Vol. 172, No. 2

JOURNAL OF BACTERIOLOGY, Feb. 1990, p. 835-844

0021-9193/90/020835-10$02.00/0 Copyright X 1990, American Society for Microbiology

A Target for Carbon Source-Dependent Negative Regulation of the citB Promoter of Bacillus subtilis AGNES FOUET AND ABRAHAM L. SONENSHEIN* Department of Molecular Biology and Microbiology, Tufts University Health Sciences Campus, 136 Harrison Avenue, Boston, Massachusetts 02111 Received 12 September 1989/Accepted 30 October 1989

Expression of the aconitase (citB) gene of Bacillus subtilis is subject to catabolite repression in cells grown in minimal media. In nutrient broth medium, citB expression is low in growing cells but is induced when cells enter sporulation. A 600-base-pair DNA fragment that extends from positions -400 through +200, relative to the transcription start site, was shown to include all of the cis-acting sequences necessary for catabolite repression and sporulation-associated regulation. This was demonstrated by fusing this DNA fragment to the Escherichia coli lacZ gene, integrating the fusion in the amyE locus of the B. subtilis chromosome, and measuring the regulation of expression of j8-galactosidase. By creating a series of deletions from either end of the 600-base-pair fragment, it was possible to define a target for catabolite repression; at least part of this target lies within the sequence between positions -84 and -68. DNA fragments that included positions -84 through +36, when carried on high-copy plasmids, caused derepression of aconitase synthesis, as if a negative regulator were being titrated. The same plasmids caused derepression of citrate synthase activity as well. Deletion of the sequence between positions -84 and -67 abolished this titration effect for both enzymes. Mutations that altered the target for catabolite repression also affected the inducibility of citB at the onset of sporulation, at least when sporulation was induced by the addition of decoyinine, an inhibitor of guanine nucleotide synthesis. When sporulation was induced by exhaustion of nutrient broth, there was no detectable difference in expression of citl-lacZ fusions whether or not they had the citB sequence from positions -84 to -67, suggesting that the mechanisms of regulation of citB in minimal medium and nutrient broth are different.

aconitase activity is required for sporulation in nutrient broth medium (10). However, transcription of citB is not prevented by mutations in two genes, spoOH or spoOB, that control early sporulation events and is therefore not dependent on certain aspects of sporulation-specific regulation (4). It is possible that the various conditions that regulate citB expression act by the same fundamental mechanism. Alternatively, each aspect of citB regulation could be mediated by a distinct regulatory effector. To begin to address these questions, we located a target for carbon source regulation in minimal media. We show that removal of 17 base pairs (bp) normally found between positions -84 and -67, with respect to the citB transcription start site, abolishes catabolite repression. This 17-bp stretch is also necessary, but not sufficient, for the titration of a putative negative regulator. Decoyinine appeared to inhibit the synthesis or the activity of this regulator. Deletion of the 17-bp sequence did not influence citB expression in nutrient broth medium.

Aconitase (EC 4.2.1.3; citrate [isocitrate] hydro-lyase), an enzyme of the Krebs cycle, is subject to several forms of regulation in Bacillus subtilis. In a minimal medium containing glucose and glutamine or glutamate, the citB gene, which encodes aconitase (5), is transcribed at a low level. Transcription is increased when glucose is replaced by a poorly metabolized carbon source such as citrate. It is also increased when the medium does not contain any compound rapidly convertible to 2-ketoglutarate (2-KG) (e.g., glutamine or glutamate) (26). A hint that this phenomenon might involve a negative regulator came from the observation that aconitase expression is partially derepressed in a cell that contains multiple copies of the citB promoter region (4). A second aspect of citB regulation is related to sporulation. Addition of decoyinine, a compound that induces sporulation in a defined medium by inhibiting the synthesis of guanine nucleotides (16), causes a rapid increase in citB transcription and aconitase activity (4, 33). These two aspects of regulation may be linked in that induction of citB by decoyinine is associated with a decrease in 2-KG levels (4, 9, 32). It has been shown, but only at the level of enzyme activity, that citrate synthase is also repressed in glucosecontaining minimal medium and induced by decoyinine treatment (11, 32). Expression of citB is also regulated in complex medium. When cells are grown in nutrient broth sporulation medium, aconitase activity and citB mRNA appear in mid- to lateexponential phase and disappear by the second hour of sporulation (4). This suggests that citB expression responds to the same signals that induce sporulation. Furthermore, *

