240 GATA 8(8): 240-245, 1991
EMERGINGTECHNIQUES Rapid Detection of Maize DNA Sequence Variation D O N N A M. S H A T T U C K - E I D E N S , R U S S E L L N. B E L L , J E F F R E Y T. M I T C H E L L , and V A L E R I E C. M c W H O R T E R
The allele-specific polymerase chain reaction (ASPCR ) has been used to determine the genotype of maize lines at two loci, wx and NPI288. The ASPCR method uses allelespecific oligonucleotide primers in PCR amplifications to amplify and discriminate simultaneously between polymorphic alleles. The success of this technique relies on the specific failure of PCR to amplify with primers that do not perfectly match the DNA sequence of one of the allelic variants. Amplification results were evaluated by dot-blot hybridization using an alkaline-phosphatase-coupled probe. The technique's speed, accuracy, sensitivity, and high throughput make it valuable for plant-breeding applications.
Introduction Restriction fragment length polymorphism (RFLP) analysis is well suited for genetic mapping in plants in which a relatively large number of markers are used to probe a relatively small number of individuals. In contrast, RFLP analysis is poorly suited for applications in which large numbers of individuals are probed with a relatively small number of markers. A technique that would enable the analysis of a few marker loci in a large number of individuals would be a valuable tool in plant-breeding programs. One such technique is the allele-specific polymerase chain reaction (ASPCR) [1-4]. ASPCR is the selective amplification of specific alleles by oligonucleotide primers that match the nucleotide sequence of one allele, but mismatch the nucleotide sequence of a dissimilar allele. Here we report the application of ASPCR to the determination of alternate DNA seFrom Native Plants Incorporated (NPI), Salt Lake City, Utah, USA. Dr. McWhorter's present address is Biology Department, Stanford University, Stanford, California, USA. Address correspondence to Dr. D.M. Shattuck-Eidens, AgriDyne Technologies, Inc., 417 Wakara Way, Salt Lake City, UT 84108, USA. Received 28 August 1991; revised and accepted 21 October 1991.
quence variants within two maize loci: waxy [5] and NPI288 [6]. The waxy locus encodes a tissue-specific starch biosynthetic enzyme the DNA sequence of which was reported by K16sgen et al. [7]. The examination of DNA sequence at the waxy locus in five inbred lines revealed sequence polymorphisms. Similarly, comparisons among DNA sequence within the RFLP marker locus NPI288 revealed polymorphisms among seven inbred lines [6]. Oligonucleotide primers overlapping the sequence polymorphisms in these regions were used in PCR reactions to amplify segments of these two loci in an allele-specific fashion. Amplification results were evaluated by dot-blot hybridization with oligonucleotide probes that were labeled either with 32p o r with alkaline phosphatase and visualized by autoradiography or by chromogenic substrates, respectively.
Methods
Isolation of Genomic DNA Genomic DNA was extracted from pulverized freezedried maize leaves in 0.1 M Tris-Cl pH 7.5, 0.7 M NaCI, 10 mM EDTA, 1% mixed alkyltrimethylammonium bromide, and 1% 2-mercaptoethanol at 60°C for 60 min with occasional gentle mixing. After cooling to room temperature this material was gently extracted for 5 min with 24:1 chloroform-octanol and centrifuged for 10 min at 700 g. The aqueous layer was mixed with an equal volume of isopropanol, the precipitate spooled out with a glass hook and washed in 76% ethanol, 0.2 M NaOAc, and then in 76% ethanol, 10 mM NH4OAc, and finally dissolved overnight in 10 mM Tris-C1 pH 8, 1 mM EDTA, at 4°C. The DNA preparations were centrifuged for 10 min at 12,000 g to sediment the undissolved solids.
Amplification of Genomic DNA Two primers were prepared for amplification within the waxy sequence: WxS, 5'-GGAAAGACCGAGGA GAAGAT-3', corresponding to nucleotides 11611180 and WxR, 5'-GTAGGAGATGTTGTGGAT GC-3', complementary to nucleotides 1761-1780 [7]. Genomic DNA (0.25 ~g) was amplified in 25-1xL reactions composed of 10 mM Tris-C1 pH 8.4, 50 mM KC1, 2.5 mM MgC12, 0.4 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.2 mM dTTP, 0.5 ~M WxS, 0.5 txM WxR, and 20 U/mL Taq DNA polymerase (Perkin Elmer, Norwalk, CT). Reactions were performed in 0.65-mL microfuge tubes with a mineraloil overlay by using an Ericomp thermocycler (Eri-
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010 1050-3862/92/$5.00
241 Detection of Sequence Variation
GATA 8(8): 240-245, 1991
comp, San Diego, CA). Temperatures were cycled through one iteration of 5 min at 95°C, 1 min at 55°C, and 2 min at 72°C; 28 iterations of 30 s at 93°C, 1 min at 55°C, and 2 min at 72°C; and one iteration of 30 s at 93°C, 1 min at 55°C, and 8 min at 72°C. Eight microliters of each reaction were electrophoresed through 3% NuSieve GTG agarose (FMC BioProducts, Rockland, ME) gel in 0.1 M Tris-C1, 83 mM H3BO4, 1 mM EDTA, containing 0.5 txg/ mL ethidium bromide. Using a Pasteur pipet, a plug was removed from each band and melted in 100 ixL water in a boiling water bath for 2-3 min. Six microliters of this DNA preparation was used in subsequent asymmetric PCR reactions. The asymmetric amplifications were performed using the same conditions as those described above except that the "limiting" primer was 0.05 txM. The products from the asymmetric amplifications were precipitated from 2 M NH4OAc, 50% isopropanol at room temperature for 10 min. The DNA was centrifuged for 10 min at 12,000 g, washed with 1 mL cold 70% ethanol, dried under vacuum, and dissolved in 8 txL of water.
