Microbiology (2014), 160, 91–101

DOI 10.1099/mic.0.071233-0

Regulation of the Bacillus subtilis mannitol utilization genes: promoter structure and transcriptional activation by the wild-type regulator (MtlR) and its mutants Kambiz Morabbi Heravi and Josef Altenbuchner Correspondence Josef Altenbuchner

Institut fu¨r Industrielle Genetik, Universita¨t Stuttgart, Allmandring 31, 70569 Stuttgart, Germany

[email protected]

Received 15 July 2013 Accepted 6 November 2013

Expression of mannitol utilization genes in Bacillus subtilis is directed by PmtlA, the promoter of the mtlAFD operon, and PmtlR, the promoter of the MtlR activator. MtlR contains phosphoenolpyruvate-dependent phosphotransferase system (PTS) regulation domains, called PRDs. The activity of PRD-containing MtlR is mainly regulated by the phosphorylation/ dephosphorylation of its PRDII and EIIBGat-like domains. Replacing histidine 342 and cysteine 419 residues, which are the targets of phosphorylation in these two domains, by aspartate and alanine provided MtlR-H342D C419A, which permanently activates PmtlA in vivo. In the mtlRH342D C419A mutant, PmtlA was active, even when the mtlAFD operon was deleted from the genome. The mtlR-H342D C419A allele was expressed in an Escherichia coli strain lacking enzyme I of the PTS. Electrophoretic mobility shift assays using purified MtlR-H342D C419A showed an interaction between the MtlR double-mutant and the Cy5-labelled PmtlA and PmtlR DNA fragments. These investigations indicate that the activated MtlR functions regardless of the presence of the mannitol-specific transporter (MtlA). This is in contrast to the proposed model in which the sequestration of MtlR by the MtlA transporter is necessary for the activity of MtlR. Additionally, DNase I footprinting, construction of PmtlA-PlicB hybrid promoters, as well as increasing the distance between the MtlR operator and the ”35 box of PmtlA revealed that the activated MtlR molecules and RNA polymerase holoenzyme likely form a class II type activation complex at PmtlA and PmtlR during transcription initiation.

INTRODUCTION Bacillus subtilis mainly takes up carbohydrates via a phosphoenolpyruvate-dependent phosphotransferase system (PTS) (Reizer et al., 1999). In the PTS, a carbohydrate is concomitantly taken up and phosphorylated by its specific transporter (also known as enzyme II or EII). In addition to the sugar-specific transporter, the PTS consists of general proteins, namely enzyme I (EI) and a histidine containing phosphocarrier protein (HPr). EI phosphorylates HPr at histidine 15 using phosphoenolpyruvate (PEP) as the donor of the phosphoryl group. HPr(H15~P) then transfers the phosphoryl group to the sugar-specific EII. The PTS is not only used for sugar uptake. HPr of B. subtilis can also be phosphorylated at serine 46 by HPr kinase in response to the concentration of the glycolysis Abbreviations: CAT, co-antiterminator; CCA, carbon catabolite activation; CcpA, carbon catabolite protein A; CCR, carbon catabolite repression; cre, catabolite responsive element; EI, enzyme I; EII, enzyme II; HPr, histidine containing phosphocarrier protein; PTS, Phosphoenolpyruvate-dependent phosphotransferase system; PRD, PTS regulation domain; RNAP, RNA polymerase holoenzyme.

071233 G 2014 SGM

Printed in Great Britain

intermediate, fructose 1,6-biphosphate. In this case, it acts as a signal transduction system by which the cell regulates various operons in response to the presence/absence of specific carbohydrates in the milieu. This is mainly mediated by a global regulator, the carbon catabolite protein A (CcpA). CcpA binds in a complex with HPr(S46~P) to a specific cis element (cre site) at the target promoters causing carbon catabolite repression/activation (CCR/CCA) (for reviews, see Deutscher et al., 2006; Fujita, 2009; Sonenshein, 2007). In B. subtilis, expression of the operons encoding the PTS components is generally regulated by transcriptional antiterminators, activators or repressors (Deutscher et al., 2002, 2006). Amongst these, transcriptional antiterminators and activators have received particular attention due to their interactions (phosphoryl group transfer and/or direct protein–protein interaction) with the cognate sugarspecific transporters as well as with HPr, which allows a completely different, CcpA-independent, type of carbon catabolite repression (Joyet et al., 2013). Antiterminators, such as LicT, consist of an RNA binding domain (CAT) and two PTS regulation domains (PRDI and PRDII) 91

K. M. Heravi and J. Altenbuchner

(Stu¨lke et al., 1998). Each of the PRDI and PRDII domains can be phosphorylated on their conserved histidyl residues, PRDI by its cognate PTS transporter in the absence of inducer, and PRDII by HPr(H15~P) in the absence of glucose. In the presence of inducer, PRDI is dephosphorylated and the antiterminator becomes active, but only when there is no preferred glucose in the medium. When glucose is present, PRDII is not phosphorylated by HPr(H15~P) and the antiterminator becomes inactive (Lindner et al., 1999, 2002; Tortosa et al., 2001). The operons encoding the glucose-, sucrose- and b-glucosides-PTSs are regulated by PRDcontaining antiterminators which are GlcT (Stu¨lke et al., 1997), SacT (Arnaud et al., 1992), SacY (Crutz et al., 1990) and LicT (Schnetz et al., 1996). The operons encoding the mannitol-, mannose- and oligo b-glucoside-PTSs are regulated by their specific activators,

i.e. MtlR (Watanabe et al., 2003), ManR (Sun & Altenbuchner, 2010) and LicR (Tobisch et al., 1999), respectively. Similar to the PRD-containing antiterminators the PRD-containing activators MtlR, ManR and LicR carry two PRD domains, whereas the CAT domain is replaced by a DNA-binding domain of the DeoR type. All these three activators carry additional EIIA and EIIB regulatory domains similar to the cytoplasmic domains of PTS transporters (Greenberg et al., 2002). Due to this difference, the activities of MtlR, ManR and LicR are modulated by the (de)phosphorylation of their PRDII, EIIA- and EIIB-like conserved regulatory domains, whereas the PRDI domain does not seem to play any role (Joyet et al., 2013). There are two additional activators for PTS transporters in B. subtilis, LevR and MalR. LevR is a NifA/ NtrC-type PRD-containing activator interacting with the RNA polymerase holoenzyme (RNAP) containing sL (Martin-Verstraete et al., 1992). The activity of MalR is supposed to be regulated by maltose 6-phosphate via a sugar isomerase domain (SIS) (Yamamoto et al., 2001). The mannitol utilization system of B. subtilis consists of the mtlAFD operon (mtlA encodes EIICBMtl, mtlF encodes EIIAMtl, and mtlD encodes mannitol 1-phosphate 5dehydrogenase) and a separated mtlR locus (activator encoding gene) (Joyet et al., 2010; Watanabe et al., 2003). MtlR activates the promoters of both, the mtlAFD operon (PmtlA) and mtlR (PmtlR), each containing a sA-type promoter structure (Heravi et al., 2011; Watanabe et al., 2003). The prerequisite step for the activation of MtlR is the HPr(H15~P)-dependent phosphorylation of the MtlR PRDII domain (H342 residue). Any loss of phosphorylation in PRDII due to shortage of HPr(H15~P) renders MtlR completely inactive (Joyet et al., 2010). Mutation of H342 to aspartate compensates the dependency of MtlR on HPr(H15~P)-dependent phosphorylation (Heravi et al., 2011; Joyet et al., 2010). Complete activation (or induction) of MtlR additionally needs dephosphorylation of the EIIBGat-like domain of MtlR. Phosphorylation and dephosphorylation occurs via the cytoplasmic phosphocarrier EIIAMtl (MtlF). The uptake of mannitol leads to the dephosphorylation of MtlF~P. As a result, the MtlF protein 92