MATERIALS AND METHODS Bacterial strains and plasmids. The bacterial strains used are shown in Table 1. Plasmid pJPM1 (J. P. Mueller, personal communication) was constructed by inserting a chloramphenicol acetyltransferase cassette in the NarI site of pBS (Stratagene Inc.). The structures of plasmid pAF1, a vector that integrates in the amyE locus and enables the construction of transcriptional fusions with the lacZ gene, and pKM7, which harbors the citB promoter region in pAF1, are shown in Fig. 1. pAF3 harbors the spac promoter (34). It was constructed by purifying a 320-bp HindIII-EcoRI fragment from pAG58 (14) and ligating it to pAF1 which had been digested by the same enzymes. pAF15 harbors the pl

Corresponding author. 835

836

FOUET AND SONENSHEIN

J. BACTERIOL.

TABLE 1. Bacterial strains Strain

E. coli MM294 RV JM103

Source or

Genotype

endA hsdR thi pro R. Losick Alac thi M. Malamy A(Iac pro) supE thi strA sbcCJ5 D. Chikaraishi endA hsdR4 F' traD36 proAB lacIq ZAM15

B. subtilis

SMY Wild type BCDC8 4§(citB'-'lacZ) cat trpC2 SMY(pDWD1) 4D(citB'-'IacZ) kan

P. Schaeffer 4 4

promoter of the veg gene (15). It was constructed by purifying a 145-bp HindIII-BamHI fragment from pCC1 (15), treating it with the Klenow fragment of Escherichia coli DNA polymerase I, and inserting it into the SmaI site of

