Theriogenology 82 (2014) 1154–1164

Contents lists available at ScienceDirect

Theriogenology journal homepage: www.theriojournal.com

Prolactin affects bovine oocytes through direct and cumulus-mediated pathways Irina Y. Lebedeva a, b, *, Galina N. Singina a, Natalia A. Volkova a, Morten Vejlsted b, Natalia A. Zinovieva a, Mette Schmidt b a

Center of Animal Biotechnology and Molecular Diagnostics, Russian Research Institute of Animal Breeding, Dubrovitsy-Podolsk, Russia Department of Large Animal Sciences, Veterinary Reproduction and Obstetrics, Faculty of Life Sciences, University of Copenhagen, Copenhagen, Denmark b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 17 March 2014 Received in revised form 18 July 2014 Accepted 2 August 2014

The available evidence points to participation of PRL in regulation of mammalian oocyte maturation. The aim of the present study was to characterize pathways of PRL action on bovine oocytes. We analyzed (1) the presence of the PRL receptor and its mRNA isoforms in oocytes and cumulus cells; (2) the effect of PRL on meiosis resumption and the role of cumulus cells, the NO/NO synthase system, protein kinase C, and tyrosine kinases in this effect; and (3) PRL effects in the presence of gonadotropins on the developmental capacity of cumulus-free and cumulus-enclosed oocytes. The transcript and protein expression of the PRL receptor in the cells were detected by reverse transcription polymerase chain reaction and immunocytochemistry, respectively. The nuclear status of oocytes was assessed after culture of cumulus–oocyte complexes (COCs) and denuded oocytes (DOs) with or without PRL (5–500 ng/mL) for 7, 14, or 24 hours. Besides, DOs were incubated for 7 hours in the absence or the presence of PRL (50 ng/mL) and/or L-NAME (an inhibitor of NO synthase), genistein (an inhibitor of tyrosine kinases), or calpostin C (a protein kinase C inhibitor). After IVM in 2 different systems containing PRL (50 ng/mL) and/or gonadotropic hormones, a part of oocytes underwent IVF and IVC and the embryo development was tracked until the blastocyst stage. Messenger RNA of long and short isoforms of the PRL receptor was revealed in both oocytes and cumulus cells. Immunocytochemistry confirmed the presence of the PRL receptor in oocytes and the cumulus investment. In the absence of gonadotropins (system 1), PRL retarded meiosis resumption in DOs but not in cumulus-enclosed oocytes, with this effect being short term, dose dependent, suppressed by L-NAME and genistein, and unaffected by calpostin. In systems containing gonadotropins, PRL did not affect nuclear maturation and the cleavage rate of cumulus-free and cumulus-enclosed oocytes. However, in the case of COCs, it raised the blastocyst yield both in system 2 (from 20.5%–40.9%, P < 0.01) and in system 3 (from 21.7%–33.9%, P < 0.05). The findings show for the first time the functioning of the direct pathway of PRL signaling into bovine oocytes, as confirmed by the expression of receptors of PRL and its direct meiosisretarding effect involving activation of tyrosine kinases and NO synthase. Furthermore, this is the first demonstration that the beneficial effect of PRL on the oocyte developmental capacity is achieved via cumulus cells containing PRL receptors. Ó 2014 Elsevier Inc. All rights reserved.

Keywords: PRL receptor Meiosis resumption Oocyte developmental capacity Cumulus cells Signaling pathways

* Corresponding author. Tel.: þ7 4967 651398; fax: þ7 4967 651151. E-mail address: [email protected] (I.Y. Lebedeva). 0093-691X/$ – see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2014.08.005

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

1. Introduction A pituitary hormone PRL is one of the key regulators of mammalian ovarian function, as clearly demonstrated using PRL receptor knockout mice [1]. The respective homozygous females are infertile in consequence of numerous reproductive disturbances, including the decreased ovulation and fertilization rates of oocytes and the reduced developmental capacity of embryos. Thus, the normal process of the mouse egg formation is disrupted in the absence of functional PRL receptors. Prolactin is likely to be involved in the regulation of oocyte maturation in other mammalian species as well. After superovulation treatment of heifers, a higher PRL concentration was found in the fluid of medium and large follicles containing more viable oocytes [2]. In women, the plasma and intrafollicular levels of PRL were positively related to the oocyte quality and fertilization rate [3,4]. Meanwhile, a diminished responsiveness of follicular cells to PRL may be one of the reasons of the human infertility [5]. In addition, PRL receptors or their mRNA were detected in oocytes and surrounding cumulus cells of sheep, rats, and mice, suggesting the sensitivity of both cell types to the hormone action [6–8]. In most investigated mammalian species, at least 2 isoforms of the PRL receptor have been found to be expressed in different tissues [1,9]. They are encoded by a single gene and arise by alternative splicing of the primary transcript [10]. It has been previously believed that the long isoform of the receptor is responsible for PRL signaling into target cells, whereas its short isoform(s), characterized by a truncated cytoplasmic domain, is a negative modulator of the signal induced through the long isoform [1]. However, according to recent evidence, the short isoform can activate specific signal cascades and cooperate with the long isoform, with both isoforms being able to prevent excessive signaling of each other [9,11]. By now, the expression of multiple isoforms of the PRL receptor has been revealed in ovine, rat, and murine oocytes and cumulus cells [6–8]. The notion that PRL participates in the regulation of mammalian oocyte maturation is further supported by the data obtained with the use of the in vitro culture model. The addition of PRL to the IVM medium containing LH and FSH enhanced the developmental potential of rabbit oocytes in a dose-dependent manner [12]. In the absence of gonadotropic hormones, PRL exerted the beneficial influence on the nuclear maturation and quality of bovine oocytes, whereas its effect on the subsequent yield of blastocysts was not observed except during coculture of oocytes with mural granulosa cells [13,14]. Moreover, the maturation rate and developmental capacity of mouse preantral oocytes cultured in the presence of FSH were positively affected by PRL [15]. In all the previously listed investigations, mammalian cumulus-enclosed oocytes were used for testing the hormone effects, so it was not possible to conclude whether PRL acts on oocytes directly or through surrounding cumulus cells. Molecular mechanisms mediating PRL actions on oocytes are also poorly understood yet [13,16]. In somatic follicular cells, PRL has been shown to activate signal cascades dependent on tyrosine kinases and protein