dephosphorylates the EIIBGat-like domain of MtlR (Joyet et al., 2010). In addition to (de)phosphorylation of MtlR, it has been recently reported that MtlR sequestration by MtlA (EIICBMtl) might also be necessary for the activity of MtlR (Bouraoui et al., 2013; Joyet et al., 2013). Prior to that, the protein–protein interaction between a regulator and its cognate transporter was also reported for the (de)activation of the E. coli antiterminator, BglG (Lopian et al., 2003). To clarify whether the active form of MtlR needs the transporter for its function, we studied mtlR mutants in different backgrounds. In this way, we showed that a double-mutant MtlR was functional in vivo as well as in vitro, even when MtlA was absent. Likewise, the MtlR binding site at PmtlA and PmtlR was characterized by using the active double-mutant MtlR.

METHODS Bacterial strains and growth conditions. The bacterial strains

used in this study are listed in Table 1. Escherichia coli JM109 was used for plasmid propagation. B. subtilis 3NA was used as a host for expression vectors or gene integration. Unless otherwise specified, transformants of E. coli and B. subtilis were selected on LB agar (Luria et al., 1960) supplemented with ampicillin (100 mg ml21) or spectinomycin (100 mg ml21) depending on the plasmid antibiotic marker. Integration mutants of B. subtilis were selected on LB agar containing chloramphenicol (5 mg ml21), erythromycin (5 mg ml21) or spectinomycin (100 mg ml21). Histidine prototroph transformants were selected on Spizizen’s minimal medium (Harwood & Cutting, 1990), while the histidine auxotroph mutants were tested on Spizizen’s minimal medium with 20 mg ml21 L-histidine. Induction of the mtl promoters, the hybrid promoters, or the lic operon promoter was carried out by 1 : 50 inoculation of the strains in 42.5 ml LB in 250 ml Erlenmeyer flasks followed by overnight culture. All strains were incubated at 37 uC with shaking at 200 r.p.m. Aliquots of 8 ml with an OD600 of 0.4 were divided in 100 ml Erlenmeyer flasks and subsequently induced by the addition of different carbohydrates, namely mannitol, mannitol together with glucose, cellobiose, or cellobiose with glucose to a final concentration of 0.2 % (w/v) for each carbohydrate. Cultures were harvested 1 h after the addition of the carbohydrates and used for b-galactosidase activity measurements. All experiments were repeated at least three times and mean values and standard deviations are presented. DNA manipulation and bacterial transformation. Standard

molecular techniques were used according to Sambrook et al. (1989). Natural transformation of B. subtilis was performed according to the ‘Paris Method’ (Harwood & Cutting, 1990). The oligonucleotides (synthesized by Eurofins MWG Operons) employed in this study are listed in Table 2. PCRs were performed using Phusion Hot Start II High-Fidelity DNA Polymerase (Fisher Scientific GmbH) on a PTC-200 Peltier Thermal Cycler (MJ Research). DNA preparation kits (Qiagen) were used for chromosomal DNA or plasmid extraction according to the manufacturers’ instructions. DNA constructs were sequenced by GATC Biotech AG. Construction of mtlR mutants. Construction of different B. subtilis

mtlR mutants was performed by replacement of a chromosomal erythromycin resistance gene via homologous recombination with a particular mtlR allele. To amplify PmtlR-mtlR-H342D, PCRs were performed with the oligonucleotides s6949/s6865 and s6866/s6867 using B. subtilis 168 chromosomal DNA as a template. Next, fusion Microbiology 160

Activation of the B. subtilis mtl promoters

Table 1. Strains and plasmids used in this study Strain or plasmid E. coli strains JM109 JW2409-1 B. subtilis strains 3NA KM13 KM15 KM162 KM176 KM209 KM213 KM229 KM231 KM240 KM241 KM271 Plasmids pDG1730 pHM30 pHM31 pIC20HE pJOE6089.4 pMW363.1 pSUN279.2 pKAM1 pKAM4 pKAM6 pKAM12 pKAM18 pKAM19 pKAM21 pKAM66 pKAM123 pKAM126 pKAM145 pKAM160 pKAM161 pKAM162 pKAM167 pKAM168 pKAM170 pKAM176 pKAM182 pKAM191 pKAM223

Genotype or relevant structure recA1, endA1, gyrA96, thi-1, hsdR17(rK2, mk+), mcrA, supE44, gyrA96, relA1, l2, D(lac-proAB), F9 (traD36, proAB+, lacIq, (DlacZ)M15) F2, D(araD-araB)567, DlacZ4787( : : rrnB-3), l2, DptsI745 : : kan, rph-1, D(rhaD-rhaB)568, hsdR514

Source or reference Yanisch-Perron et al. (1985) Baba et al. (2006)

spo0A3 spo0A3 DmtlAFD : : ermC spo0A3 DmtlR : : ermC spo0A3 DmtlR : : ermC hisI9, spc spo0A3 amyE : : [ter-PmtlA-lacZ, spc] spo0A3 mtlR-H342D spo0A3 mtlR-H342D amyE : : [ter-PmtlA-lacZ, spc] spo0A3 DmtlR : : ermC hisI-[mtlR-H342D C419A-PmtlR]-yvcA spo0A3 DmtlR : : ermC hisI-[mtlR-H342D C419A-PmtlR]-yvcA amyE : : [ter-PmtlA-lacZ, spc] spo0A3 DmtlAFD : : ermC amyE : : [ter-PmtlA-lacZ, spc] spo0A3 DmtlR : : ermC amyE : : [ter-PmtlA-lacZ, spc] spo0A3 DmtlR : : ermC hisI-[mtlR-H342D C419A-PmtlR]-yvcA amyE : : [ter-PmtlA-lacZ, spc] DmtlAFD : : [mroxP-cat-mroxP]