//

ptrpBGl

~~~~~amy-frontr

/

,jamy-back pKM7

l_ Sac trpA-lacZ4 S

\

cat

w

Eco RI

HindlEl HindHil

pUC8. The orientation of the insert was checked by RsaI digestion; in pAF15 the promoter is directed toward the HindIII site. The 160-bp EcoRI-HindIlI fragment from pAF15 was subcloned in pAF1, giving rise to pAF25. Plasmids pAF10, pAF11, pAF12, pAF13, pAF14, pAF20, pAF21, pAF22, pAF23, pAF24, pAF60, pAF61, pAF62, pAF63, and pAF64 were obtained by subcloning different DNA fragments, encompassing the citB promoter, from pMR41 (26) in pUC8, pAF1, or pMK3-1 (pMK3-1 is a derivative of pMK3 [31] which has a single EcoRI site in the polylinker region [R. Yasbin, personal communcation]) (Fig. 2). To construct pAF10, pMR41 (26) was digested with AvaI, treated with the Klenow fragment, and further digested with Pstl; the resulting 500-bp fragment was inserted in pUC8 that had been treated with SmaI and PstI. For pAF20, the 600-bp AvaI-HindIII fragment from pMR41 was further digested with RsaI and ligated to pUC8 that had been digested with SmaI and HindIll. pAF20 was then treated with EcoRI and PstI, and the 180-bp fragment was ligated to pUC8 that had been cut with EcoRI and PstI, giving rise to pAF12. The same 180-bp fragment was digested with DdeI, treated with Klenow fragment, and ligated to pUC8 that had been treated with SmaI, yielding pAF13. The 180-bp fragment was also digested with DdeI and TaqI, treated with Klenow fragment, and ligated to the same vector to give pAF14. The small, promoter-containing fragments obtained by the digestion of these plasmids with EcoRI and HindIII were cloned in pAF1 digested with the same enzymes, giving rise to plasmids pAF11, pAF21, pAF22, pAF23, and pAF24. Plasmids pAF60, pAF61, pAF62, pAF63, and pAF64 were constructed by inserting the same fragments in the pMK3-1 vector. pAF65 was obtained by cloning the 115-bp EcoRIHindIII DNA fragment from pAF14 into pJPM1. Culture media and bacterial growth. E. coli strains were grown in L broth or on L agar plates (19). When appropriate, the growth medium contained 100 ,ug of ampicillin per ml. B. subtilis strains were grown in DSM [0.8% nutrient broth,

III

ligase

Sac

0.1% KCl, 0.025% MgSO4 7H20, 1.0 mM Ca(NO3)2, 10 ,uM MnCl2, 1.0 ,uM FeSO4 (30)] or TSS (0.05 M Tris [pH 7.5], 40 ,ug each of FeCl3 6H20 and trisodium citrate dihydrate per ml, 2.5 mM K2HPO4, 0.02% MgSO4 7H20, 0.2% glutamine, 0.5% glucose or 0.2% trisodium citrate dihydrate [9]) liquid medium. When necessary, TSS was supplemented with amino acids (to 0.004%). For plates of DSM or TBAB-0.2% starch (28), agar was added to 17 g/liter. Chloramphenicol or kanamycin was added to a final concentration of 5 ,ug/ml when plasmids were integrated at the amyE locus or were replicating autonomously and to 2.5 ,ug/ml when plasmids were integrated at the citB locus.

5-Bromo-4-chloro-3-indolyl-,-D-galactopyranoside (X-Gal) was added to solid media (to 40 ,ug/ml) as an indicator of

Eco RI

Hindill

FIG. 1. Construction of a lacZ transcription fusion vector that integrates at the amyE locus. pKM7 was constructed by digesting both ptrpBG1 (29) and pVRD1 (4) with EcoRI and SacI, purifying the desired fragments, and ligating them (K. Madden, personal communication). pAFl was obtained after digestion of pKM7 with HindlIl and religation. In both plasmids, the ori and bla sequences originated in pBR322 and the cat gene originated in pC194. The lacZ gene used as an indicator of promoter activity is the same as that in pCED6 (6). The ,-galactosidase polypeptide coded for is a fusion protein with the N terminus of the E. coli trpA gene product.

,-galactosidase activity. Induction by decoyinine U-7984 (kindly provided by G. B. Whitfield and R. L. Keene, The Upjohn Co.) was carried out as described previously (4). In preliminary experiments, we found that to obtain steady-state conditions in TSS, it was necessary to maintain growing cultures in the exponential phase for at least four generations. Thus, 5 ml of medium was inoculated with exponential-phase precultures to give an initial turbidity of 20 to 30 Klett units. The cultures were diluted twofold whenever the turbidity reached 100 Klett units. Cultures went through at least four dilution cycles before being used for enzyme assays. The same principle was applied to growth in DSM, except that the cultures were started by inoculation from TBAB plates to give a turbidity

VOL. 172, 1990

B. SUBTILIS citB REGULATORY MUTANTS

R

837

T

GTACATTTTTCTCATAAGTCGAACTTATTGTATTTAATAAAAACATTGATATTTACTTATGTATGATTTTGTTTTAATATGAAATTGTGA n 35"

-

10"

"+1"

pUIC8 A/H -400

I

RT

P

D

I

pAF1 pMK3-1

H

I +200

pKM7

-400

+92

pAF10 pAFl 1

pAF60

-84

+200

pAF20 pAF21

pAF61

-84

+92

pAF12 pAF22 pAF62

+36

pAF13 pAF23 pAF63

+36

pAF14 pAF24 pAF64

::.::,. .:..- ..:.

-: ::.. ::::::

:.-.:-. :.

:.:: ::

-84 ...

-67