DNA Sequencing The asymmetrically amplified DNA was sequenced using a Sequenase 2.0 DNA sequencing kit (United States Biochemical Corporation, Cleveland, OH) and 10 pmol of the 'qimiting" primer. Sequencing reactions were carried out using [a-thio35S]dATP and following the kit instructions except that the primer was annealed for 5 min at 650C and 5 min at room temperature, and then chilled on ice. Sequencing reactions were labeled for 5 min on ice, terminated for 5 min at 37°C, and then combined with 4 ~L of stop buffer. Denatured sequencing reactions were electrophoresed on a 6% polyacrylamide, 7 M urea, field gradient (wedge) gel. The gel was fixed in 10% methanol, 10% acetic acid, for 30 min, dried at 80°C, and autoradiographed with X-OMAT AR diagnostic film (Eastman Kodak, Rochester, NY). Satisfactory results have also been obtained by sequencing DNA from the asymmetric PCR reaction after chromatography through a 0.7-cm diameter, 10cm-long column of Bio-Gel A50m (Bio-Rad Laboratories, Richmond, CA) equilibrated with 1 mM Tris-C1 pH 8, 0.1 mM EDTA, and 10 mM NaCI. The DNA-containing fraction of the eluate was concentrated 10-fold by freeze drying and the DNA was precipitated with ethanol. The DNA was dissolved in 7 ILL water and sequenced as described above except that the labeling reaction was carried out at room temperature rather than at 0°C.
Allele-Specific PCR Allele-specific PCR was performed in 25-1xL reactions composed of 10 mM Tris--Cl pH 8.4, 50 mM KCI, 2.5 mM MgC12, 20 Ixg/mL gelatin, 50 IxM dATP, 50 txM dCTP, 50 ~M dGTP, 50 fxM dTTP, 0.2 Ixg/mL RNase A, 10 U/mL RNase T1, 0.4 txM each primer, 20 U/mL Taq DNA polymerase, and 5 Ixg/mL genomic DNA. The reactions, in a Hi-Temp 96-well microplate (Techne Corporation, Princeton, NJ), were overlaid with 50-100 ~xL mineral oil to prevent evaporation. Temperatures were cycled in a Techne MW-2 thermal cycler through 30 iterations of 1 min at 94°C, 1 min at 55°C, and 2 rain at 72°C.
Detection To assess the outcome of the ASPCR, 3 IxL of each reaction was diluted in 300 txL 0.15 M NaC1 and filtered through a Biodyne-B membrane (Pall Biosupport, Glen Grove, NY) in a dot-blot manifold with 10 mm Hg vacuum. The membrane was placed on Whatman-3MM paper saturated with 0.2 M NaOH, 0.15 M NaC1, for 1 rain to denature the DNA, transferred to 3MM paper saturated with 1 M Tris-C1 pH 7.5, 0.15 M NaCI, for 2 min to neutralize the DNA, washed for 10 rain in 2 x SSC, and allowed to dry. Dot blots were prehybridized for 20 rain at 50°C in "hyb" solution (5 x SSC, 1% SDS, and 0.5% BSA), and then hybridized for 20 min at 50°C in "hyb" solution containing 5 nM probe. Two different types of probes and detection methods were used. For waxy, the oligonucleotide WxP, 5'-TCCAAGGATCCT GAGCCTCA-3', corresponding to nucleotides 13401359, was end-labeled with 32p. WxP (10 pmol) was incubated for 30 min at 37°C in a 10-~L reaction composed of 70 mM Tris-C1 pH 7.6, 0.1 M KC1, 10 mM MgC12, 5 mM dithiothreitol, 0.5 mg/mL BSA, 10 fxM [~/J~P]ATP, and 1000 U/mL T4 polynucleotide kinase. The kinase was inactivated by heating 10 rain at 96°C and the probe was used without further purification. The probe for NP1288 (SNAP288) is an oligonucleotide to which alkaline phosphatase has been chemically coupled (SNAP; Molecular Biosystems, San Diego, CA). This probe, 5'GTATCGCGAACGTCATGATC-3', hybridizes to a conserved sequence within the amplification interval of NPI288. Following two 10-min washes in 2 x SSC, 1% SDS, and one 10-min wash in 2 x SSC, all at room temperature, the probes were visualized either by autoradiography on X-OMAT AR diagnostic film or with chromogenic substrates for alkaline phosphatase. The SNAP288 was visualized in
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010
242 D.M. Shattuck-Eidens et ah
GATA 8(8): 240-245, 1991
a
1601
I A619 B73 C103
CAGGGACGC-AAGGTTGCCTTCTCTGCTGA-CTGAACAAGCCGGTCTTCGTTCTC CAGGGACGCAAAGGTTGCCTTCTCTG---AACTGAACAANGCCGTCTTCGTTCTC CAGGGACGCAAAGGTTGCCTTCTCTGCTGAACTGAACAACGCCGTCTTCGTTCTC
Wxwild Mo17
wxMo17
A619 B73 C103 Mo17 wxMo17
CAGGGACGCAAAGGTTGCCTTCTCTGCTGAACTGAACAACGCCGTCNN-GTTCTC CAGGGACGC . . . . . . . CGTTTTCGTTCTC wxMo17-2
1675
1711
I
I
CATGCT--GATATACCT-ATCTG---GTGGTGGTGCTTCTCTGAAACTGAAACTGAAAC CATGCT--GNTATACCTCGTCTG---GTGGTGGTGCTTCTCTGA .... GAAACTGAAAC CATGCTCGTATATACCTCATCTG---GTGGTGGTGCTTCTCTGAAACTGAAACTGAAAC CATGCTNGNATATNCCTCATCTG---GTGGTGGTGCTTCTCTGAAACTGAAANCGAAAC CATGCTCGTATATACCTCGTCTGGTAGTGGTGGTGCTTCTCTGAGAAACTAACTGAAAC wxMo17-1
b 1780
I
I 1161 WxR
WxwHd
Figure 1. (a) The alignment of DNA sequences within the maize waxy locus of five variant maize lines. Lines A619, B73, C103, and Mo17 are wild-type, but wxMolT, a derivative of Mo17, carries a wx mutation. The absence of nucleotides is indicated by (-), N indicates sequencing gel ambiguities, and the sequences complementary to oligonucleotides wxwild, wxMol7-1, and wxMol7-2 are indicated by underlining. (b) Schematic representation of the waxy locus between nucleotides 1161-1780 showing the relative positions and orientations of the various waxy oligonucleotides. The triangles depict the locations of the deletion and the insertion. The nucleotide numbering is consistent with that of the published sequence of the wild-type allele [7].