1155

kinase C [17–19], which in turn may be involved in meiosis regulation [20,21]. In addition, PRL was able to stimulate accumulation of nitric oxide (NO), another meiotic modulator [22], and the respective NO synthase (NOS) activity in mammary epithelial cells [23]. The aim of the present research was to study an implication of direct and cumulus-mediated pathways in PRL actions on meiosis and the developmental capacity of bovine oocytes. With this purpose, we analyzed (1) the presence of the PRL receptor and its mRNA isoforms in oocytes and cumulus cells; (2) the effect of PRL on meiosis resumption and the role of cumulus cells, the NO/NOS system, protein kinase C, and tyrosine kinases in this effect; and (3) PRL effects in the presence of gonadotropic hormones on the developmental capacity of cumulus-free and cumulus-enclosed oocytes. To assess the involvement of the previously mentioned signal pathways in the meiosismodulating action of PRL, the influence of L-NAME (an inhibitor of NOS), genistein (a nonselective inhibitor of tyrosine kinases), and calpostin C (a protein kinase C inhibitor) on the PRL action was examined. In addition, PRL effects on the developmental capacity of bovine oocytes were studied using 2 different IVM systems containing gonadotropic hormones, because PRL did not affect this capacity in the absence of LH and FSH, as mentioned previously [14]. 2. Materials and methods Unless otherwise stated, all media and chemicals were purchased from Sigma–Aldrich Chemical Co. (St. Louis, MO, USA or Vallensbaek, Denmark). 2.1. Oocyte collection, handling, and in vitro maturation Slaughterhouse-derived bovine ovaries were transported to the laboratory in a thermo box with sterile saline at 30  C to 35  C, and cumulus–oocyte complexes (COCs) were obtained by aspiration or wall dissection of 2- to 8mm antral follicles. The oocyte retrieval and handling were performed in a basic wash medium or modified wash medium. The basic wash medium was HEPES-buffered TCM-199 containing 2-mg/mL BSA and 50-mg/mL gentamycin sulfate. The modified wash medium was the basic wash medium supplemented with 0.5-mM 3-isobutyl-1methylxanthine; it was used in the case of COCs and denuded oocytes (DOs) assigned for in vitro embryo production. This approach was applied in accordance with the notion that maintaining oocytes in meiotic arrest before IVM using cAMP-elevating agents can improve their developmental competence [24]. The COCs were washed twice in the respective media and selected under a stereomicroscope. Only oocytes with a complete, compact, multilayer cumulus and finely granulated homogenous ooplasm were used for the study. A portion of the selected oocytes was denuded of their cumulus cells by incubating the COCs in the previously mentioned wash media supplemented with 2-mg/mL collagenase (type II) for 20 minutes at 37  C and subsequent gentle pipetting through a fine-needle pipette (with the hole diameter of 130 mm). The DOs were washed twice from

1156

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

collagenase and examined under an inverted light microscope (at magnification 200) to ensure the complete removal of cumulus cells. Groups of COCs or DOs were cultured in 500 mL of media at 38.5  C under 5% CO2 in humidified air. The following culture media were used: (1) HEPES-buffered TCM-199 (with Earle’s salts and L-glutamine), containing 2.5-mM calcium lactate, 2-mM sodium pyruvate, and 50-mg/mL gentamycin, supplemented with 10% (v:v) fetal calf serum (FCS), subsequently referred to as IVM system 1; (2) Dulbecco modified Eagle medium (DMEM), containing 1-mg/ mL glucose, 1-mM sodium pyruvate, 4-mM L-glutamine, and 50-mg/mL gentamycin, supplemented with 5% (v:v) estrus cow serum (ECS; Danish Institute for Food and Veterinary Research, Copenhagen, Denmark), 10 IU/mL eCG, and 5 IU/mL hCG (Suigonan Vet; Intervet Denmark A/ S, Skovlunde, Denmark), subsequently referred to as IVM system 2; and (3) the medium of system 1 supplemented with 10-mg/mL porcine FSH and 5-mg/mL ovine LH, subsequently referred to as IVM system 3. 2.2. Design of culture experiments Bovine pituitary PRL (20 IU/mg; Research Center for Endocrinology, Moscow, Russia) tested previously by other research groups [13,16] was used in all IVM experiments. Frozen aliquots of a stock solution (50-mg/mL PRL in saline) were diluted by the respective media immediately before culture. System 1 was applied to examine effects of PRL on meiotic resumption in cumulus-free and cumulus-enclosed oocytes. In the first experiment, the oocytes were incubated for 7 hours in the presence of different concentrations of PRL (0, 5, 20, 50, 150, and 500 ng/mL in the case of DOs; 0, 5, 50, and 500 ng/mL in the case of COCs). In the second experiment, cumulus-free oocytes were cultured with and without PRL (50 ng/mL) for 7, 14, and 24 hours. In the third experiment, DOs were incubated for 7 hours in the absence or the presence of PRL (50 ng/mL) and/or N(omega)-nitro-larginine methyl ester hydrochloride (L-NAME, 20 mM), an inhibitor of NOS. In the fourth experiment, DOs were cultured for 7 hours in the absence and the presence of PRL (50 ng/mL), genistein (a nonselective inhibitor of tyrosine kinases; 10 mg/mL; ICN Biomedicals, Aurora, OH, USA), calpostin C (a protein kinase C inhibitor; 100 nM; Calbiochem, Darmstadt, Germany), or PRL with genistein or calpostin C. At the end of culture, all oocytes were fixed to determine their nuclear status. For evaluation of PRL effects on the developmental capacity of oocytes, COCs and DOs were matured with and without PRL (50 ng/mL) for 22 to 24 hours in system 2 or system 3. After IVM, a portion of the oocytes was used to evaluate their nuclear maturation. The residuary oocytes were inseminated. After 20 to 22 hours coincubation with sperm, a part of presumptive zygotes were fixed to assess the fertilization rate. The remaining cells were cultured for 24 hours, and the cleavage rate was determined at Day 2 after insemination. All embryos were cultured until Day 8 after insemination, and the blastocyst formation was evaluated. At the end of culture, the embryos were fixed and their nuclei were counted.

2.3. In vitro fertilization and embryo culture In vitro fertilization of bovine oocytes and IVC of embryos were performed in accordance with the procedures described previously [25]. Briefly, cumulus-enclosed and cumulus-free oocytes matured in system 2 or system 3 were washed once in Tyrode albumin lactate pyruvate medium supplemented with 30-mg/mL heparin, 20-mM penicillamine, 10-mM hypotaurine, and 1-mM epinephrine and transferred to 4-well dishes containing 400 ml of the same medium. Groups of 25 to 30 COCs or DOs were coincubated for 20 to 22 hours with frozen-thawed washed sperm from bulls of proven fertility at a final concentration of 2.5  106 cells/mL at 38.5  C under 5% CO2 in humidified air. After IVF, groups of 20 to 25 presumptive zygotes were placed in 100-mL droplets of SOFaaci medium (synthetic oviductal fluid containing essential and nonessential amino acids) supplemented with 5% (v:v) ECS covered with mineral oil and cultured at 38.5  C in a humidified atmosphere containing 5% CO2, 5% O2, and 90% N2. 2.4. Assessment of oocyte nuclear maturation, fertilization, and embryo development To evaluate nuclear maturation and fertilization of oocytes, cytogenetic preparations were performed by the method of Tarkowski [26] with some modifications [13]. The state of the nuclear material was examined under a light microscope (Carl Zeiss, Jena, Germany) at magnification 1000. Meiotic stages of oocytes were determined using criteria described by Homa [27]. Inseminated oocytes containing pronuclei were considered as fertilized. Embryo development was assessed under a stereomicroscope at Days 2 and 8 after insemination for cleavage and blastocyst formation. In addition, nuclei of the embryos were counted to confirm the developmental stage. After culture, the embryos were incubated in 0.9% (wt/vol) sodium citrate for 30 minutes, fixed using the methanol– acetic acid mixture (3:1, v:v), air dried, stained with 5% (v:v) Giemsa solution, and examined under the light microscope at magnification 400. 2.5. Immunocytochemical analysis Freshly isolated COCs and DOs were washed twice in PBS containing 0.2% (wt/vol) BSA (PBS-BSA) and fixed with 4% (wt/vol) paraformaldehyde in PBS for 20 minutes. Furthermore, some DOs were fixed with the mixture of methanol and acetic acid, as described previously [13]. Then the specimens were washed 3 times with PBS-BSA and permeabilized with 0.1% (v:v) Triton X-100 in PBS-BSA for 30 minutes. Nonspecific binding was blocked by incubating the COCs and DOs with 10% (v:v) goat serum (Vector Laboratories, Burlingame, CA, USA) in PBS containing 1% (wt/vol) BSA for 1 hour at room temperature. The specimens were incubated with mouse anti-PRL receptor monoclonal antibody (MA1-610; Thermo Scientific, Rockford, IL, USA; 1:50 dilution) overnight at 4  C and then with biotinylated goat antimouse antibody (Vector Laboratories, Burlingame, CA, USA; 1:500 dilution) for 30 minutes at room temperature. The primary antibody used reacts both with long and short

