ERONDU species-specific repetitive DNA sequence from Onchocerca N.E., LUCIUSR., RENZA., KARAMM. & FLORES G.Z. 1988. armillata. Molecular and Biochemical Parasitology 301 Construction of Onchocerca volvulus cDNA libraries and 209-216. partial characterization of the cDNA for a major antigen. PARKHOUSER.M.E., CABRERAZ. & HARNEI-TW. 1987. Molecular and Biochemical Parasitology 31: 241-250. Onchocerca antigens in protection, diagnosis and pathology. GUBLERU.&HOFFMANNB.J. 1983.Asimpleandveryefficient In: Filariasis (Edited by EVEREDD. & CLARKS.), pp. 125method for generating cDNA libraries. Gene 25: 263-269. 145. Wiley, Chichester (Ciba Foundation Symposium 127).