FIG. 2. Construction of plasmids carrying deleted versions of the citB promoter region. The top line shows the sequence of the noncoding strand from positions -87 through +4; the RsaI and TaqI sites are underlined, as are the -35 and -10 boxes and the transcription start site. Arrows represent inverted and direct repeats. The 600-bp promoter-containing fragment of pKM7 is diagrammed under the sequence. The start and direction of citB transcription are indicated by the arrow. The numbers to the left and the right of each line indicate the coordinates of the promoter-containing fragment relative to the transcription start point. Each promoter fragment indicated was cloned in three different vectors (pUC8, pAF1, and pMK3-1). pUC8 was used to clone the different deleted promoters, i.e., the various restriction fragments. Transcriptional fusions were constructed in pAF1; these plasmids were then inserted in single copy in the amyE locus. pMK3-1 is a multicopy plasmid which can replicate in B. subtilis; it was used for titration experiments. Abbreviations: A/H, AvaI (in pMR41) or Hindlll (in pKM7); R, RsaI; T, TaqI; D, DdeI; P, PstI; H, Hindlll. The sequence in the figure has already been published (5); its GenBank/EMBL accession number is M16776.

of 10 Klett units or less and dilutions were carried out when the turbidity reached 40 Klett units. DNA manipulations. Methods for endonuclease digestion and ligation were as described by Maniatis et al. (18). Chromosomal DNA was isolated from B. subtilis cells harvested in the exponential phase. Cells were suspended in 1/25 volume of 0.1 M Tris hydrochloride (pH 8.0)-0.1 M EDTA-0.15 M NaCl and incubated in the presence of lysozyme (1 mg/ml) for 10 min at 37°C. After treatment with pancreatic RNase (50 jxg/ml for 15 min at 50°C), sodium dodecyl sulfate was added to 1% (wt/vol) and proteinase K was added to 100 ,ug/ml. Incubation continued until clarification was complete. After dialysis for 12 h at 37°C against 10 mM Tris hydrochloride (pH 8.0)-10 mM EDTA-50 mM NaCI, phenol extractions were carried out and followed by ethanol precipitation. The DNA was drawn out of solution by being wound around a glass rod. Plasmid DNA was isolated from E. coli and B. subtilis by alkaline lysis (1, 13). Restriction enzymes, T4 DNA ligase, and DNA polymerase large fragment (Klenow fragment) were obtained from New England BioLabs, Inc. Agarose gels and denaturing polyacrylamide gels were prepared and subjected to electrophoresis in the buffers described by Maniatis et al. (18). DNA sequencing was carried out by using the dideoxy-chain termination method (27) on doublestranded DNA; the Sequenase kit was obtained from United States Biochemical Corp. Oligonucleotide primers were pre-

pared by S. W. Brown with an Applied Biosystems 380B machine. Transformation. E. coli and B. subtilis strains were transformed by the competent-cell techniques of Davis et al. (3) and Dubnau and Davidoff-Abelson (7), respectively. E. coli transformants were selected by plating on L plates containing ampicillin and X-Gal. B. subtilis transformants were selected by plating on DSM plates containing chloramphenicol or kanamycin. The Amy phenotype was assayed, with colonies grown overnight on TBAB-starch plates, by flooding the plates with a l% 12-KI solution (28). Amy+ colonies produced a clear halo; Amy- colonies gave no halo. Enzyme assays. Cells were harvested by centrifugation (12,000 x g for 5 min), washed with 50 mM Tris hydrochloride (pH 8.0) at 4°C, and stored frozen at -20°C. P-Galactosidase and aconitase assays were carried out as previously described (4). Isocitrate dehydrogenase and citrate synthase activities were determined as described by Hanson and Cox (11) and by Fortnagel and Freese (10), respectively. Protein concentrations were determined by the method of Lowry et al. (17) or by using the Bio-Rad Coomassie blue assay. Bovine serum albumin was the standard. RESULTS citB-lacZ fusion integrated at the amyE locus. Variations in aconitase activity in different growth media (11) and in

838

FOUJET ANID SONENSHEIN

J. BACTERIOL. 2000

100

C.) cu

80

0

1500

0 Cu 0) 0

1000

Cu E 0 CL cn

.) r_ la 3

500

co

-

0)

pKM7 pAF1 1 pAF21 pAF22 pAF23 pAF24

0

pAF25

FIG. 3. r-Galactosidase specific activity in cells harboring various versions of the (itB promoter fused to 1acZ and grown in different media. The plasmids integrated in strain SMY are indicated under each set of columns. See Fig. 2 for their structures. Plasmid pAF25 is a fusion of the l'eg promoter to IacZ (see Materials and Methods). Cells were grown in TSS supplemented with chloramphenicol (5 ,ug/ml) and either glucose (_) or citrate ( M ) as the carbon source. Samples were harvested at a turbidity of 100 Klett units (exponential growth phase), and f-galactosidase was assayed. One unit is defined as the AA42,0 X 103 per min. Note that the scale for SMY::pAF25 differs from that for all the other constructions.

different growth phases (24, 25) have been shown by nuclease mapping and operon fusion experiments to reflect regulation at the level of transcription (4, 26). For example, Dingman et al. (4) found that when a fusion of the E. coli laI(Z gene to the citB promoter region was integrated into the B. slibtilis chromosome at the citB locus, 3-galactosidase activity responded to the carbon source and to induction of sporulation in the same way as did aconitase activity. In this case, the fusion junction was at position +-200 relative to the start point for transcription. This result indicated that no sequences necessary for regulation of citB were located downstream of position +200. To find whether any sequences located far upstream of the citB promoter were responsible for its regulation, we integrated a citB-lacZ fusion at amnvE, a locus far removed from citB. To do so, we transformed B. slubtilis SMY with linearized DNA of pKM7 (Fig. 1). This plasmid is a derivative of ptrpBG1 (29) in which the part of the citB promoter region extending from positions -400 to +200 was fused to lacZ. Transformants were selected by resistance to