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

PRL receptor isoforms and detects the receptor in tissues of different mammalian species including ruminants. All antibodies were diluted in PBS containing 1% (wt/vol) BSA and 3% (v:v) goat serum. For visualization of the specific staining, Vectastain ABC reagent and 3,30 -diaminobenzidine (DAB) or 3-amino-9-ethylcarbazole (AEC) substrates (Vector Laboratories, Burlingame, CA, USA) were applied for DOs or COCs, respectively. The specimens fixed in paraformaldehyde were counterstained by hematoxylin and mounted in a droplet of the glycerol-PBS mixture (1:3, v:v). Air dried preparations of DOs were counterstained with 5% (v:v) Giemsa solution. All specimens were evaluated for the presence of the PRL receptor using the light microscope at magnification 400 or 200. Layers of membrana granulosa fixed with 4% (wt/vol) paraformaldehyde and processed as described previously were used as a positive control. Specificity of the immunodetection was proved by several negative controls: (1) omission of the first antibody, (2) omission of the secondary antibody, and (3) incubation with DAB or AEC alone to show the absence of endogenous peroxidases. A total of 41 DOs and 35 COCs fixed with paraformaldehyde and 16 DOs fixed with the methanol–acetic acid mixture were used for immunocytochemical analysis. 2.6. Cell and tissue processing and RNA isolation Ovaries with developed CL were transported to the laboratory in ice-cold saline. The respective CLs were immediately separated from the ovaries, cut into small pieces, frozen rapidly in liquid nitrogen, and stored at 70  C until RNA extraction. Granulosa cells were derived by aspiration of the fluid from follicles 3 to 5 mm in diameter. After COC removal, the fluid was centrifuged at 300 g for 10 minutes, and the viability of granulosa cells was determined using the trypan blue exclusion technique. The cell suspension with no less than 70% of viable cells was used for RNA isolation. Bovine DOs were obtained as stated previously and washed twice in cold (4  C) PBS. Cumulus cells isolated from the respective COCs as well as granulosa cells were washed twice in the cold PBS by centrifugation at 300 g for 10 minutes. After PBS removal, 400 mL of TRI Reagent (Sigma–Aldrich) were added to the tubes containing 50 to 100 DOs or (1–2)  106 cumulus or granulosa cells. All cells were immediately lysed by repeated pipetting in the reagent, and the samples were stored at 70  C for up to

1157

1 month. At least 3 different sets of samples of each cell type were prepared for the assay. Total RNA was isolated from the cell samples and CL pieces (25–50 mg) using TRI Reagent in accordance with the manufacturer’s directions. The RNA pellet was stored in 75% (v:v) ethanol at 20  C for no more than 2 months.

2.7. Reverse transcription and polymerase chain reaction Samples of total RNA were centrifuged at 12000 g for 10 minutes at 4  C, air dried, dissolved in 15 mL of nucleasefree water at 60  C for 10 minutes, and immediately placed on ice. Reverse transcription (RT) was carried out on the total RNA preparations (somatic cells, 1 mg; oocytes, 0.2 mg) using random hexamer primers (0.2 or 0.04 mg, respectively) and RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas Life Sciencies, Vilnius, Lithuania) according to the manufacturer’s protocol. In negative controls, total RNA was replaced by nuclease-free water. In all instances, omitting RNA in the RT reaction produced no amplified fragments in the subsequent polymerase chain reaction (PCR). Oligonucleotide primers were designed so that the amplified fragments extended from exon 7 to exon 10, discriminating products from genomic DNA and cDNA. In the case of somatic ovarian cells, cDNA of bovine PRL receptor isoforms was amplified using the following oligonucleotides: (1) a sense primer (primer 1) from the coding region common to long (l-PRLR) and short (s-PRLR) isoforms; (2) an antisense primer (primer 2) specific for the long isoform; and (3) an antisense primer (primer 3) specific for the short isoform (Table 1). Primers for bovine b-actin (internal control) were sense: 50 -GGGTCACCCACACGGTGCCCATCT-30 and antisense: 50 -GAAGCATTTGCGGTGGACAATGGAGG-30 , amplifying a fragment of 653 bp [28]. All primers were purchased from Syntol (Moscow, Russia). Polymerase chain reaction was performed with 2 mL of the RT product in an incubation mixture (a final volume of 15 mL) containing 1 Taq DNA polymerase buffer, 0.2 mM of each dNTP (Fermentas), 1.5-mM MgCl2 (Merck, Darmstadt, Germany), 1 IU of Taq DNA polymerase (Fermentas), and 0.33 mM of each primer. Different combinations of primers for the PRL receptor (primer 1 þ primer 2, primer 1 þ primer 3, and primer 1 þ primer 2 þ primer 3) or the primer pair for bovine actin was added to each PCR tube. After heating at 95  C for 5 minutes, amplification was carried out for 38 cycles of 30 seconds at 95  C, 30 seconds at 54  C (both PRL

Table 1 Primers used for amplification of cDNA for PRL receptor isoforms. cDNA The first round of PCR l-PRLR s-PRLR The second round of PCR l-PRLR s-PRLR

Primer sequence (50 –30 )

Accession number

Product size (bp)

F: CAAGCCAGACCATGGATACT (primer 1) R: GCTGGTCCTCACAGTCATCT (primer 2) F: CAAGCCAGACCATGGATACT (primer 1) R: GCGAGAAGGCTGTGATATCT (primer 3)

NM_001039726

347

NM_174155

250

F: ATACTGGAGTGAGTGGAGCC (primer 4) R: CTCCAGCAGATGAACATCAA (primer 5) F: ATACTGGAGTGAGTGGAGCC (primer 4) R: CTCCAGCAGATGAACATCAA (primer 5)

NM_001039726

217

NM_174155

217

1158

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

receptor isoforms) or at 60  C (actin), 90 seconds at 72  C followed by 7 minutes extension at 72  C and cooling to 4  C. For oocytes, nested PCR was used. In the first round, PCR was performed as described previously using 1 of 2 primer combinations: (1) primer 1 þ primer 2 or (2) primer 1 þ primer 3. Thus, only cDNA either for the long isoform or for the short isoform could be amplified. In the second round of PCR, the incubation mixture contained 1 mL of PCR products of the first round instead of 2 mL of RT products and an inner primer pair, common for both PRL receptor isoforms (Table 1), at a final concentration of 0.6 mM. The second round of PCR was carried out for 30 cycles using the previously mentioned program. The PCR products were subjected to electrophoresis in 2% agarose gels (Life Technologies; Gaithersburg, USA) stained with dimidium bromide (Boehringer, Ingelheim, Germany). On completion of electrophoresis, gels were photographed under ultraviolet light using a gel documentation system (Biometra GmbH, Goettingen, Germany). The respective DNA fragments were sequenced to confirm their identity using BigDye Terminator v3.1 Cycle Sequencing Kit and 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). The RT-PCR assay of each cell type was repeated at least 3 times. For 1 replication, 50 to 100 DOs, (1–2)  106 cumulus or granulosa cells, or 25 to 50 mg of CL were used. 2.8. Statistical analysis All treatments in culture experiments were repeated 4 to 7 times. The numbers of oocytes used per each treatment are indicated in the figure legends. Results were expressed as means  standard error of the mean. Data were analyzed by one-way or two-way ANOVA followed by the Tukey’s HSD test using SigmaStat software package. If the data expressed as percentages did not meet the assumption of normal distribution or homogeneity of variance, they were arcsine transformed before analysis. In the case of two-way ANOVA, the statistical model included the main effects and all interactions. Independent variables were the PRL treatment and the presence of the cumulus investment or the inhibitor treatment. A probability of P < 0.05 was considered to be statistically significant. 3. Results