Michel & Millet (1970) Heravi et al. (2011) Heravi et al. (2011) This study This study This study This study This study This study

erm, bla, amyE9-spc-amyE9 hisF9-hisI9-spc-yvcA-yvcB, bla hisF9-hisI-yvcA-yvcB, bla lacZ, bla, oripUC18 oripBR322, rop, cer, rhaPBAD, eGFP-Strep-tag II-rrnB, bla ter, spc, manP9-cat-yjdB-yjdA9, bla ter-PmanR-manR-PmanP-lacZ-ter, repA, oripUC18, oripBS72, spc ter-PmtlA(2181 A 21)*-lacZ-ter, spc ‘ycsN-ermC-ydaB’, bla, spc ‘ycnL-ermC-ycsA’, spc, bla ter-PmtlA9(2161A 232)*-lacZ-ter, spc ter-PmtlR9(2200A 215)*-lacZ-ter, spc mroxP-cat-mroxP ter-PHP7-lacZ-ter, spc hisF9-hisI-mtlR-H342D-PmtlR-yvcA-yvcB, bla amyE9-ter-PmtlA-lacZ-spc-amyE9, bla, ermC ‘ycsN-PmtlR-mtlR-H342D-ydaB’, bla, spc ter-PmtlA+10-lacZ-ter, spc ter-PlicB-lacZ-ter, spc ter-PHP41-lacZ-ter, spc ter-PHP42-lacZ-ter, spc ter-PmtlA+11-lacZ-ter, spc ter-PmtlA+9-lacZ-ter, spc ‘ycsN-PmtlR-mtlR-H342D C419A-ydaB’, bla, spc ter-PHP43-lacZ-ter, spc rhaPBAD-mtlR-H342D C419A hisF9-hisI-mtlR-H342D C419A-PmtlR-yvcA-yvcB, bla ‘ycnL- mroxP-cat-mroxP-ycsA’, spc, bla

Gue´rout-Fleury et al. (1996) Motejadded & Altenbuchner (2007) Motejadded & Altenbuchner (2007) Altenbuchner et al. (1992) Hoffmann et al. (2012) Heravi et al. (2011) Sun & Altenbuchner (2010) Heravi et al. (2011) Heravi et al. (2011) Heravi et al. (2011) Heravi et al. (2011) Heravi et al. (2011) This study This study Heravi et al. (2011) This study This study This study This study This study This study This study This study This study This study This study This study This study

This study This study This study

*The numbers show the base pair position with respect to the start codon of the wild-type gene.

PCR was carried out using the primary PCR products and oligonucleotides s6949/s6867. The amplified PmtlR-mtlR-H342D fragment was then inserted into pKAM4 via XmaI/SpeI digestion creating pKAM126. Afterwards, strain KM15 (DmtlR) was transformed http://mic.sgmjournals.org

with pKAM126 to construct strain KM209 (mtlR-H342D). PmtlR-mtlRH342D C419A was generated by fusion PCR using oligonucleotides s6949/s7301 and s7302/s6867 and pKAM126 as a template. The fusion PCR was performed by using the primary PCR products and 93

K. M. Heravi and J. Altenbuchner

Table 2. Oligonucleotides used in this study Name

Sequence (5§A3§)

s6209 s6213 s6392 s6465 s6466 s6504 s6505 s6506 s6507 s6865 s6866 s6867 s6949 s7301 s7302 s7303 s7304 s7455 s7481 s7548 s7614 s7615 s7616 s7617 s7618 s7619 s7678 s7679 s7714

AAAAAAGCTAGCTTTTTATTTTTAAAAAATTGTCACAGTCA AAAAAACTTAAGTAAGATACAAAAATATGTTCAGAGA AAAAAACTTAAGAGCCAATCTTGATGTGCGG AAAAAACTCGAGTCTGGCTCTTGATAATGTACACTATACGAAGTTATACTAGTAGCACGCCATAGTGACTG AAAAAAGAATTCTCTGGCTCTTGATAATGTACACTATACGAAGTTATACTAGTAGTTATTGGTATGACTGGTTT AAAAAAGCTAGCGTTATAGGGAAAAATGCCTTTATT ACGCTTACAGTCCCTATACAATTTTTTTACCATAGGTTCCG CGGAACCTATGGTAAAAAAATTGTATAGGGACTGTAAGCGT AAAAAACTTAAGTAAGATACAAAAATATGTTCAGAGAATG GCTGACGGCCGGCTCCAGATCTGCAATCAAGCCTTCATATAA TTATATGAAGGCTTGATTGCAGATCTGGAGCCGGCCGTCAGC AAAAAAACTAGTTTACAGTATGTTTTTTTCTTTCAT AAAAAACCCGGGTACGATATTCCATAAAAAGC GAGCCGATCCCGCTGCTCGCGACGACAAGCGCTTTCA TGAAAGCGCTTGTCGTCGCGAGCAGCGGGATCGGCTC AAAAAACTTAAGAAGGAGATATACATATGTATATGACTGCCAGAGAAC AAAAAACCCGGGTTACAGTATGTTTTTTTCTTTCATC AAAAAAGAATTCTTATTATTATTTTTGACACCAGAC AAAAAAAAGCTTCGTCGAGACCCCTGTGGGTCTCGTTTTTTGGATCCGGCGCCCACGT AAAAACAATTGAAAGAAATTGAAAGTAAAGAGGACTTTGG CCCCCCGCTAGCCAGCCTGTATATACCTTTTTTCC CCCCCCCTTAAGAGAGTTTGATCAATTTTGTAATGT AAAAAAGGTCTCAATGTTTATGAAAGCGATTTC AAAAAAGGTCTCAACATTGAAAGTAAAGAGGACTT GCTTTCATAAACACTCAGGGTAAAGAGGACTTTGGCACATGACT AGTCATGTGCCAAAGTCCTCTTTACCCTGAGTGTTTATGAAAGC AAAAACAATTGAAAGAAAATTGAAAGTAAAGAGGACTTTGG AAAAACAATTGAAAGAATTGAAAGTAAAGAGGACTTTGG AAAAAAGCTAGCTTTTTATTTTTAAAAAATTGTCACAGTCATGTGCCAAAGTCCTCTTTACTTTGAGTGTTTATGAAAGCGATTTC CTCTTGCCAGTCACGTTACG Cy5-CCAGTCACGACGTTGTAAAAC Cy5-CTCTTGCCAGTCACGTTACG

s8447 s5960 s8365

oligonucleotides s6949/s6867. The generated PmtlR-mtlR-H342D C419A fragment was inserted into pKAM4 via XmaI/SpeI digestion to form pKAM170. Afterwards, pKAM170 was digested by SpeI/XmaI, and pHM31 digested by NheI/XmaI. The 2.3 kb fragment from pKAM170 was then inserted into pHM31 vector constructing pKAM191. Integration of PmtlR-mtlR-H342D C419A into the chromosome was carried out according to the markerless integration method of Motejadded & Altenbuchner (2007) based on histidine auxotrophy. At first, strain KM15 (DmtlR) was transformed with pHM30 to create a histidine auxotrophic strain with spectinomycin resistance gene within its chromosome (KM162). Next, strain KM162 (spc+, his2, DmtlR) was transformed with pKAM191 and the histidine prototroph transformants containing the integrated mtlR allele were selected on Spizizen’s minimal medium (strain KM229). To integrate the PmtlA-lacZ cassette into the chromosome of B. subtilis, plasmid pDG1730 containing the amyE integration cassette was used. A PCR with oligonucleotides s7455/s7481 and pKAM12, as a template, was carried out. The amplified PmtlA-lacZ fragment was then inserted into pDG1730 via HindIII/EcoRI restriction sites creating pKAM123. Subsequently, B. subtilis 3NA, KM13, KM15, KM209 and KM229 were transformed with pKAM123 constructing strains KM176, KM240, KM241, KM213 and KM231. The latter transformants were selected on LB medium supplemented with spectinomycin. To delete the mtlAFD operon in the strain KM231 and create strain KM271, plasmid 94