a solution containing 0.1 M Tris-C1 pH 9, 0.1 M NaCI, 50 mM MgC12, 0.35 mM 5-bromo-4-chloro3-indolylphosphate p-toluidine salt (BCIP), and 0.35 mM nitroblue tetrazolium chloride (NBT) (BCIP and NBT; BRL, Gaithersburg, MD).
Results and Discussion waxy Figure 1a shows the comparison of sequence between nucleotides 1601 and 1711 among five maize inbreds. The sequence of the waxy mutant allele wxMol 7 can be distinguished from the sequences of four wildtype alleles by two sequence variations: a small in-
sertion of three nucleotides at position 1675 and by the deletion between 1609 and 1639. Using these data, four oligonucleotide primers were synthesized for the allele-specific PCR amplifications of the waxy locus. The nucleotides complementary to the primers are underlined in Figure la. The wxMol7-1 primer (5'-AGCACCACCACTAC-T) matches the wxMol 7 sequence exactly, but the three nucleotides on the 3' end are mispaired with the wild-type maize sequences. The wxMol7-2 primer (5'-CGAAAA CGGCGTCC-3') is complementary to the DNA sequence that spans the deletion in wxMol 7. The target site for wxMol7-2 is therefore continuous in wxMo17, but is interrupted in the wild-type lines. Wxwild
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010
243 Detection of Sequence Variation
GATA 8(8): 240-245, 1991
Meize
Line~ v'-
O~ ~D
I',-
~'9
I',-
O
T-
O
X
Primers Wxwild wxMo17-1 wxMo17-2 Figure 2. Autoradiogram of hybridized dot blot exhibiting the presence or absence of amplified product, enabling allelic assignment in waxy. The rows correspond to the allele-specific primer used in the reaction, and the columns correspond to the maize lines evaluated.
(5'-TCAGCAGAGAAGGCAACCTT-Y) is homologous to sequence entirely within the deletion and is consequently specific to the four wild-type maize lines. The relationship among the oligonucleotides used in the waxy ASPCR is depicted in Figure lb. WxS (5'-GGAAAGACCGAGGAGAAGAT-Y) and
WxR (5'-GTAGGAGATGTrGTGGATGC-Y) match all five DNA sequences. WxS was used as the "common" primer in all of the waxy ASPCR amplifications. WxP, which hybridizes to a conserved region between the PCR primers, was radiolabeled and used as a hybridization probe in the dot-blot assay. The autoradiogram in Figure 2 shows a positive reaction when Wxwild is used to amplify genomic DNA from the lines carrying wild-type alleles A619, B73, C103, or Mo17, but not genomic DNA from wxMo17. Amplifications with both wxMol7-1 and wxMol7-2 exhibit the opposite behavior: these primers amplify genomic DNA from wxMo17, but fail to amplify genomic DNA from the lines carrying wildtype alleles. Interestingly, the deletion spanned by wxMol7-2 is in the same location as the deletion recently reported by Okagaki et al. [8]. It appears that wxMol 7, wx1240, and wxC are identical in this region. Okagaki et al. present convincing evidence that this deletion is responsible for the mutant phenotype in wx1240. We sequenced two other wx alleles supplied by Dr. David Glover of Purdue University. These two alleles, wx standard and wxB, also have this deletion. One other wx allele was sequenced, wxB73, but this
m
a
MO17
3' C T T G A T G A C G T G G
A CGTGACTAC...5'
288-i
5'
T 3 ' ~
B73
3' C T T G A T G A C G T G G
288-2
5'
GAACTACTGCACC
T CGTGACTAC...5'
GAACTACTGCACC__.AI3 ' ~
288-1 908
I
I 338
b
~=
-I~
"91"~"~''~
~m ~'--"~----
Figure 3. (a) DNA sequences within the NP1288 marker locus of two variant maize lines, Mo17 and B73. The primers 288-1 and 288-2 and their complementary sequences are shown. The box highlights the 3' ends of the allele-specific primers, that is, primers that either match or mismatch the two genomic sequences. (b) Schematic representation of a portion of the NPI288 sequence showing the relative positions and orientations of the various NP1288 oligonucleotides.