Fig. 1. Messenger RNA expression of PRL receptor isoforms in bovine ovarian cells as detected by RT-PCR. Amplification of cDNA was performed using combination of primers for the long and short receptor isoforms simultaneously. Lane 1: molecular size markers in base pairs (bp); lanes 2 to 4: PCR products corresponding to long (upper bands) and short (lower bands) isoforms of the PRL receptor; and lanes 5 to 7: PCR products corresponding to b-actin. Granulosa cells: lanes 2 and 5; cumulus cells: lanes 3 and 6; corpus luteum (positive control): lanes 4 and 7.

generating a strong PCR product with the expected size of 653 bp. The respective fragments (347 or 250 bp) were also detected, when primers either for the long or for the short receptor isoform were added (data not shown). Whereas, no PCR products were revealed using nuclease-free water instead of RNA (negative control). In the case of bovine oocytes, nested PCR was used to increase the yield of amplified products. On the basis of the data for the mRNA expression of both PRL receptor isoforms in bovine granulosa cells, these latter served as a positive control. The second round of amplification using the inner primer pair, common for both receptor isoforms, produced a single specific band with the predicted size of 217 bp for granulosa cells and oocytes alike (Fig. 2). However, the respective primer pair specific only for 1 of 2 isoforms was used in the first round of amplification. Thus, PCR products corresponding to either the long or the short isoform of the PRL receptor could be discriminated, confirming that both of them were expressed in the cells studied. Furthermore, the PCR products of the first round for b-actin with the expected size were detected. Concurrently, omitting RNA in the RT reaction produced no amplified fragments (negative control). 3.2. Immunocytochemical localization of the PRL receptor in bovine oocytes and cumulus cells Receptors of PRL were detected in all oocytes tested using a brown DAB-chromophore. In DOs fixed with paraformaldehyde and retained a spherical shape, the brown

3.1. Messenger RNA expression of PRL receptor isoforms in bovine oocytes and cumulus cells The presence of mRNA of 2 PRL receptor isoforms in bovine cumulus cells was analyzed by RT-PCR using the developed CL, expressing both isoforms of the receptor [29], as a positive control. Bovine granulosa cells were also used for comparison, because they have been previously shown to possess PRL-binding sites [30]. For all tested cell types, amplification of cDNA with combination of primers for long and short PRL receptor isoforms simultaneously (primer 1 þ primer 2 þ primer 3) resulted in 2 PCR products with expected sizes of 347 and 250 bp, respectively (Fig. 1). As a control for RNA isolation and cDNA production, all samples were amplified with b-actin–specific primers,

Fig. 2. Analysis of mRNA expression of PRL receptor isoforms in bovine oocytes using nested PCR. The first round of cDNA amplification was performed using the primer pair specific either for the long or short receptor isoform. In the second round, the inner primer pair common for both receptor isoforms was applied. Lane 1: molecular size markers in base pairs (bp); lanes 2 and 3: PCR products of the second round corresponding to the long isoform of the PRL receptor; lanes 4 and 5: PCR products of the second round corresponding to the short isoform of the PRL receptor; lanes 6 and 7: without RNA (negative controls for the long and short receptor isoforms); and lanes 8 and 9: PCR products of the first round corresponding to b-actin. Granulosa cells (positive control): lanes 2, 4, and 8; oocytes: lanes 3, 5, and 9.

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

staining was observed throughout the surface of the oocytes (Fig. 3A). No specific immunoreactivity was found in negative controls performed by omitting the primary antibody (Fig. 3B). In microspread oocytes fixed with the methanol– acetic acid mixture, the positive staining was localized along the plasma membrane (Supplementary Fig.1). Furthermore, most of cumulus cells showed the intensive staining with a red AEC-chromophore (Fig. 3C), whereas the specific immunoreactivity was not present in the negative controls (Fig. 3D). Layers of membrana granulosa (positive control) containing PRL-binding sites [30] also demonstrated the red staining (data not shown). Concurrently, DOs and COCs incubated without the secondary antibody or with DAB or AEC alone did not show the specific staining. 3.3. Effects of PRL on meiosis resumption in bovine oocytes Bovine PRL exerted a dose-dependent biphasic action on meiosis resumption in cumulus-free oocytes cultured in system 1 (Fig. 4). The application of PRL at concentrations of 20 to 150 ng/mL caused a rise in the rate of DOs remaining at the diplotene stage by 7 hours of incubation (at least P < 0.05), with the maximum inhibitory effect being observed at a concentration of 50 ng/mL. The meiosisinhibiting action of PRL disappeared on addition of 500 ng/mL of the hormone to the culture medium. At the same time, PRL did not affect meiotic resumption in cumulus-enclosed oocytes at all concentrations tested. So, in further experiments, 50 ng/mL of PRL were used for characterization of the hormonal influence on DOs.

1159

A detailed analysis of the time pattern of the cumulus-free oocyte nuclear maturation in system 1 demonstrated that the inhibitory action of PRL was short term and associated with meiosis resumption but not progression. Prolactin suppressed (P < 0.01) the transition of DOs from the diplotene to diakinesis stage by 7 hours of incubation (Fig. 5). However, there were no significant differences between the control and PRL-treated groups in the rates of DOs attained different stages of meiosis at 14 and 24 hours of culture. A participation of the NO/NOS system in realization of the inhibitory effect of PRL on meiosis was examined by treatment of DOs with 20-mM L-NAME, the NOS inhibitor. The dose used was in the middle of a range of L-NAME concentrations (0.1–1000 mM), which were effective in reducing the rate of bovine oocyte nuclear maturation [31]. In the control medium, L-NAME increased (P < 0.001) the rate of oocytes remaining at the diplotene stage by 7 hours of incubation (Fig. 6). On the contrary, the addition of the NOS inhibitor to the medium containing PRL resulted in a decrease of the meiosis-decelerating action of the hormone (P < 0.01). In its turn, the meiotic delay caused by L-NAME was attenuated in the presence of PRL (P < 0.01). Two-way ANOVA revealed that meiotic resumption of DOs was depended on L-NAME and the interaction between L-NAME and PRL (at least P < 0.01). An involvement of protein kinases in mechanisms of PRL signaling in bovine oocytes was studied by testing effects of 10-mg/ml genistein, the nonselective inhibitor of tyrosine kinases, and 100-nM calpostin C, the protein kinase C inhibitor, on the meiosis-decelerating influence of

Fig. 3. Immunocytochemical detection of PRL receptors in bovine oocytes and cumulus cells fixed with paraformaldehyde. Specific localizations were detected by a brown 3,30 -diaminobenzidine chromophore (oocytes) or red 3-amino-9-ethylcarbazole chromophore (cumulus). Nuclei were counterstained with hematoxylin. (A) Oocyte, positive staining (white arrows indicate nuclei). (B) Oocyte, negative control performed by omitting the primary antibody. (C) Cumulus, positive staining (black arrows indicate PRL receptor-specific immunoreaction). (D) Cumulus, negative control performed by omitting the primary antibody. Representative images of immunocytochemical analyses conducted on a total of 41 denuded oocytes and 35 cumulus–oocyte complexes are shown. Original magnification: 400.