pKAM223 was employed in which the erythromycin resistance gene of pKAM6 was replaced with a chloramphenicol resistance gene. For this purpose, pMW363.1 containing the chloramphenicol resistance gene was used as a template for PCR employing oligonucleotides s6465 and s6466. The resulting fragment was then inserted into pIC20HE via XhoI/EcoRI restriction sites creating pKAM19. Plasmid pKAM19 was then digested by XmaI/NheI and the chloramphenicol resistance gene was inserted into pKAM6 which was cut by XmaI/SpeI to create pKAM223. Construction of expression plasmids. PCR was performed for

amplification of the desired DNA fragment using chromosomal DNA of B. subtilis 168 as a template. Unless otherwise specified, the amplified promoter fragments were inserted into pSUN279.2 upstream of lacZ via NheI and AflII restriction sites. Amplification of the promoter of the licBCAH operon (PlicB) was performed using oligonucleotides s7614/s7615. The resulting fragment was then inserted into pSUN279.2 to create pKAM160. Hybrid promoter 41 (PHP41) was created by amplification of the truncated PmtlA fragment using oligonucleotides s6209/s7617, while oligonucleotides s7616/ s7615 were employed to amplify the truncated PlicB fragment. The primary PCR products were digested by BsaI followed by ligation. The ligation reaction was then used as a template for a PCR by oligonucleotides s6209/s7615. By insertion of the PHP41 into Microbiology 160

Activation of the B. subtilis mtl promoters pSUN279.2, plasmid pKAM161 was constructed. To create PHP42, oligonucleotides s6209/s7618 and s7619/s7615 were used in the PCRs prior to the final fusion PCR by s6029/s7615. Insertion of PHP42 into pSUN279.2 resulted in pKAM162. PHP43 was created by using oligonucleotides s7714 and s7615 in a PCR. The final fragment was inserted into pSUN279.2 to construct pKAM176. Promoter PmtlA+10 was created in a PCR using oligonucleotides s6209/s7548 the product of which was inserted into pSUN279.2 to construct pKAM145. To create PmtlA+11 and PmtlA+9, oligonucleotides s6209/s7678 and s6209/ s7679 were used in PCR, respectively. Insertion of PmtlA+11 into pSUN279.2 created pKAM167, and PmtlA+9 was inserted into pSUN279.2 to construct pKAM168. The mtlR-H342D C419A double-mutant was created by mutation of the C419 to alanine in mtlR-H342D in order to purify MtlR-H342D C419A. For this purpose, plasmid pKAM66 containing mtlR-H342D was used as the template in two PCRs using oligonucleotides s7303/s7301 and s7302/ s7304. Primary PCR products were used in the fusion PCR with oligonucleotides s7303/s7304. The mtlR-H342D C419A fragment was inserted into pJOE6089.4 via AflII/XmaI digestion to create pKAM182 where the expression of mtlR allele was controlled by rhaPBAD. The 235 upstream sequence of PmtlA was exchanged with its counterpart from PmanP to construct hybrid promoter 7 (PHP7) in which the MtlR binding site was replaced with the putative ManR binding site. PHP7 was constructed by amplification of the PmanP truncated fragment using oligonucleotides s6504/s6505, and amplification of the PmtlA fragment with oligonucleotides s6506/s6507. The primary PCR products were used in fusion PCR with oligonucleotides s6504/ s6507 and the resulting fragment (PHP7) was inserted into pSUN279.2 to create pKAM21. PHP7 was then applied as a template in PCR for generation of a Cy5-labelled PHP7 DNA fragment used as a negative control in electrophoretic mobility shift studies. Overexpression and purification of MtlR-H342D C419A in E. coli. For overexpression and purification of MtlR-H342D C419A,

200 ml LB in a 1 l Erlenmeyer flask was inoculated (1 : 100 dilution) with an overnight culture of E. coli JW2409-1 containing pKAM182. The bacterial culture was then cultivated at 37 uC with shaking at 200 r.p.m. When the culture reached an OD600 of 0.4, 0.2 % Lrhamnose was added in order to induce the rhaPBAD promoter located upstream of the mtlR-H342D C419A allele of pKAM182. Afterwards, the induced cells were further incubated at 30 uC to produce MtlR-H342D C419A. The bacterial culture was harvested 5 h after the addition of L-rhamnose at an OD600 of approximately 2.8. After centrifugation for 5 min at 5800 g the bacterial pellet was washed twice with Buffer A (50 mM HEPES pH 7.4, 1 mM tris(2carboxyethyl)phosphine (TCEP)). Next, the pellet was resuspended in 12 ml Buffer A and disrupted with a high pressure homogenizer (10 000–15 000 p.s.i.). After centrifugation of the lysate for 25 min at 20 200 g and 4 uC, 6 mg protein of the clear lysate was loaded onto a Mono Q HR 5/5 column (column capacity 20250 mg ml21). Using Buffer A and Buffer B (50 mM HEPES pH 7.4, 1 M NaCl, 1 mM TCEP), anion-exchange chromatography was carried out with a flow rate of 1 ml min21 and a gradient of 0–50 % Buffer B in 50 min followed by 50–100 % Buffer B in 10 min. The purification fractions were collected and tested with electrophoretic mobility shift assay for the presence of an active MtlR mutant. The protein concentration of each fraction was determined according to Bradford (1976). Electrophoretic mobility shift assays (EMSA) and DNase I footprinting. Cy5-labelled 59-end DNA fragments of PmtlA and PmtlR

were synthesized in PCRs using Cy5-labelled oligonucleotides, i.e. s5960 and s8365. For labelling the non-coding strand, PmtlA was amplified from pKAM1 with oligonucleotides s8447 and s5960. The PmtlA coding strand was labelled with oligonucleotides s8365 and s6213 in a PCR with pKAM1 as a template. Plasmid pKAM12 was also employed as the template for generation of Cy5-PmtlA DNA using oligonucleotides s8447 and s5960 in a PCR. The same oligonucleotides http://mic.sgmjournals.org