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010
244 D.M. Shattuck-Eidens et al.
GATA 8(8): 240-245, 1991
allele did not have the deletion (data not shown). Both wxMol7 and wxB73 were supplied by Virgil Ferguson of Custom Farm Seed. The small 3-bp insertion in wxMo17 at nucleotide 1675 is present in the wild-type C allele [7], but absent from the wildtype alleles of A619, B73, C103, and Mo17. This insertion is probably unrelated to the mutant phenotype. NP1288 From the DNA sequence information obtained from clone NPI288 [6], primers were constructed that enabled the differential amplification of two alleles of NPI288. Figure 3a shows the primers used in the ASPCR amplification of NPI288 alleles. The T at the 3' end of primer 288-1 matches the DNA sequence of the allele in Mol 7, but is mispaired with a T in the DNA sequence of the B73 allele. Conversely, the A at the 3' end of primer 288-2 matches the DNA sequence of the B73 allele, but is mispaired with an A in the DNA sequence of the Mol 7 allele. These primers facilitate ASPCR amplification when paired with the "common" primer 288-3 (Figure 3b). The reactions were evaluated by dot-blot hybridization with SNAP288, and successful amplifications were scored as positives by visualization using the chromogenic substrates BCIP and NBT. Figure 4 demonstrates the accurate assignment of alleles of NP1288 between the two inbred maize lines.
~aize Lines Mo17
B73
!
288-1 !i / ¸
•
'ii i,~! ~,'iIII ,
288-2 ~'~!!,i,!i~, ii~i
Figure 4, Photograph of color-visualized hybridization spots exhibiting the presence or absence of amplified product, enabling allelic assignment in N P 1 2 8 8 . The r o w s correspond to the allelespecific primer used in the reaction, and the c o l u m n s correspond to the maize lines evaluated.
Summary The analytic technique described here is designed to handle large numbers of samples. The technique is
complementary to RFLP analysis, which is not well suited for high throughput with few markers. ASPCR could be applied in a plant-breeding program to markers that have been linked to traits of interest by RFLP analysis. Once the informative markers are identified, further analysis of the populations can be focused on that limited set of markers. The most difficult aspect of the procedure is the development of allele-specific reagents. The applicability of this method to a given species relies on the extensiveness of the DNA sequence polymorphism in the genomic region of interest. Previous work [6] has suggested that there is variation in the occurrence of DNA sequence polymorphism among plant species. The more DNA sequence polymorphism exhibited by a species, the less extensive must be the search for nucleotide differences. There are some considerations concerning the design of allele-specific oligonucleotide primers that are governed by the nature of the sequence differences among the variants. The most uncomplicated configuration is the presence of a relatively long segment of inserted DNA or, conversely, the deletion of an interval of DNA as in the instance of wxMol7. Where there is such a difference among plant lines, the placement of the specific primer within the insertion makes the discrimination straightforward since the primer can only amplify the DNA sequence in possession of the complementary target. Otherwise, the allele-specific primers can be made to coincide with smaller insertions or deletions or at positions of nucleotide substitution, especially at their 3' ends, as exemplified by the 288 primers. Previous research [2, 3, 9] has established that there are favored mispairings between primer and template that facilitate the specific frustration of amplification. It was ascertained, for example, that the specificity is enhanced if purines are mispaired with purines, and pyrimidines with pyrimidines. The exploitation, where possible, of multiple nucleotide differences to maximize the number of mismatches within a single primer or the pairing of two allele-specific amplifying primers (instead of using a "common" primer) also will facilitate allele-specific amplification. The use of dot-blot hybridization renders the technique sensitive and rapid, and obviates the need for agarose gels. The improved sensitivity of dot-blot hybridization over agarose electrophoresis enables the use of fewer numbers of cycles of amplification, an important consideration for the minimization of false positives resulting from the amplification of spurious mispairings. Our investigations have con-
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010
245 Detection of Sequence Variation
GATA 8(8): 240-245, 1991
firmed that PCR products are best detected by using an internal probe sequence as a hybridization probe rather than an amplifying primer sequence. The use of both the Techne temperature cycler, which has a 96-well plate format, and a 96-well dot-blot manifold allows for a relatively large number of determinations per amplification. We thank Mark Walton for his help in obtaining seed samples. This work was partially funded by NIH SBIR grant 2 R44 GM 40794-04/61601E.
2. Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C, Kalsheker N, Smith JC, Markham AF: Nucleic Acids Res 17:2503-2516, 1989 3. Kwok S, Kellog DE, McKinney N, Spasic D, Goda L, Levinson C, Sninsky JJ: Nucleic Acids Res 18:999-1005, 1990 4. SarkarG, CassadyJ, BottemaCDK, Sommer SS: Anal Biochem 186:64-68, 1990 5. Echt CS, Schwartz D: Genetics 99:275-284, 1981 6. Shattuck-Eidens DM, Bell RN, Neuhausen SL, Helentjaris TG: Genetics 126:207-217, 1990 7. Kl6sgen RB, Gierl A, Schwarz-Sommer Z, Saedler H: Mol Gen Genet 203:237-244, 1986 8. Okagaki RJ, Neuffer MG, Wessler SR: Genetics 128:425431, 1991
References 1, Wu DY, Ugazzoli L, Pal BK, Wallace RB: Proc Natl Acad Sci USA 86:2757-2760, 1989
9. Shattuck-Eidens DM, Bell RN, Helentjaris TG: In Osborn T, Beckmann J, (eds): Plant Genomes: Methods for Genetic and Physical Mapping. Amsterdam, Kluwer 1992 (in press)
© 1992 Elsevier Science PublishingCo., Inc. 655 Avenue of the Americas, New York, NY 10010
EMERGINGTECHNIQUES Rapid Detection of Maize DNA Sequence Variation D O N N A M. S H A T T U C K - E I D E N S , R U S S E L L N. B E L L , J E F F R E Y T. M I T C H E L L , and V A L E R I E C. M c W H O R T E R
The allele-specific polymerase chain reaction (ASPCR ) has been used to determine the genotype of maize lines at two loci, wx and NPI288. The ASPCR method uses allelespecific oligonucleotide primers in PCR amplifications to amplify and discriminate simultaneously between polymorphic alleles. The success of this technique relies on the specific failure of PCR to amplify with primers that do not perfectly match the DNA sequence of one of the allelic variants. Amplification results were evaluated by dot-blot hybridization using an alkaline-phosphatase-coupled probe. The technique's speed, accuracy, sensitivity, and high throughput make it valuable for plant-breeding applications.