1160

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

Fig. 4. Effects of different PRL concentrations on meiosis resumption in bovine cumulus-free (denuded) and cumulus-enclosed oocytes (cumulus– oocyte complex) cultured for 7 hours in system 1. IVM system 1: TCM-199 supplemented with 10% fetal calf serum. Dp: the diplotene stage of meiosis. Data represent means  standard error of the mean of 4 replicates using 62 to 76 oocytes per treatment. *P < 0.05, **P < 0.01 compared with the group without PRL.

Fig. 6. Individual and combined effects of PRL (50 ng/ml) and L-NAME (20 mM) on meiosis resumption in cumulus-free oocytes cultured for 7 hours in system 1. IVM system 1: TCM-199 supplemented with 10% fetal calf serum. Dp: the diplotene stage of meiosis. Data represent means  standard error of the mean of 4 replicates using 78 to 91 oocytes per treatment. Means with different letters differ significantly (at least P < 0.01).

In all IVM experiments preceding IVF and IVC, bovine PRL was used at a concentration of 50 ng/mL, which was

maximal effective in stimulating the nuclear maturation of bovine COCs in system 1 [14]. Two different IVM systems (systems 2 and 3) were applied to study an influence of PRL in the presence of gonadotropic hormones on the oocyte capacity for the further development. Concentrations of FSH/eCG and LH/hCG used in these systems were similar to those applied in IVM experiments for producing bovine embryos [33,34]. A role of cumulus cells in realization of regulatory effects of PRL was examined by comparing the hormone action on the developmental potential of bovine cumulus-enclosed and cumulus-free oocytes. In system 2, PRL did not influence the nuclear maturation and fertilization ability of either COCs or DOs (Fig. 8). The cleavage rate of the oocytes was also unaffected by the hormone (Fig. 9). However, PRL exerted a positive longterm action on the cytoplasmic maturation of COCs (but not DOs) enhancing their developmental competence after fertilization. When added to cumulus-enclosed oocytes, PRL raised the subsequent blastocyst rate (P < 0.01), with this effect being vastly dependent on the presence of the cumulus investment during oocyte maturation (P < 0.001).

Fig. 5. Dynamics of meiosis progression in bovine cumulus-free oocytes cultured in system 1 in the presence or the absence of PRL (50 ng/ml). IVM system 1: TCM-199 supplemented with 10% fetal calf serum. Meiosis stages: diplotene (Dp), diakinesis to anaphase I (Dk-AI), and telophase I to metaphase II (TI-MII). Data represent means  standard error of the mean of 4 replicates using 57 to 77 oocytes per treatment. **P < 0.01 compared with the respective control group (without PRL).

Fig. 7. Effects of genistein (10 mg/ml) and calpostin C (100 nM) on meiosis resumption in cumulus-free oocytes cultured for 7 hours in system 1 in the presence or the absence of PRL (50 ng/ml). IVM system 1: TCM-199 supplemented with 10% fetal calf serum. Dp: the diplotene stage of meiosis. Data represent means  standard error of the mean of 4 replicates using 54 to 71 oocytes per treatment. **P < 0.01 compared with the group without PRL. Between the inhibitor treatments, means with different letters differ significantly (at least P < 0.01).

PRL. These concentrations of the inhibitors were chosen because our previous experiments indicated that they are efficient enough when suppressing the modulating action of PRL on the nuclear maturation of cumulus-enclosed oocytes and/or cumulus morphology in system 1 [32]. Concurrently, genistein enhanced destructive processes in bovine oocytes at higher concentrations. It was found that meiotic resumption in DOs was affected by PRL and the interaction of PRL and genistein (P < 0.01). Genistein had no effect on the proportion of oocytes in the diplotene stage at 7 hours of DO incubation in the control medium but abolished (P < 0.01) the meiosis-decelerating influence of PRL (Fig. 7). Meanwhile, calpostin C did not suppress the inhibitory action of the hormone. 3.4. Effects of PRL on the developmental capacity of bovine oocytes

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

Fig. 8. The nuclear maturation and fertilization ability of bovine cumulusenclosed (cumulus–oocyte complex) and cumulus-free oocytes (denuded oocytes) cultured in system 2 in the presence or the absence of PRL (50 ng/ ml). IVM system 2: Dulbecco modified Eagle medium supplemented with 5% estrus cow serum, 10 IU/mL eCG, and 5 IU/mL hCG. Data represent means  standard error of the mean of 4 to 5 replicates using 56 to 115 oocytes per treatment.

Effects of PRL on COCs in system 3 were closely similar to those in system 2 (Fig. 10). No significant differences in the maturation or cleavage rates were revealed between the control and PRL-treated groups. In contrast, an increased yield of blastocysts (P < 0.05) was found after fertilization of cumulus-enclosed oocytes matured in the presence of PRL. At the same time, the hormone did not affect the developmental capacity of DOs cultured in system 3 (data not shown). 4. Discussion The findings of our research have clarified the role of direct and cumulus-mediated pathways in PRL signaling into the mammalian oocyte. The data report for the first time that, in cows, both pathways are available, functional, and involved in distinct effects of PRL on oocytes. The expression of multiple isoforms of the PRL receptor has been previously revealed in oocytes and cumulus cells of sheep, rats, and mice [6–8]. In the bovine, only mRNA of the long receptor isoform has been found in somatic cells of

Fig. 9. Effects of PRL (50 ng/ml) on the developmental cumulus-enclosed oocytes (COC) and cumulus-free oocytes (DO) during IVM in System 2. System 2: Dulbecco modified Eagle medium supplemented with 5% estrus cow serum, 10 IU/mL eCG, and 5 IU/mL hCG. Data represent means  standard error of the mean of 6 to 7 replicates using 154 to 177 oocytes per treatment. **P < 0.01 compared with the group without PRL.

1161

Fig. 10. Effects of PRL (50 ng/ml) on the nuclear maturation and developmental cumulus-enclosed oocytes during IVM in system 3. IVM system 3: TCM-199 supplemented with 10% fetal calf serum, 10 mg/mL porcine FSH, and 5 mg/mL ovine LH. Data represent means  standard error of the mean of 4 replicates using 99 to 118 oocytes per treatment. *P < 0.05 compared with the group without PRL.

COCs [35]. Meanwhile, there were no data yet regarding the expression of the PRL receptor in cow gametes. In the present study, we detected mRNA of the long and short receptor isoforms in bovine cumulus cells and oocytes alike, implying a participation of both isoforms in PRL signaling into these cells. Immunocytochemical analysis confirmed the presence of PRL receptors in the somatic and generative cells of the COCs, although it could not discriminate between the long and short receptor isoforms. Thus, this is the first demonstration of the expression of the PRL receptor both in bovine oocytes and cumulus cells. At the same time, our findings do not allow concluding what isoform of the receptor is predominant in these 2 cell types of COCs. According to present views, both long and short receptor isoforms are crucial for the ovarian function [9,11]. Therefore, the role of each receptor isoform in realization of PRL effects on bovine oocytes and cumulus cells remains to be determined. Levels of PRL in the bovine follicular fluid have been shown to amount 20 to 30 ng/mL just before the preovulatory surge of luteinizing hormone [36]. In our dose– response experiments, the significant meiosis-inhibiting effect was found at a PRL concentration of 20 ng/mL, which was within the physiological range. Prolactin inhibited meiotic resumption of DOs in a biphasic dosedependent manner typical for its effects in different mammalian systems [37,38]. Such a dose–response curve for PRL is derived from the 2-site mechanism of the binding of PRL to its receptors involving dimerization of these latter [39]. In cows, a similar pattern of PRL action on the nuclear maturation of cumulus-enclosed oocytes as well as DNA synthesis in granulosa cells has been previously revealed [14,40]. Concurrently, the maximal influence of bovine PRL on both cell types has been observed at a concentration of 50 ng/mL. In the present study, the same hormonal concentration was the most effective in decelerating meiotic resumption of DOs, indicating a similar sensitivity of different types of bovine ovarian cells to homologous PRL. The inhibitory effect of PRL on meiosis resumption in DOs was transient and disappeared by 14 hours of culture, similar to the respective effects of cAMP-elevating agents on bovine oocytes [41]. However, the meiosis-decelerating hormonal