(s8447 and s5960) were applied in PCRs for generation of Cy5-PmtlA+9, PmtlA+10 and PmtlA+11 DNA fragments from pKAM168, pKAM145 and pKAM167, respectively. Cy5-labelled PmtlR DNA was synthesized from pKAM18 employing oligonucleotides s8447 and s5960 for labelling the non-coding DNA strand, while Cy5-labelled PmtlR DNA was amplified with s8365 and s6392 from pKAM18 to label the PmtlR coding strand. Electrophoretic mobility shift assay was carried out by mixing 100 fmol of the desired Cy5-labelled DNA with 25 ml of the 26 shift buffer (20 mM HEPES pH 7.4, 80 mM KCl, 2 mM dithiothreitol, 8 mM MgCl2, 25 % glycerol, 0.25 mg ml21 BSA, 0.25 mg ml21 herring sperm DNA) in a total volume of 50 ml. Different amounts of the purified MtlR-H342D C419A were used in the reactions to obtain a clear shifted DNA band compared to the control without protein. After incubation of the reaction mixture for 15 min at 4 uC, 10 ml of the shift reaction was loaded onto a 6 % native polyacrylamide gel and the migration of the DNA bands was visualized by a phosphorimager (Storm 860 phosphoimager, Molecular Dynamics). DNase I footprinting was performed with 600 fmol of the Cy5-labelled DNA fragments and 120 ml of the protein sample (0.320.4 mg ml21) in a 250 ml shift reaction. Two microlitres of DNase I (2000 units ml21; New England Biolabs GmbH) was added to the reaction mixtures which were kept for 1 min at room temperature. A negative control without MtlR was also carried out. The reaction was then stopped with 250 ml of the stop solution (50 mM EDTA pH 8, 15 mg ml21 calf thymus DNA). After removing the protein by phenol/chloroform extraction, the digested Cy5-labelled DNA probe was loaded onto a polyacrylamide gel and analysed by ALFexpress DNA sequencer (GE Healthcare). The location of the footprint was determined by sequencing of the pKAM1 (for PmtlA) and pKAM18 (for PmtlR) using oligonucleotides s5960 and s8365. For this purpose, Sanger’s method (Sanger et al., 1977) was applied with T7 polymerase (Roche) using DNA sequencing reagents (AutoRead sequencing kit; GE Healthcare).

b-Galactosidase activity. b-Galactosidase activities were measured by using o-nitrophenyl-b-galactopyranoside (ONPG) as a substrate according to Miller (1972) with the modification of Wenzel & Altenbuchner (2013).

RESULTS Constitutive activity of MtlR-H342D C419A in the absence of MtlA To investigate the interaction between the promoters of the B. subtilis mannitol utilization system and their activator, MtlR, it was necessary to obtain MtlR functional in vivo and in vitro. Such MtlR, which was expected to be active independently of the phosphorylation state of its regulatory domains, was obtained by specifically mutating the mtlR gene. In strains that produce the single-mutant proteins MtlR-C419A or MtlR-H342D, expression of the mtlAFD operon either occurs constitutively or is not subject to CCR, respectively (Joyet et al., 2010). To test whether combining the two mutations by constructing the mtlRH342D C419A allele would provide a functional activator with both specified characteristics, the PmtlR-mtlR-H342D C419A cassette was integrated into its wild-type locus within the chromosome of B. subtilis KM15, a DmtlR : : ermC mutant. Next, the PmtlA-lacZ fusion was separately integrated into the amyE loci of the chromosomes of B. subtilis 3NA (wild-type), PmtlR-mtlR-H342D, PmtlR-mtlR-H342D C419A and DmtlR strains in order to measure the 95

K. M. Heravi and J. Altenbuchner

the presence of an inducing (mannitol) or repressing sugar (glucose). Prior to purifying doubly mutated MtlR-H342D C419A and using it in vitro, it was important to understand whether it functions independently of MtlA. It has recently been suggested that the function of MtlR requires sequestration by the components of the mannitol-specific transporter, i.e. the domain B of the EIICBMtl (MtlA) (Bouraoui et al., 2013; Joyet et al., 2013). To test whether MtlR-H342D C419A needs sequestration by MtlA, the mtlAFD operon was deleted in the wild-type strain as well as in the strain producing doubly mutated MtlR-H342D C419A. Deletion of the mtlAFD operon in the wild-type strain resulted in a weak constitutive PmtlA activity, while this weak activity was increased when mtlR-H342D C419A was expressed in the DmtlAFD background (Fig. 1). In the presence of mannitol, the b-galactosidase activity of the mtlR-H342D C419A strain without the mannitol-specific transporter was even higher than its parental strain containing mtlAFD (Fig. 1). This could be due to loss of mannitol uptake and metabolism. As a consequence, the CcpA-dependent CCR will not be activated and will not lower PmtlA activity. In conclusion, these results indicate that the MtlR-H342D C419A protein acts independently of MtlA, whereas wild-type MtlR probably needs to interact with MtlA to gain full activity.

b-galactosidase activity of these strains in the presence of

different sugars. Subsequently, the mtlR mutants and wildtype strains were cultivated in LB and the b-galactosidase activity was measured 1 h after the addition of 0.2 % (w/v) mannitol alone or together with 0.2 % (w/v) glucose at an OD600 of 0.4. As a negative control, no sugar was added to the bacterial culture. Addition of mannitol increased the bgalactosidase activity by about 11-fold in the wild-type strain due to the induction of PmtlA (Fig. 1). Addition of glucose to the culture medium of the induced wild-type strain reduced the b-galactosidase activity by 3.6-fold (Fig. 1). In contrast, the DmtlR mutant showed a weak b-galactosidase activity with or without mannitol, although glucose reduced the bgalactosidase activity by about 3-fold. Similar to the wildtype strain, the PmtlA activity was induced with mannitol in the mtlR-H342D strain; however, CCR was considerably reduced in the presence of glucose as reported before (Heravi et al., 2011; Joyet et al., 2010). The double mutation mtlR-H342D C419A resulted in strong constitutive production of b-galactosidase by PmtlA. Likewise, the presence of glucose had no influence on the b-galactosidase production in the mtlR-H342D C419A strain compared to the b-galactosidase production with mannitol (Fig. 1). An even higher b-galactosidase activity was observed in the mtlR-H342D C419A strain in LB (uninduced). This difference could be due to the uptake of a PTS sugar, mannitol or glucose, resulting in a strong CcpAdependent CCR of PmtlA. Altogether, MtlR-H342D C419A is a functional regulator activating PmtlA in vivo regardless of

Identification of the MtlR-H342D C419A binding site by DNA footprinting The mtlR double-mutant, i.e. mtlR-H342D C419A, encodes a functional protein activating PmtlA in vivo. To identify the

3000

LB + mannitol LB + mannitol + glucose

β -Galactosidase activity (Miller units)

2500

LB

2000

1671

1500

1000

500

0

1219 1250 801 615

776

215 69 wt

665 659

212

217

143 mtlR-H342D

619

38 12 39 mtlR-H342D C419A

ΔmtlR

23 ΔmtlAFD ΔmtlAFD mtlR-H342D C419A

Fig. 1. b-Galactosidase activity of the B. subtilis mutants. All strains carry a PmtlA-lacZ cassette integrated at the amyE locus. The wild-type strain (KM176) and mutant strains mtlR-H342D (KM213), mtlR-H342D C419A (KM231), DmtlR (KM241), DmtlAFD (KM240) and DmtlAFD mtlR-H342D C419A (KM271) were induced at an OD600 of 0.4 by the addition of 0.2 % (w/ v) mannitol (inducer) alone or together with 0.2 % (w/v) glucose (repressing sugar). No sugar was added to the negative control. The enzyme activity was measured 1 h after the addition of sugars. All measurements were performed three times. The mean and standard deviation (error bars) values are represented. 96