Introduction Restriction fragment length polymorphism (RFLP) analysis is well suited for genetic mapping in plants in which a relatively large number of markers are used to probe a relatively small number of individuals. In contrast, RFLP analysis is poorly suited for applications in which large numbers of individuals are probed with a relatively small number of markers. A technique that would enable the analysis of a few marker loci in a large number of individuals would be a valuable tool in plant-breeding programs. One such technique is the allele-specific polymerase chain reaction (ASPCR) [1-4]. ASPCR is the selective amplification of specific alleles by oligonucleotide primers that match the nucleotide sequence of one allele, but mismatch the nucleotide sequence of a dissimilar allele. Here we report the application of ASPCR to the determination of alternate DNA seFrom Native Plants Incorporated (NPI), Salt Lake City, Utah, USA. Dr. McWhorter's present address is Biology Department, Stanford University, Stanford, California, USA. Address correspondence to Dr. D.M. Shattuck-Eidens, AgriDyne Technologies, Inc., 417 Wakara Way, Salt Lake City, UT 84108, USA. Received 28 August 1991; revised and accepted 21 October 1991.
quence variants within two maize loci: waxy [5] and NPI288 [6]. The waxy locus encodes a tissue-specific starch biosynthetic enzyme the DNA sequence of which was reported by K16sgen et al. [7]. The examination of DNA sequence at the waxy locus in five inbred lines revealed sequence polymorphisms. Similarly, comparisons among DNA sequence within the RFLP marker locus NPI288 revealed polymorphisms among seven inbred lines [6]. Oligonucleotide primers overlapping the sequence polymorphisms in these regions were used in PCR reactions to amplify segments of these two loci in an allele-specific fashion. Amplification results were evaluated by dot-blot hybridization with oligonucleotide probes that were labeled either with 32p o r with alkaline phosphatase and visualized by autoradiography or by chromogenic substrates, respectively.
Methods
Isolation of Genomic DNA Genomic DNA was extracted from pulverized freezedried maize leaves in 0.1 M Tris-Cl pH 7.5, 0.7 M NaCI, 10 mM EDTA, 1% mixed alkyltrimethylammonium bromide, and 1% 2-mercaptoethanol at 60°C for 60 min with occasional gentle mixing. After cooling to room temperature this material was gently extracted for 5 min with 24:1 chloroform-octanol and centrifuged for 10 min at 700 g. The aqueous layer was mixed with an equal volume of isopropanol, the precipitate spooled out with a glass hook and washed in 76% ethanol, 0.2 M NaOAc, and then in 76% ethanol, 10 mM NH4OAc, and finally dissolved overnight in 10 mM Tris-C1 pH 8, 1 mM EDTA, at 4°C. The DNA preparations were centrifuged for 10 min at 12,000 g to sediment the undissolved solids.
Amplification of Genomic DNA Two primers were prepared for amplification within the waxy sequence: WxS, 5'-GGAAAGACCGAGGA GAAGAT-3', corresponding to nucleotides 11611180 and WxR, 5'-GTAGGAGATGTTGTGGAT GC-3', complementary to nucleotides 1761-1780 [7]. Genomic DNA (0.25 ~g) was amplified in 25-1xL reactions composed of 10 mM Tris-C1 pH 8.4, 50 mM KC1, 2.5 mM MgC12, 0.4 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.2 mM dTTP, 0.5 ~M WxS, 0.5 txM WxR, and 20 U/mL Taq DNA polymerase (Perkin Elmer, Norwalk, CT). Reactions were performed in 0.65-mL microfuge tubes with a mineraloil overlay by using an Ericomp thermocycler (Eri-
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010 1050-3862/92/$5.00
241 Detection of Sequence Variation
GATA 8(8): 240-245, 1991
comp, San Diego, CA). Temperatures were cycled through one iteration of 5 min at 95°C, 1 min at 55°C, and 2 min at 72°C; 28 iterations of 30 s at 93°C, 1 min at 55°C, and 2 min at 72°C; and one iteration of 30 s at 93°C, 1 min at 55°C, and 8 min at 72°C. Eight microliters of each reaction were electrophoresed through 3% NuSieve GTG agarose (FMC BioProducts, Rockland, ME) gel in 0.1 M Tris-C1, 83 mM H3BO4, 1 mM EDTA, containing 0.5 txg/ mL ethidium bromide. Using a Pasteur pipet, a plug was removed from each band and melted in 100 ixL water in a boiling water bath for 2-3 min. Six microliters of this DNA preparation was used in subsequent asymmetric PCR reactions. The asymmetric amplifications were performed using the same conditions as those described above except that the "limiting" primer was 0.05 txM. The products from the asymmetric amplifications were precipitated from 2 M NH4OAc, 50% isopropanol at room temperature for 10 min. The DNA was centrifuged for 10 min at 12,000 g, washed with 1 mL cold 70% ethanol, dried under vacuum, and dissolved in 8 txL of water.