1162

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

effect was unlikely to be achieved by increasing cAMP levels in DOs, because PRL suppressed the inhibitory action of cAMP-elevating agents on meiotic resumption in bovine oocytes [35,42]. Therefore, our further efforts were directed toward elucidating intracellular mechanisms mediating the meiosis-retarding action of PRL on bovine DOs. The cAMP-dependent signal cascade is not the only pathway controlling the meiotic arrest in mammals. In accordance with the modern notions, the NO/cyclic guanosine monophosphate (cGMP) pathway is also involved in the regulation of meiosis [41,43]. Nitric oxide is a chemical messenger synthesized from L-arginine by NOS; it stimulates production of cGMP, which in turn inhibits meiotic resumption [22]. Although cumulus cells make a primary contribution to the cGMP production in COCs, the guanylate cyclase system is also present in oocytes [22,44]. Besides, the expression of 3 isoforms of NOS, endothelial NOS (eNOS), inducible NOS, and neuronal NOS (nNOS), has been detected in both follicular cells and oocytes of different species including cows [22,45,46]. Hence, the NO/cGMP system existing in mammalian oocytes may contribute the meiotic regulation. Nitric oxide can exert both the inhibitory and stimulatory effects on meiosis resumption depending on its concentration, suggesting a dual role of this messenger in the meiosis regulation [22]. This notion is confirmed by the data that not only NO donors but also inhibitors of NOS are able to suppress the oocyte nuclear maturation. In cows, treatment of cumulus-enclosed oocytes with NO donors produced a transient rise of cGMP levels in COCs resulting in a delay of meiosis without effect on cAMP [44]. At the same time, L-NAME, the nonselective NOS inhibitor, at concentrations of 0.1 to 1000 mM suppressed the completion of nuclear maturation of bovine cumulus-enclosed oocytes [31]. In our research, L-NAME (20 mM) delayed meiotic resumption in DOs, indicating its direct meiosisretarding effect on bovine oocytes. It has been previously shown that PRL can stimulate the NOS activity and accumulation of NO in mammary epithelial cells by elevating intracellular calcium [23], whereas eNOS and nNOS are usually considered as calcium-dependent enzymes. In addition, PRL has been found to induce mobilization of calcium ions from intracellular stores in bovine cumulus-enclosed oocytes incubated for 2.5 hours in our system 1 [13]. Therefore, we assumed that PRL might decelerate meiotic resumption in bovine DOs through activation of NOS. For testing this hypothesis, the impact of L-NAME on the meiosis-retarding action of PRL was studied. When added simultaneously to the culture medium, L-NAME and PRL attenuated the effects of each other, although their individual actions on meiosis were unidirectional. The revealed crosstalk between the NOS inhibitor and PRL support our assumption that the hormone effect could be associated, at least in part, with stimulation of the NO production in oocytes. It should be noted that meiotic resumption in COCs was unaffected by PRL in contrast to that in DOs, suggesting that the cumulus investment is able to abolish the direct retarding action of the hormone on meiosis. On the basis of the previously mentioned data, one can speculate that cumulus cells may interfere with the promoting effect of PRL on the NOS

activity in bovine oocytes. Alternatively, cumulus cells might counteract the inhibitory effect of the intraoocyte NO on meiotic resumption. The last assumption is confirmed by evidence that only high concentrations of NO donors can inhibit meiosis resumption in bovine cumulus-enclosed oocytes [44,47]. Furthermore, the PRL-induced calcium release from intracellular stores of bovine oocytes, which might activate calcium-dependent isoforms of NOS, has been revealed in spite of the cumulus investment [13]. Finally, an implication of known mediators of PRL signaling in follicular cells, tyrosine kinases and protein kinase C [17–19], was examined using calpostin C, the protein kinase C inhibitor, and genistein, the nonselective inhibitor of tyrosine kinases. Although both kinase types have been shown to be involved in meiosis regulation [20,21], we did not observe effects of calpostin C and genistein at concentrations used on meiosis of cumulus-free oocytes. Meanwhile, genistein (but not calpostin C) suppressed the inhibitory effect of PRL on meiotic resumption in DOs, suggesting the implication of a tyrosine kinase activity in this hormonal effect. The obtained results are consistent with our previous findings for participation of tyrosine kinases in mediating the regulatory effect of PRL on the completion of the nuclear maturation of bovine COCs [32]. However, there is no way of telling what tyrosine kinase(s) is activated in response to PRL because genistein inhibits different tyrosine-specific protein kinases. Genistein can also act as an agonist of estrogen receptors and affect glucose metabolism. But these activities of genistein could not interfere with the meiosis-retarding effect of PRL because there were no sources of estrogens or glucose in the culture medium of DOs, which, besides, are not able to use glucose in the absence of cumulus cells [48]. Previously, the beneficial influence of PRL on the developmental potential of bovine oocytes has not been found except during coculture of COCs with dispersed mural granulosa cells [14]. Hence, the authors have supposed that PRL exerts its effect on the oocytes through granulosa cells in a paracrine manner. The findings of the present study have demonstrated for the first time the stimulatory action of PRL on the bovine oocyte capacity for embryonic development, which is independent on mural granulosa cells. In systems 2 and 3, PRL enhanced the developmental competence of cumulus-enclosed oocytes (namely, the yield of blastocysts) but did not affect their nuclear maturation, fertilization, and cleavage ability. According to present views, the oocyte capacity to develop after fertilization up to the blastocyst stage is an appropriate sign of the completeness of the oocyte cytoplasmic maturation [49]. Thus, the obtained results have indicated a positive action of PRL on the cytoplasmic maturation of bovine oocytes in media supplemented with FSH/eCG, LH/ hCG, and FCS/ECS. By contrast, no influence of PRL on the developmental capacity of bovine cumulus-enclosed oocytes has been earlier observed in media containing ECS or FCS and FSH (without LH) [14]. These data suggest that the presence of LH or LH and FSH simultaneously during IVM is needed for achieving such a promotory effect of PRL on bovine COCs, as in the case of rabbit COCs [12]. So, it is possible that this effect arose from PRL modulation of the respective influence of gonadotropic hormones, at least LH.