Microbiology 160

Activation of the B. subtilis mtl promoters

MtlR binding site at PmtlA and PmtlR, the mtlR-H342D C419A allele was expressed under control of rhaPBAD in E. coli strain JW2409-1, in which the EI of the PTS is disrupted. The theoretical pI of MtlR-H342D C419A was approximately 5.2. Therefore, anion-exchange chromatography was conducted and the resulting fractions were tested for the presence of an active MtlR by electrophoretic mobility shift assays (data not shown). The DNA fragments Cy5-PmtlA and Cy5-PmtlR were subsequently used for DNase I footprinting to determine the MtlR binding sequence in both coding and non-coding strands of PmtlA and PmtlR (Fig. 2a). The results indicated that the MtlR operator at the coding strand of PmtlA is located between 285 and 239 with respect to the transcription start site of PmtlA, while the protected region of the non-coding strand extended from 288 to 241 (Fig. 2b). Similar results were obtained by PmtlR footprinting where a region between 281 and 237

PmtlA coding strand A C G T – +

(a)

remained protected during the DNase I digestion on the coding strand, while the MtlR bound to the region between 286 and 240 on the non-coding strand (Fig. 2c).These results indicate that MtlR binds adjacent to the 235 box in both PmtlA and PmtlR promoters. Construction of PmtlA-PlicB hybrid promoters and confirmation of the MtlR operator in vivo To confirm the identified 39-end of the MtlR binding site by DNase I footprinting, hybrid promoters were constructed using the promoter core elements of PlicB as a platform. PlicB is the promoter of the licBCAH operon which is also activated by a PRD-containing activator, called LicR. Previously, a LicR binding site immediately upstream of the 235 sequence of PlicB was postulated (Tobisch et al., 1999). Accordingly, the hybrid promoters

PmtlR coding strand A C G T – +

PmtlA non-coding strand A C G T – +

PmtlR non-coding strand A C G T – + –86

–85

–88

–81 –40 –39

–41

–37

(b) PmtlA –35

–10

+1

(c) PmtlR –35

–10

+1

Fig. 2. Identification of the MtlR binding site at PmtlA and PmtlR by DNase I footprinting. (a) The sequencing reactions (shown by A, C, G and T) with oligonucleotides s5960 (non-coding strand) and s8365 (coding strand) were carried out using pKAM1 (PmtlA) and pKAM18 (PmtlR) as templates. The DNA protection pattern was analysed in the absence (”) and presence (+) of MtlR-H342D C419A. The protected regions of each DNA strand is shown by marks on the left and by bold lines on the right side of each gel. (b) Promoter sequence (”10 and ”35; shown by boxes), transcription start site (+1; capital letters), and MtlR binding site (bold lines) in PmtlA and (c) in PmtlR are demonstrated. The arrows represent the incomplete inverted repeats. Bold lines show the protected regions of DNA and the binding site of MtlR-H342D C419A. http://mic.sgmjournals.org

97

K. M. Heravi and J. Altenbuchner

(a) Promoter mtlA

–35

HP41 HP43 HP42 licB

3000

(b)

LB + inducer LB

(Miller units)

β -Galactosidase activity

2500

1657

2000 1500 1000

784

859

858 300

500 0

29 PmtlA

86 PHP41

105 PHP43

101 81 PHP42

PlicB

Fig. 3. Construction of PmtlA-PlicB hybrid promoters. (a) The DNA sequences of the PmtlA-PlicB hybrid promoters. The base pairs originating from PmtlA are shown with capital letters, whereas the PlicB derived base pairs are shown with lower-case underlined letters. (b) b-Galactosidase activity of B. subtilis 3NA containing pKAM1 (PmtlA), pKAM160 (PlicB), pKAM161 (PHP41), pKAM162 (PHP42) or pKAM176 (PHP43). All constructs were induced with 0.2 % (w/v) mannitol except 3NA pKAM160 containing PlicB which was induced with 0.2 % (w/v) cellobiose. All measurements were performed three times and the mean and standard deviation (error bar) values are presented.

were constructed by substitution of the complete upstream region of the PlicB 235 box with its counterpart from PmtlA (construct PHP41; Fig. 3a). PlicB was also used as a control in this study. Both constructs were inserted into pSUN279.2, a derivative of pMTLBS72 (Titok et al., 2003), upstream of the lacZ reporter gene. In this way, plasmid pKAM160 (PlicB) and pKAM161 (PHP41) were created. Induction of the B. subtilis strains containing PlicB-lacZ with cellobiose and PHP41-lacZ with mannitol resulted in 1657 and 859 Miller units b-galactosidase activity, respectively (Fig. 3b). On the other hand, the uninduced cells showed only 300 Miller units (PlicB-lacZ) and 86 Miller units (PHP41-lacZ). Indeed, PHP41 was inducible with mannitol similar to the wild-type PmtlA on plasmid pKAM1 (reported by Heravi et al., 2011). Further replacement of 3 bp located adjacent to the 235 box of PHP41 with their counterparts from PlicB created PHP43 (Fig. 3a). Induction of PHP43 showed no significant changes in the b-galactosidase activity compared to PHP41 (Fig. 3b), whereas substitution of 7 bp of PHP41 with its PlicB counterparts rendered PHP42 uninducible with mannitol (Fig. 3b). Altogether, these results indicate that the MtlR operator in PmtlA extends towards the 235 box at the position 238 with respect to the transcription start site. 98

Increasing the distance between the ”35 box and the MtlR binding site Given that the MtlR operator begins about 3 to 4 bp upstream from the 235 box in both PmtlA and PmtlR, the distance between the MtlR binding site and 235 box was increased in order to confirm the class II type activation by MtlR. For this purpose, 9 (PmtlA+9), 10 (PmtlA+10) and 11 (PmtlA+11) bp were inserted between the 235 box and the MtlR binding site in order to separate the MtlR binding site from the 235 box with a complete turn of B-DNA double helix (Fig. 4a). Insertion of the newly constructed promoters in front of the lacZ gene was followed by induction of the B. subtilis 3NA containing these constructs. Although PmtlA+10 and PmtlA+11 respectively showed eight- and fourfold induction, the b-galactosidase activity was considerably lower than in the wild-type strain (Fig. 4b). In contrast, the PmtlA+9 activity was non-inducible (Fig. 4b). EMSA showed that MtlR was able to interact with its operator in the PmtlA sequence or its derivatives, although the MtlR binding site was relocated further from the 235 box (Fig. 4c). This suggests that the distance between the MtlR binding site and the 235 box is not flexible with respect to activation of gene expression.