DNA Sequencing The asymmetrically amplified DNA was sequenced using a Sequenase 2.0 DNA sequencing kit (United States Biochemical Corporation, Cleveland, OH) and 10 pmol of the 'qimiting" primer. Sequencing reactions were carried out using [a-thio35S]dATP and following the kit instructions except that the primer was annealed for 5 min at 650C and 5 min at room temperature, and then chilled on ice. Sequencing reactions were labeled for 5 min on ice, terminated for 5 min at 37°C, and then combined with 4 ~L of stop buffer. Denatured sequencing reactions were electrophoresed on a 6% polyacrylamide, 7 M urea, field gradient (wedge) gel. The gel was fixed in 10% methanol, 10% acetic acid, for 30 min, dried at 80°C, and autoradiographed with X-OMAT AR diagnostic film (Eastman Kodak, Rochester, NY). Satisfactory results have also been obtained by sequencing DNA from the asymmetric PCR reaction after chromatography through a 0.7-cm diameter, 10cm-long column of Bio-Gel A50m (Bio-Rad Laboratories, Richmond, CA) equilibrated with 1 mM Tris-C1 pH 8, 0.1 mM EDTA, and 10 mM NaCI. The DNA-containing fraction of the eluate was concentrated 10-fold by freeze drying and the DNA was precipitated with ethanol. The DNA was dissolved in 7 ILL water and sequenced as described above except that the labeling reaction was carried out at room temperature rather than at 0°C.
Allele-Specific PCR Allele-specific PCR was performed in 25-1xL reactions composed of 10 mM Tris--Cl pH 8.4, 50 mM KCI, 2.5 mM MgC12, 20 Ixg/mL gelatin, 50 IxM dATP, 50 txM dCTP, 50 ~M dGTP, 50 fxM dTTP, 0.2 Ixg/mL RNase A, 10 U/mL RNase T1, 0.4 txM each primer, 20 U/mL Taq DNA polymerase, and 5 Ixg/mL genomic DNA. The reactions, in a Hi-Temp 96-well microplate (Techne Corporation, Princeton, NJ), were overlaid with 50-100 ~xL mineral oil to prevent evaporation. Temperatures were cycled in a Techne MW-2 thermal cycler through 30 iterations of 1 min at 94°C, 1 min at 55°C, and 2 rain at 72°C.
Detection To assess the outcome of the ASPCR, 3 IxL of each reaction was diluted in 300 txL 0.15 M NaC1 and filtered through a Biodyne-B membrane (Pall Biosupport, Glen Grove, NY) in a dot-blot manifold with 10 mm Hg vacuum. The membrane was placed on Whatman-3MM paper saturated with 0.2 M NaOH, 0.15 M NaC1, for 1 rain to denature the DNA, transferred to 3MM paper saturated with 1 M Tris-C1 pH 7.5, 0.15 M NaCI, for 2 min to neutralize the DNA, washed for 10 rain in 2 x SSC, and allowed to dry. Dot blots were prehybridized for 20 rain at 50°C in "hyb" solution (5 x SSC, 1% SDS, and 0.5% BSA), and then hybridized for 20 min at 50°C in "hyb" solution containing 5 nM probe. Two different types of probes and detection methods were used. For waxy, the oligonucleotide WxP, 5'-TCCAAGGATCCT GAGCCTCA-3', corresponding to nucleotides 13401359, was end-labeled with 32p. WxP (10 pmol) was incubated for 30 min at 37°C in a 10-~L reaction composed of 70 mM Tris-C1 pH 7.6, 0.1 M KC1, 10 mM MgC12, 5 mM dithiothreitol, 0.5 mg/mL BSA, 10 fxM [~/J~P]ATP, and 1000 U/mL T4 polynucleotide kinase. The kinase was inactivated by heating 10 rain at 96°C and the probe was used without further purification. The probe for NP1288 (SNAP288) is an oligonucleotide to which alkaline phosphatase has been chemically coupled (SNAP; Molecular Biosystems, San Diego, CA). This probe, 5'GTATCGCGAACGTCATGATC-3', hybridizes to a conserved sequence within the amplification interval of NPI288. Following two 10-min washes in 2 x SSC, 1% SDS, and one 10-min wash in 2 x SSC, all at room temperature, the probes were visualized either by autoradiography on X-OMAT AR diagnostic film or with chromogenic substrates for alkaline phosphatase. The SNAP288 was visualized in
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010
242 D.M. Shattuck-Eidens et ah
GATA 8(8): 240-245, 1991
a
1601
I A619 B73 C103
CAGGGACGC-AAGGTTGCCTTCTCTGCTGA-CTGAACAAGCCGGTCTTCGTTCTC CAGGGACGCAAAGGTTGCCTTCTCTG---AACTGAACAANGCCGTCTTCGTTCTC CAGGGACGCAAAGGTTGCCTTCTCTGCTGAACTGAACAACGCCGTCTTCGTTCTC
Wxwild Mo17
wxMo17
A619 B73 C103 Mo17 wxMo17
CAGGGACGCAAAGGTTGCCTTCTCTGCTGAACTGAACAACGCCGTCNN-GTTCTC CAGGGACGC . . . . . . . CGTTTTCGTTCTC wxMo17-2
1675
1711
I
I
CATGCT--GATATACCT-ATCTG---GTGGTGGTGCTTCTCTGAAACTGAAACTGAAAC CATGCT--GNTATACCTCGTCTG---GTGGTGGTGCTTCTCTGA .... GAAACTGAAAC CATGCTCGTATATACCTCATCTG---GTGGTGGTGCTTCTCTGAAACTGAAACTGAAAC CATGCTNGNATATNCCTCATCTG---GTGGTGGTGCTTCTCTGAAACTGAAANCGAAAC CATGCTCGTATATACCTCGTCTGGTAGTGGTGGTGCTTCTCTGAGAAACTAACTGAAAC wxMo17-1
b 1780
I
I 1161 WxR
WxwHd
Figure 1. (a) The alignment of DNA sequences within the maize waxy locus of five variant maize lines. Lines A619, B73, C103, and Mo17 are wild-type, but wxMolT, a derivative of Mo17, carries a wx mutation. The absence of nucleotides is indicated by (-), N indicates sequencing gel ambiguities, and the sequences complementary to oligonucleotides wxwild, wxMol7-1, and wxMol7-2 are indicated by underlining. (b) Schematic representation of the waxy locus between nucleotides 1161-1780 showing the relative positions and orientations of the various waxy oligonucleotides. The triangles depict the locations of the deletion and the insertion. The nucleotide numbering is consistent with that of the published sequence of the wild-type allele [7].