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

Cumulus cells are known to play an important role in acquisition of the developmental competence by mammalian oocytes [50]. The data of our study are in line with the previous studies in that bovine DOs cannot properly support the cytoplasmic maturation and following embryonic development [51,52]. Concurrently, the cumulus investment was required for realization of the positive effect of PRL on the developmental capacity of bovine oocytes. These findings are consistent with the assumption that the revealed effect of PRL is dependent on gonadotropic hormones, which affect oocytes through cumulus cells [53]. Prolactin is one of the main stimulators of progesterone production in different mammalian species including cattle [11,54]. Secretion of progesterone by cumulus cells during the bovine COC maturation is important for the oocyte developmental competence and enhanced by EGF [55,56]. At the same time, EGF-like factors are mediators of LH effects on oocytes [53]. Recently, the permissive role of PRL as a major regulator of LH action on the ovarian function, primarily on progesterone production, has been established using transgenic female mice [57]. In addition, PRL has been shown to increase the FSH-induced progesterone synthesis in rat granulosa cells cocultured with oocytes by amplifying the expression of steroidogenic enzymes [7]. Taking into account these data, one can assume that the beneficial influence of PRL on the developmental capacity of bovine oocytes may be related to an enhancement of gonadotropic action on progesterone production by cumulus cells expressing the respective receptors. Further experiments are needed to clarify the role of progesterone in the interaction between PRL and gonadotropins during the bovine COC maturation. 4.1. Conclusion These findings show for the first time the functioning of the direct pathway of PRL signaling into bovine oocytes, as confirmed by the respective expression of receptors of PRL and its direct meiosis-retarding effect on cumulus-free oocytes. This signaling pathway may involve activation of tyrosine kinases and NOS but not protein kinase C. Concurrently, cumulus cells are able to downmodulate the direct PRL action on the oocyte. In the presence of gonadotropic hormones, PRL does not affect the nuclear maturation, fertilization, and cleavage ability of bovine cumulus-free and cumulus-enclosed oocytes, whereas it can exert the stimulatory effect on the subsequent yield of blastocysts (and hence on the cytoplasmic maturation) in the case of COCs. Thus, this is the first demonstration that the beneficial effect of PRL on the oocyte developmental capacity is achieved via cumulus cells containing receptors of PRL. Acknowledgments This work was supported in part by the Russian Foundation for Basic Research (grant numbers 07-04-01485 and 13-04-01888). We thank A.D. Roed for expert technical assistance with IVF and IVC and B. Avery for advice and helpful discussions regarding IVP. We are grateful to Prof. N. Parvizi (Institute of Farm Animal Genetics, FLI, Germany) for the gift of calpostin C.

1163

Competing interests Irina Y. Lebedeva was the recipient of an Erasmus Mundus fellowship. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. theriogenology.2014.08.005. References [1] Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA. Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev 1998; 19:225–68. [2] Wise T, Suss U, Stranzinger G, Wuthrich K, Maurer RR. Cumulus and oocyte maturation and in vitro and in vivo fertilization of oocytes in relation to follicular steroids, prolactin, and glycosaminoglycans throughout the estrous period in superovulated heifers with a normal LH surge, no detectable LH surge, and progestin inhibition of LH surge. Domest Anim Endocrinol 1994;11:59–86. [3] Doldi N, Papaleo E, De Santis L, Ferrari A. Treatment versus no treatment of transient hyperprolactinemia in patients undergoing intracytoplasmic sperm injection programs. Gynecol Endocrinol 2000;14:437–41. [4] Mendoza C, Cremades N, Ruiz-Requena E, Martinez F, Ortega E, Bernabeu S, et al. Relationship between fertilization results after intracytoplasmic sperm injection, intrafollicular steroid, pituitary hormone and cytokine concentrations. Hum Reprod 1999;14:628–35. [5] Jinno M, Katsumata Y, Hoshiai T, Nakamura Y, Matsumoto K, Yoshimura Y. A therapeutic role of prolactin supplementation in ovarian stimulation for in vitro fertilization: the bromocriptinerebound method. J Clin Endocrinol Metab 1997;82:3603–11. [6] Picazo RA, Garcia Ruiz JP, Santiago Moreno J, Gonzalez de Bulnes A, Munoz J, Silvan G, et al. Cellular localization and changes in expression of prolactin receptor isoforms in sheep ovary throughout the estrous cycle. Reproduction 2004;128:545–53. [7] Nakamura E, Otsuka F, Inagaki K, Miyoshi T, Yamanaka R, Tsukamoto N, et al. A novel antagonistic effect of the bone morphogenetic protein system on prolactin actions in regulating steroidogenesis by granulosa cells. Endocrinology 2010;151:5506–18. [8] Kiapekou E, Loutradis D, Patsoula E, Koussidis GA, Minas V, Bletsa R, et al. Prolactin receptor mRNA expression in oocytes and preimplantation mouse embryos. Reprod Biomed Online 2005;10:339–46. [9] Binart N, Bachelot A, Bouilly J. Impact of prolactin receptor isoforms on reproduction. Trends Endocrinol Metab 2010;21:362–8. [10] Bignon C, Binart N, Ormandy C, Schuler LA, Kelly PA, Djiane J. Long and short forms of the ovine prolactin receptor: cDNA cloning and genomic analysis reveal that the two forms arise by different alternative splicing mechanisms in ruminants and in rodents. J Mol Endocrinol 1997;19:109–20. [11] Sangeeta Devi Y, Halperin J. Reproductive actions of prolactin mediated through short and long receptor isoforms. Mol Cell Endocrinol 2014;382:400–10. [12] Yoshimura Y, Hosoi Y, Iritani A, Nakamura Y, Atlas SJ, Wallach EE. Developmental potential of rabbit oocytes matured in vitro: the possible contribution of prolactin. Biol Reprod 1989;40:26–33. [13] Kuzmina TI, Lebedeva IY, Torner H, Alm H, Denisenko VY. Effects of prolactin on intracellular stored calcium in the course of bovine oocyte maturation in vitro. Theriogenology 1999;51:1363–74. [14] Kuz’mina TI, Lebedeva IYu, Torner H, Alm H. Effects of prolactin in different culture systems on the maturation of bovine oocytes and their capacity for subsequent development. Russ J Dev Biol 2001;32: 112–8. [15] Kiapekou E, Zapanti E, Mastorakos G, Beretsos P, Bletsa R, Drakakis P, et al. Effect of prolactin in the absence of hCG on maturation, fertilization, and embryonic development of in vitro matured mouse oocytes. Ann N Y Acad Sci 2006;1092:450–9. [16] Torner H, Kubelka M, Heleil B, Tomek W, Alm H, Kuzmina T, et al. Dynamics of meiosis and protein kinase activities in bovine oocytes correlated to prolactin treatment and follicle size. Theriogenology 2001;55:885–99. [17] Villanueva LA, Méndez I, Ampuero S, Larrea F. The prolactin inhibition of follicle-stimulating hormone-induced aromatase activity in

1164

[18]

[19]

[20]

[21]

[22]

[23] [24]

[25]