DISCUSSION The mannitol utilization system of B. subtilis is regulated by two promoters, PmtlA and PmtlR. Transcription from these promoters, which have conserved 235 and 210 boxes similar to the sA-type housekeeping promoters, depends on MtlR, a PRD-containing activator. The activation complex of simple housekeeping promoters is formed by RNAP and an activator. Generally, transcription activation has been categorized into two classes, class I and II. In the class I type of activation, the activator usually binds between positions 261 to 291 and interacts with the carboxy terminal domain of the RNAP a subunit (aCTD). In the class II type activation, the activator binding site overlaps the 235 box, where it contacts domain 4 of the s subunit of RNAP (Browning & Busby, 2004; Lee et al., 2012). This situation is found in the promoters of the B. subtilis mannose utilization system, PmanP and PmanR, where the operators completely overlap the 235 region (Wenzel & Altenbuchner, 2013). Identification of the MtlR operator at PmtlA and PmtlR revealed a structure somewhere between class I and class II type transcription activation where MtlR binds a few bases adjacent to the 235 box (Figs 2 and 3). Changing the distance between the MtlR operator and the 235 box significantly reduced the activity of PmtlA showing the necessity of the proximity of the MtlR molecules to the RNAP/sA holoenzyme as required in class II type transcription activation (Fig. 4). Besides, the activation of PlicB by LicR, a PRD-containing activator, also depends on a dyad symmetry located 8 bp upstream of the 235 box (Tobisch et al., 1999). Obviously, the PRDcontaining activators of B. subtilis usually form a class II type activation complex at their target promoters. Microbiology 160

Activation of the B. subtilis mtl promoters NheI

(a)

MunI –35

PmtlA 9 bp

PmtlA+9

10 bp

PmtlA+10

11 bp

PmtlA+11

(b)

20

PHP7 – +

(c)

β -Galactosidase activity (Miller units × 103)

LB + mannitol 15

PmtlA – +

PmtlA+9 PmtlA+10 PmtlA+11 – + – + – +

LB

13.2

MtlR-DNA complex 10

5

Free DNA 0.6

0 PmtlA

0.1 0.2 PmtlA+9

0.8

0.1

0.4 0.1

PmtlA+10

PmtlA+11

Fig. 4. Increasing the distance between the MtlR operator and the ”35 box of PmtlA. (a) Sequence of PmtlA and the constructs thereof. (b) b-Galactosidase activity of B. subtilis containing pKAM12 (PmtlA), pKAM168 (PmtlA+9), pKAM145 (PmtlA+10) or pKAM167 (PmtlA+11). Measurements were carried out three times and the mean and standard deviation (error bar) values are shown. (c) EMSA study using Cy5-PHP7 DNA fragment (negative control containing no MtlR binding site), Cy5-PmtlA DNA fragments (positive control) and constructs thereof in the presence (+) or absence (”) of MtlR-H342D C419A.

Prior to the activation of PmtlA and PmtlR, MtlR molecules must be activated. There are two reported activation processes for MtlR: (i) regulator activation by posttranslational protein modifications (phosphorylation) and (ii) a direct protein–protein interaction between regulator and the cognate transporter. It is assumed that the nascent MtlR PRDII domain is phosphorylated by HPr(H15~P), and the EIIBGat-like domain of MtlR by phosphorylated EIIAMtl in the absence of glucose and mannitol. In the presence of mannitol, MtlF dephosphorylates the EIIBGatlike domain of MtlR which renders MtlR active (Joyet et al., 2010). The results obtained with the mtlR-H342D C419A double-mutant are in line with the previous studies showing that MtlR-H342D C419A is a functional protein activating PmtlA independent of the presence of mannitol or glucose. However, the MtlR-H342D C419A mutant protein was fully functional in vivo when MtlA was deleted from the B. subtilis chromosome. Besides, the purified B. subtilis MtlR-H342D C419A isolated from E. coli cells could also bind to the PmtlA DNA fragments without MtlA in vitro (Fig. 4). These mutations probably induce structural changes which render the mutant MtlR independent of activation by the mannitol transporter. In fact, the http://mic.sgmjournals.org

modulation of the regulator and transporter phosphorylation state could alter their direct interaction. Up until now, the localization of E. coli BglG and B. subtilis LicT antiterminators has been investigated. BglG is sequestered by the cognate phosphorylated transporter, BglF, in the absence of salicin (inducer). Upon addition of salicin, BglF becomes dephosphorylated and BglG will be released into the cytosol (Lopian et al., 2003). B. subtilis LicT, however, is homogeneously distributed in the cytoplasm in the absence of inducer. Upon addition of salicin, LicT localizes in the subpolar region. No LicT membrane sequestration was observed in the presence/absence of inducer (Rothe et al., 2013). Also, in the B. subtilis mannose system there seems to be no need for such sequestration since ManR is fully active in manA deletion mutants (Wenzel & Altenbuchner, 2013). In conclusion, it might be possible that the hypothesized MtlR sequestration by MtlA takes place during MtlR activation by the formation of the MtlA/ MtlF/MtlR(PRDII~P/EIIBGat~P) complex. However, the active form of MtlR(PRDII~P/EIIBGat) functions independently of the presence of MtlA in the cell (Fig. 1). The exact dynamic of the MtlR localization and its relationship to control mtl gene expression must be further studied. 99

K. M. Heravi and J. Altenbuchner

ACKNOWLEDGEMENTS We would like to thank Josef Deutscher for critical reading and revising the manuscript and Hildegard Watzlawick for her helpful suggestions. We also appreciate Gisela Kwiatkowski and Silke Weber for their technical assistance. This study was supported by the German Academic Exchange Service (DAAD).

Joyet, P., Bouraoui, H., Ake´, F. M., Derkaoui, M., Ze´bre´, A. C., Cao, T. N., Ventroux, M., Nessler, S., Noirot-Gros, M. F. & other authors (2013). Transcription regulators controlled by interac-

tion with enzyme IIB components of the phosphoenolpyruvate: sugar phosphotransferase system. Biochim Biophys Acta 1834, 1415– 1424. Lee, D. J., Minchin, S. D. & Busby, S. J. (2012). Activating

transcription in bacteria. Annu Rev Microbiol 66, 125–152.

REFERENCES Altenbuchner, J., Viell, P. & Pelletier, I. (1992). Positive selection vectors

based on palindromic DNA sequences. Methods Enzymol 216, 457–466. Arnaud, M., Vary, P., Zagorec, M., Klier, A., Debarbouille, M., Postma, P. & Rapoport, G. (1992). Regulation of the sacPA operon of Bacillus

subtilis: identification of phosphotransferase system components involved in SacT activity. J Bacteriol 174, 3161–3170. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L. & Mori, H. (2006).

Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2, 0008. Bouraoui, H., Ventroux, M., Noirot-Gros, M. F., Deutscher, J. & Joyet, P. (2013). Membrane sequestration by the EIIB domain of the

mannitol permease MtlA activates the Bacillus subtilis mtl operon regulator MtlR. Mol Microbiol 87, 789–801. Bradford, M. M. (1976). A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248–254. Browning, D. F. & Busby, S. J. (2004). The regulation of bacterial

Lindner, C., Galinier, A., Hecker, M. & Deutscher, J. (1999).