a solution containing 0.1 M Tris-C1 pH 9, 0.1 M NaCI, 50 mM MgC12, 0.35 mM 5-bromo-4-chloro3-indolylphosphate p-toluidine salt (BCIP), and 0.35 mM nitroblue tetrazolium chloride (NBT) (BCIP and NBT; BRL, Gaithersburg, MD).
Results and Discussion waxy Figure 1a shows the comparison of sequence between nucleotides 1601 and 1711 among five maize inbreds. The sequence of the waxy mutant allele wxMol 7 can be distinguished from the sequences of four wildtype alleles by two sequence variations: a small in-
sertion of three nucleotides at position 1675 and by the deletion between 1609 and 1639. Using these data, four oligonucleotide primers were synthesized for the allele-specific PCR amplifications of the waxy locus. The nucleotides complementary to the primers are underlined in Figure la. The wxMol7-1 primer (5'-AGCACCACCACTAC-T) matches the wxMol 7 sequence exactly, but the three nucleotides on the 3' end are mispaired with the wild-type maize sequences. The wxMol7-2 primer (5'-CGAAAA CGGCGTCC-3') is complementary to the DNA sequence that spans the deletion in wxMol 7. The target site for wxMol7-2 is therefore continuous in wxMo17, but is interrupted in the wild-type lines. Wxwild
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010
243 Detection of Sequence Variation
GATA 8(8): 240-245, 1991
Meize
Line~ v'-
O~ ~D
I',-
~'9
I',-
O
T-
O
X
Primers Wxwild wxMo17-1 wxMo17-2 Figure 2. Autoradiogram of hybridized dot blot exhibiting the presence or absence of amplified product, enabling allelic assignment in waxy. The rows correspond to the allele-specific primer used in the reaction, and the columns correspond to the maize lines evaluated.
(5'-TCAGCAGAGAAGGCAACCTT-Y) is homologous to sequence entirely within the deletion and is consequently specific to the four wild-type maize lines. The relationship among the oligonucleotides used in the waxy ASPCR is depicted in Figure lb. WxS (5'-GGAAAGACCGAGGAGAAGAT-Y) and
WxR (5'-GTAGGAGATGTrGTGGATGC-Y) match all five DNA sequences. WxS was used as the "common" primer in all of the waxy ASPCR amplifications. WxP, which hybridizes to a conserved region between the PCR primers, was radiolabeled and used as a hybridization probe in the dot-blot assay. The autoradiogram in Figure 2 shows a positive reaction when Wxwild is used to amplify genomic DNA from the lines carrying wild-type alleles A619, B73, C103, or Mo17, but not genomic DNA from wxMo17. Amplifications with both wxMol7-1 and wxMol7-2 exhibit the opposite behavior: these primers amplify genomic DNA from wxMo17, but fail to amplify genomic DNA from the lines carrying wildtype alleles. Interestingly, the deletion spanned by wxMol7-2 is in the same location as the deletion recently reported by Okagaki et al. [8]. It appears that wxMol 7, wx1240, and wxC are identical in this region. Okagaki et al. present convincing evidence that this deletion is responsible for the mutant phenotype in wx1240. We sequenced two other wx alleles supplied by Dr. David Glover of Purdue University. These two alleles, wx standard and wxB, also have this deletion. One other wx allele was sequenced, wxB73, but this
m
a
MO17
3' C T T G A T G A C G T G G
A CGTGACTAC...5'
288-i
5'
T 3 ' ~
B73
3' C T T G A T G A C G T G G
288-2
5'
GAACTACTGCACC
T CGTGACTAC...5'
GAACTACTGCACC__.AI3 ' ~
288-1 908
I
I 338
b
~=
-I~
"91"~"~''~
~m ~'--"~----
Figure 3. (a) DNA sequences within the NP1288 marker locus of two variant maize lines, Mo17 and B73. The primers 288-1 and 288-2 and their complementary sequences are shown. The box highlights the 3' ends of the allele-specific primers, that is, primers that either match or mismatch the two genomic sequences. (b) Schematic representation of a portion of the NPI288 sequence showing the relative positions and orientations of the various NP1288 oligonucleotides.