[26] [27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164 cultured rat granulosa cells is in part tyrosine kinase and protein kinase-C dependent. Mol Hum Reprod 1996;2:725–31.  ska B, Górska T, Dusza L. Prolactin Ciereszko R, Opa1ka M, Kamin signalling in porcine theca cells: the involvement of protein kinases and phosphatases. Reprod Fertil Dev 2003;15:27–35.  ska M, Stok1osowa S. Effect of genistein, Gregoraszczuk E, S1omczyn tyrphostin and herbimycin on prolactin-stimulated progesterone production by porcine theca and luteal cells. J Physiol Pharmacol 1999;50:477–84. Sun QY, Miao YL, Schatten H. Towards a new understanding on the regulation of mammalian oocyte meiosis resumption. Cell Cycle 2009;8:2741–7. McGinnis LK, Carroll DJ, Kinsey WH. Protein tyrosine kinase signaling during oocyte maturation and fertilization. Mol Reprod Dev 2011;78:831–45. Pandey AN, Tripathi A, Premkumar KV, Shrivastav TG, Chaube SK. Reactive oxygen and nitrogen species during meiotic resumption from diplotene arrest in mammalian oocytes. J Cell Biochem 2010; 111:521–8. Bolander FF. Prolactin activation of mammary nitric oxide synthase: molecular mechanisms. J Mol Endocrinol 2002;28:45–51. Gilchrist RB, Thompson JG. Oocyte maturation: emerging concepts and technologies to improve developmental potential in vitro. Theriogenology 2007;67:6–15. Vejlsted M, Avery B, Schmidt M, Greve T, Alexopoulos N, MaddoxHyttel P. Ultrastructural and immunohistochemical characterization of the bovine epiblast. Biol Reprod 2005;72:678–86. Tarkowski AK. An air-drying method for chromosome preparations from mouse eggs. Cytogenetics 1966;5:394–400. Homa ST. Effects of cyclic AMP on the spontaneous meiotic maturation of cumulus-free bovine oocytes cultured in chemically defined medium. J Exp Zool 1988;248:222–31. Degen JL, Neubauer MG, Degen SJF, Seyfried CE, Morris DR. Regulation of protein synthesis in mitogen-activated bovine lymphocytes. Analysis of actin-specific and total mRNA accumulation and utilization. J Biol Chem 1983;258:12153–62. Shibaya M, Murakami S, Tatsukawa Y, Skarzynski DJ, Acosta TJ, Okuda K. Bovine corpus luteum is an extrapituitary site of prolactin production. Mol Reprod Dev 2006;73:512–9. Lebedeva IY, Lebedev VA, Kuzmina TI. Characterization of somatotropin- and prolactin-binding sites on bovine granulosa cells using homologous hormones. Biochemistry(Mosc) 2001;66:967–72. Schwarz KR, Pires PR, de Bem TH, Adona PR, Leal CL. Consequences of nitric oxide synthase inhibition during bovine oocyte maturation on meiosis and embryo development. Reprod Domest Anim 2010; 45:75–80. Lebedeva IY, Singina GN, Taradajnic TE, Zinovieva NA. Protein kinase implication in prolactin signaling in bovine oocyte-cumulus complexes. Cell Tissue Biol 2011;5:560–7. Racedo SE, Wrenzycki C, Herrmann D, Salamone D, Niemann H. Effects of follicle size and stages of maturation on mRNA expression in bovine in vitro matured oocytes. Mol Reprod Dev 2008;75:17–25. Choi YH, Carnevale EM, Seidel Jr GE, Squire EL. Effects of gonadotropins on bovine oocytes matured in TCM-199. Theriogenology 2001;56:661–70. Lebedeva IY, Singina GN, Volkova NA, Mormishev AN, Golubev AK, Zinovieva NA. Interaction of signal cascades induced by cAMP and prolactin in bovine oocyte-cumulus complexes. Cell Tissue Biol 2008;2:472–80. Wise T, Maurer RR. Follicular development, oocyte viability and recovery in relation to follicular steroids, prolactin and glycosaminoglycans throughout the estrous period in superovulated heifers with a normal LH surge, no detectable LH surge, and progestin inhibition of LH surge. Domest Anim Endocrinol 1994;11:35–58. Kraidith K, Jantarajit W, Teerapornpuntakit J, Nakkrasae LI, Krishnamra N, Charoenphandhu N. Direct stimulation of the

[38] [39]

[40]

[41]

[42]

[43] [44]

[45]

[46] [47]

[48]

[49] [50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

transcellular and paracellular calcium transport in the rat cecum by prolactin. Pflugers Arch 2009;458:993–1005. Hodson DJ, Townsend J, Tortonese DJ. Characterization of the effects of prolactin in gonadotroph target cells. Biol Reprod 2010;83:1046–55. Kelly PA, Edery M, Finidori J, Postel-Vinay MC, Gougon L, Ali S, et al. Receptor domains involved in signal transduction of prolactin and growth hormone. Proc Soc Exp Biol Med 1994;206:280–3. Lebedeva IYu, Kuzmina TI, Goilo TA. The influence of prolactin on DNA synthesis in cultured cow granulosa cells [in Russian]. Tsitologija 1995;37:220–6. Bilodeau-Goeseels S. Cows are not mice: the role of cyclic AMP, phosphodiesterases, and adenosine monophosphate-activated protein kinase in the maintenance of meiotic arrest in bovine oocytes. Mol Reprod Dev 2011;78:734–43. Lebedeva IY, Singina GN, Ernst LK, Golubev AK. Realization pathways of prolactin modulating effect on the cAMP-dependent mechanism of meiosis regulation in bovine oocytes. Cell Tissue Biol 2009;3:438–44. Liu L, Kong N, Xia G, Zhang M. Molecular control of oocyte meiotic arrest and resumption. Reprod Fertil Dev 2013;25:463–71. Lancellotti Schwarz KR, Lisboa Pires PR, Mesquita LG, Chiaratti MR, Verde Leal CL. Effect of nitric oxide on the cyclic guanosine monophosphate (cGMP) pathway during meiosis resumption in bovine oocytes. Theriogenology 2014;81:556–64. Pires PR, Santos NP, Adona PR, Natori MM, Schwarz KR, de Bem TH, et al. Endothelial and inducible nitric oxide synthases in oocytes of cattle. Anim Reprod Sci 2009;116:233–43. Kadanga AK. Nitric oxide synthase (NOS) genes expression in cattle in vitro produced embryos. Göttingen: Cuvillier Verlag; 2005. Bilodeau-Goeseels S. Effects of manipulating the nitric oxide/cyclic GMP pathway on bovine oocyte meiotic resumption in vitro. Theriogenology 2007;68:693–701. Sutton-McDowall ML, Gilchrist RB, Thompson JG. The pivotal role of glucose metabolism in determining oocyte developmental competence. Reproduction 2010;139:685–95. Wang Q, Sun QY. Evaluation of oocyte quality: morphological, cellular and molecular predictors. Reprod Fertil Dev 2007;19:1–12. Tanghe S, Van Soom A, Nauwynck H, Coryn M, de Kruif A. Minireview: functions of the cumulus oophorus during oocyte maturation, ovulation, and fertilization. Mol Reprod Dev 2002;61:414–24. Aktas H, Leibfried-Rutledge ML, First NL. Meiotic state of bovine oocytes is regulated by interactions between cAMP, cumulus, and granulosa. Mol Reprod Dev 2003;65:336–43. Paula-Lopes FF, Boelhauve M, Habermann FA, Sinowatz F, Wolf E. Leptin promotes meiotic progression and developmental capacity of bovine oocytes via cumulus cell-independent and -dependent mechanisms. Biol Reprod 2007;76:532–41. Zhang M, Ouyang H, Xia G. The signal pathway of gonadotrophinsinduced mammalian oocyte meiotic resumption. Mol Hum Reprod 2009;15:399–409. Thompson IM, Ozawa M, Bubolz JW, Yang Q, Dahl GE. Bovine luteal prolactin receptor expression: potential involvement in regulation of progesterone during the estrous cycle and pregnancy. J Anim Sci 2011;89:1338–46. Nuttinck F, Marquant-Le Guienne B, Clément L, Reinaud P, Charpigny G, Grimard B. Expression of genes involved in prostaglandin E2 and progesterone production in bovine cumulus-oocyte complexes during in vitro maturation and fertilization. Reproduction 2008;135:593–603. Aparicio IM, Garcia-Herreros M, O’Shea LC, Hensey C, Lonergan P, Fair T. Expression, regulation, and function of progesterone receptors in bovine cumulus oocyte complexes during in vitro maturation. Biol Reprod 2011;84:910–21. Bachelot A, Carré N, Mialon O, Matelot M, Servel N, Monget P, et al. The permissive role of prolactin as a regulator of luteinizing hormone action in the female mouse ovary and extragonadal tumorigenesis. Am J Physiol Endocrinol Metab 2013;305:E845–52.

I.Y. Lebedeva et al. / Theriogenology 82 (2014) 1154–1164

Supplementary Fig. 1. Immunolocalization of PRL receptors with the use of a brown DAB-chromophore in bovine oocytes fixed with the methanol– acetic acid mixture. Preparations were counterstained with Giemsa solution. (A) Positive staining. (B) Negative control performed by omitting the primary antibody. Original magnification: 200.

1164.e1