Regulation of the activity of the Bacillus subtilis antiterminator LicT by multiple PEP-dependent, enzyme I- and HPr-catalysed phosphorylation. Mol Microbiol 31, 995–1006. Lindner, C., Hecker, M., Le Coq, D. & Deutscher, J. (2002). Bacillus

subtilis mutant LicT antiterminators exhibiting enzyme I- and HPrindependent antitermination affect catabolite repression of the bglPH operon. J Bacteriol 184, 4819–4828. Lopian, L., Nussbaum-Shochat, A., O’Day-Kerstein, K., Wright, A. & Amster-Choder, O. (2003). The BglF sensor recruits the BglG

transcription regulator to the membrane and releases it on stimulation. Proc Natl Acad Sci U S A 100, 7099–7104. Luria, S. E., Adams, J. N. & Ting, R. C. (1960). Transduction of lactose-

utilizing ability among strains of E. coli and S. dysenteriae and the properties of the transducing phage particles. Virology 12, 348–390. Martin-Verstraete, I., De´barbouille´, M., Klier, A. & Rapoport, G. (1992). Mutagenesis of the Bacillus subtilis ‘‘-12, -24’’ promoter of the

levanase operon and evidence for the existence of an upstream activating sequence. J Mol Biol 226, 85–99. Michel, J. F. & Millet, J. (1970). Physiological studies on early-blocked

transcription initiation. Nat Rev Microbiol 2, 57–65.

sporulation mutants of Bacillus subtilis. J Appl Bacteriol 33, 220–227.

Crutz, A. M., Steinmetz, M., Aymerich, S., Richter, R. & Le Coq, D. (1990). Induction of levansucrase in Bacillus subtilis: an antitermina-

Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring

tion mechanism negatively controlled by the phosphotransferase system. J Bacteriol 172, 1043–1050.

Motejadded, H. & Altenbuchner, J. (2007). Integration of a lipase

Deutscher, J., Galinier, A. & Martin-Verstraete, I. (2002). Carbohydrate

uptake and metabolism. In Bacillus Subtilis and its Closest Relatives: from Genes to Cells, pp. 129–150. Edited by A. L. Sonenshein, J. A. Hoch & R. Losick. Washington, DC: American Society for Microbiology. Deutscher, J., Francke, C. & Postma, P. W. (2006). How phospho-

transferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev 70, 939–1031. Fujita, Y. (2009). Carbon catabolite control of the metabolic network

in Bacillus subtilis. Biosci Biotechnol Biochem 73, 245–259. Greenberg, D. B., Stu¨lke, J. & Saier, M. H., Jr (2002). Domain analysis

of transcriptional regulators bearing PTS regulatory domains. Res Microbiol 153, 519–526. Gue´rout-Fleury, A. M., Frandsen, N. & Stragier, P. (1996). Plasmids

for ectopic integration in Bacillus subtilis. Gene 180, 57–61. Harwood, C. R. & Cutting, S. M. (1990). Molecular Biological Methods

for Bacillus. New York: Wiley. Heravi, K. M., Wenzel, M. & Altenbuchner, J. (2011). Regulation of mtl

operon promoter of Bacillus subtilis: requirements of its use in expression vectors. Microb Cell Fact 10, 83. Hoffmann, J., Bo´na-Lova´sz, J., Beuttler, H. & Altenbuchner, J. (2012).

Harbor, NY: Cold Spring Harbor Laboratory. gene into the Bacillus subtilis chromosome: Recombinant strains without antibiotic resistance marker. Iranian J Biotechnol 5, 105– 109. Reizer, J., Bachem, S., Reizer, A., Arnaud, M., Saier, M. H., Jr & Stu¨lke, J. (1999). Novel phosphotransferase system genes revealed by

genome analysis - the complete complement of PTS proteins encoded within the genome of Bacillus subtilis. Microbiology 145, 3419–3429. Rothe, F. M., Wrede, C., Lehnik-Habrink, M., Go¨rke, B. & Stu¨lke, J. (2013). Dynamic localization of a transcription factor in Bacillus

subtilis: the LicT antiterminator relocalizes in response to inducer availability. J Bacteriol 195, 2146–2154. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:

a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with

chain-terminating inhibitors. Proc Natl Acad Sci U S A 74, 5463–5467. Schnetz, K., Stu¨lke, J., Gertz, S., Kru¨ger, S., Krieg, M., Hecker, M. & Rak, B. (1996). LicT, a Bacillus subtilis transcriptional antiterminator

protein of the BglG family. J Bacteriol 178, 1971–1979. Sonenshein, A. L. (2007). Control of key metabolic intersections in Bacillus subtilis. Nat Rev Microbiol 5, 917–927. Stu¨lke, J., Martin-Verstraete, I., Zagorec, M., Rose, M., Klier, A. & Rapoport, G. (1997). Induction of the Bacillus subtilis ptsGHI operon

In vivo and in vitro studies on the carotenoid cleavage oxygenases from Sphingopyxis alaskensis RB2256 and Plesiocystis pacifica SIR-1 revealed their substrate specificities and non-retinal-forming cleavage activities. FEBS J 279, 3911–3924.

by glucose is controlled by a novel antiterminator, GlcT. Mol Microbiol 25, 65–78.

Joyet, P., Derkaoui, M., Poncet, S. & Deutscher, J. (2010). Control of

Stu¨lke, J., Arnaud, M., Rapoport, G. & Martin-Verstraete, I. (1998).

Bacillus subtilis mtl operon expression by complex phosphorylationdependent regulation of the transcriptional activator MtlR. Mol Microbiol 76, 1279–1294.

PRD–a protein domain involved in PTS-dependent induction and carbon catabolite repression of catabolic operons in bacteria. Mol Microbiol 28, 865–874.

100

Microbiology 160

Activation of the B. subtilis mtl promoters Sun, T. & Altenbuchner, J. (2010). Characterization of a mannose utilization system in Bacillus subtilis. J Bacteriol 192, 2128–2139. Titok, M. A., Chapuis, J., Selezneva, Y. V., Lagodich, A. V., Prokulevich, V. A., Ehrlich, S. D. & Jannie`re, L. (2003). Bacillus

Mannitol-1-phosphate dehydrogenase (MtlD) is required for mannitol and glucitol assimilation in Bacillus subtilis: possible cooperation of mtl and gut operons. J Bacteriol 185, 4816–4824. Wenzel, M. & Altenbuchner, J. (2013). The Bacillus subtilis mannose

subtilis soil isolates: plasmid replicon analysis and construction of a new theta-replicating vector. Plasmid 49, 53–62.

regulator, ManR, a DNA-binding protein regulated by HPr and its cognate PTS transporter ManP. Mol Microbiol 88, 562–576.

Tobisch, S., Stu¨lke, J. & Hecker, M. (1999). Regulation of the lic

Yamamoto, H., Serizawa, M., Thompson, J. & Sekiguchi, J. (2001).

operon of Bacillus subtilis and characterization of potential phosphorylation sites of the LicR regulator protein by site-directed mutagenesis. J Bacteriol 181, 4995–5003.

Regulation of the glv operon in Bacillus subtilis: YfiA (GlvR) is a positive regulator of the operon that is repressed through CcpA and cre. J Bacteriol 183, 5110–5121.

Tortosa, P., Declerck, N., Dutartre, H., Lindner, C., Deutscher, J. & Le Coq, D. (2001). Sites of positive and negative regulation in the Bacillus

Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13

subtilis antiterminators LicT and SacY. Mol Microbiol 41, 1381–1393.

phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119.

Watanabe, S., Hamano, M., Kakeshita, H., Bunai, K., Tojo, S., Yamaguchi, H., Fujita, Y., Wong, S. L. & Yamane, K. (2003).

Edited by: W. Meijer

http://mic.sgmjournals.org

101