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010
244 D.M. Shattuck-Eidens et al.
GATA 8(8): 240-245, 1991
allele did not have the deletion (data not shown). Both wxMol7 and wxB73 were supplied by Virgil Ferguson of Custom Farm Seed. The small 3-bp insertion in wxMo17 at nucleotide 1675 is present in the wild-type C allele [7], but absent from the wildtype alleles of A619, B73, C103, and Mo17. This insertion is probably unrelated to the mutant phenotype. NP1288 From the DNA sequence information obtained from clone NPI288 [6], primers were constructed that enabled the differential amplification of two alleles of NPI288. Figure 3a shows the primers used in the ASPCR amplification of NPI288 alleles. The T at the 3' end of primer 288-1 matches the DNA sequence of the allele in Mol 7, but is mispaired with a T in the DNA sequence of the B73 allele. Conversely, the A at the 3' end of primer 288-2 matches the DNA sequence of the B73 allele, but is mispaired with an A in the DNA sequence of the Mol 7 allele. These primers facilitate ASPCR amplification when paired with the "common" primer 288-3 (Figure 3b). The reactions were evaluated by dot-blot hybridization with SNAP288, and successful amplifications were scored as positives by visualization using the chromogenic substrates BCIP and NBT. Figure 4 demonstrates the accurate assignment of alleles of NP1288 between the two inbred maize lines.
~aize Lines Mo17
B73
!
288-1 !i / ¸
•
'ii i,~! ~,'iIII ,
288-2 ~'~!!,i,!i~, ii~i
Figure 4, Photograph of color-visualized hybridization spots exhibiting the presence or absence of amplified product, enabling allelic assignment in N P 1 2 8 8 . The r o w s correspond to the allelespecific primer used in the reaction, and the c o l u m n s correspond to the maize lines evaluated.
Summary The analytic technique described here is designed to handle large numbers of samples. The technique is
complementary to RFLP analysis, which is not well suited for high throughput with few markers. ASPCR could be applied in a plant-breeding program to markers that have been linked to traits of interest by RFLP analysis. Once the informative markers are identified, further analysis of the populations can be focused on that limited set of markers. The most difficult aspect of the procedure is the development of allele-specific reagents. The applicability of this method to a given species relies on the extensiveness of the DNA sequence polymorphism in the genomic region of interest. Previous work [6] has suggested that there is variation in the occurrence of DNA sequence polymorphism among plant species. The more DNA sequence polymorphism exhibited by a species, the less extensive must be the search for nucleotide differences. There are some considerations concerning the design of allele-specific oligonucleotide primers that are governed by the nature of the sequence differences among the variants. The most uncomplicated configuration is the presence of a relatively long segment of inserted DNA or, conversely, the deletion of an interval of DNA as in the instance of wxMol7. Where there is such a difference among plant lines, the placement of the specific primer within the insertion makes the discrimination straightforward since the primer can only amplify the DNA sequence in possession of the complementary target. Otherwise, the allele-specific primers can be made to coincide with smaller insertions or deletions or at positions of nucleotide substitution, especially at their 3' ends, as exemplified by the 288 primers. Previous research [2, 3, 9] has established that there are favored mispairings between primer and template that facilitate the specific frustration of amplification. It was ascertained, for example, that the specificity is enhanced if purines are mispaired with purines, and pyrimidines with pyrimidines. The exploitation, where possible, of multiple nucleotide differences to maximize the number of mismatches within a single primer or the pairing of two allele-specific amplifying primers (instead of using a "common" primer) also will facilitate allele-specific amplification. The use of dot-blot hybridization renders the technique sensitive and rapid, and obviates the need for agarose gels. The improved sensitivity of dot-blot hybridization over agarose electrophoresis enables the use of fewer numbers of cycles of amplification, an important consideration for the minimization of false positives resulting from the amplification of spurious mispairings. Our investigations have con-
© 1992 Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY 10010
245 Detection of Sequence Variation
GATA 8(8): 240-245, 1991
firmed that PCR products are best detected by using an internal probe sequence as a hybridization probe rather than an amplifying primer sequence. The use of both the Techne temperature cycler, which has a 96-well plate format, and a 96-well dot-blot manifold allows for a relatively large number of determinations per amplification. We thank Mark Walton for his help in obtaining seed samples. This work was partially funded by NIH SBIR grant 2 R44 GM 40794-04/61601E.
2. Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C, Kalsheker N, Smith JC, Markham AF: Nucleic Acids Res 17:2503-2516, 1989 3. Kwok S, Kellog DE, McKinney N, Spasic D, Goda L, Levinson C, Sninsky JJ: Nucleic Acids Res 18:999-1005, 1990 4. SarkarG, CassadyJ, BottemaCDK, Sommer SS: Anal Biochem 186:64-68, 1990 5. Echt CS, Schwartz D: Genetics 99:275-284, 1981 6. Shattuck-Eidens DM, Bell RN, Neuhausen SL, Helentjaris TG: Genetics 126:207-217, 1990 7. Kl6sgen RB, Gierl A, Schwarz-Sommer Z, Saedler H: Mol Gen Genet 203:237-244, 1986 8. Okagaki RJ, Neuffer MG, Wessler SR: Genetics 128:425431, 1991
References 1, Wu DY, Ugazzoli L, Pal BK, Wallace RB: Proc Natl Acad Sci USA 86:2757-2760, 1989
9. Shattuck-Eidens DM, Bell RN, Helentjaris TG: In Osborn T, Beckmann J, (eds): Plant Genomes: Methods for Genetic and Physical Mapping. Amsterdam, Kluwer 1992 (in press)
© 1992 Elsevier Science PublishingCo., Inc. 655 Avenue of the Americas, New York, NY 10010