chloramphenicol and screened for loss of cx-amylase production. By a double-crossover recombination event, integration of the citB-lacZ fusion results in disruption of the amyE gene. 3-Galactosidase activity in strain SMY::pKM7 was 10-fold higher in cells grown in minimal-citrate-glutamine medium than it was in cells grown in minimal-glucose-glutamine medium (Fig. 3. pKM7) or in minimal-glucose-citrate-glutamine medium (data not shown). The same repression-derepression phenomena were observed when glycerol was used as the carbon source instead of glucose (data not shown); this indicates that catabolite repression of aconitase is not specific to glucose and is exerted on a itB-lacZ fusion to the same extent as it is on the normal citB gene. It should be noted that in B. silbtilis, unlike the case for E. coli, glycerol is known to exert catabolite repression (11). Defining the target of the glucose effect. Not knowing whether the multiple aspects of citB regulation were the reflection of a single mechanism or multiple mechanisms, we focused first on defining the target of the glucose (carbon source) effect. To do so, we created 5' and 3' deletions of the 600-bp promoter fragment (-400 to +200) previously shown

to contain all sequences necessary for regulation. Various restriction fragments from the citB promoter region were

cloned in pUC8, their orientations were checked, and appropriate HindIII-EcoRI fragments were subcloned in pAFI (Fig. 1), a vector identical to pKM7 but lacking the citB promoter region upstream of lacZ. The various constructs obtained and verified by DNA sequencing are shown schematically in Fig. 2. Each of these fragments was thus fused to lacZ, and the fusion was inserted into the B. siubtilis chromosome at the amrnE locus. We verified for each construct that the alnvE locus was disrupted. The various strains were grown in minimal-glutamine medium containing either glucose or citrate as the carbon source. Figure 3 shows the results obtained with these strains. Integrants of pAF11, pAF21, pAF22, and pAF23 had the same pattern of 3-galactosidase expression in these media as did SMY::pKM7. Since pAF23 retains only bases -84 through +36 of the citB promoter region, we conclude that all cis-acting sequences necessary for carbon source regulation of citB are contained within this 121-bp region. On the other hand, integration at the amyE locus of pAF24, which differs from pAF23 by only 17 bp at the 5' end of the citB fragment, led to derepressed expression of 3-galactosidase whether the medium contained glucose or citrate as the carbon source (Fig. 3). Glucose-insensitive expression was also seen with a fusion of the leg promoter to lacZ (pAF25) (Fig. 3). The v'eg promoter was shown previously to be unresponsive to the presence of glucose (26). When glucose was replaced by glycerol as the carbon source, the same pattern of repression in SMY::pAF23 and deprepression in SMY::pAF24 was observed as in glucose medium (data not shown). Thus, removal of the 17 bp between positions -84 and -67 of the citB promoter led to total loss of catabolite repression. Deletion of the citB promoter at the citB locus. Since construction of a citB-lacZ fusion strain at the amyE locus revealed that the bases between positions -84 and -67 were critical for catabolite repression, we asked whether alteration of this 17-bp region would have the same effect at the citB locus. To test this, we purified the 104-bp HindIllEcoRI fragment containing the (itB promoter (positions -67

VOL. 172, 1990

B. SUBTILIS citB REGULATORY MUTANTS

839

200 -

cat

pAF65 l~ acZ

NcitBp

0 -, 04. co

o~ 'm 02

E 100-

_ ni

CL0 C

-67 X+36

o 0

citB

citBp

0o

c d FIG. 5. Aconitase activity in strain SMY::pAF65. Strains SMY (columns a, b, and c) and SMY::pAF65 (column d) were grown in TSS supplemented with glutamine and either glucose (columns a, c, and d) or citrate (column b) as the carbon source; chloramphenicol (2.5 ,ug/ml) was added to the SMY: :pAF65 culture. When the turbidity reached 100 Klett units, samples were harvested (columns a, b, and d). Alternatively, decoyinine was added and cells were harvested 2 h later (column c). Aconitase was assayed in extracts of each sample. One unit is defined as the production of 1.0 nmol of cis-aconitate per min. a

-67

+36

Lz LS/

L////

citBp

.-..-..

bla

-...-.-.I

.-..

cat

lacZ

s

s

citBp

s

b

citB

FIG. 4. Integration of pAF65 at the citB locus by a Campbell-like mechanism. This integration duplicates the region from positions -67 to +36 of the citB promoter. One copy is preceded by the DNA which is immediately upstream of this sequence in the wild-type strain and followed by sequences from the pJPM1 vector; the other copy is preceded by vector sequences and followed by the intact citB gene.

to +36) from pAF14 and ligated it to pJPM1, a vector that replicates in E. coli and carries a chloramphenicol resistance gene that is active in B. subtilis. Transformation of strain SMY by the resultant plasmid (pAF65) gave Camr strains in which pAF65 had integrated by a Campbell mechanism at the citB locus (Fig. 4). This was confirmed by Southern blot

analysis of chromosomal DNA of strains SMY and SMY::pAF65 digested with EcoRI, HindIII, and PstI (data not shown). The integration created a duplication of the region between positions -67 and +36. One copy lies in its normal position with respect to upstream sequences, but its downstream DNA is derived from the vector; the other copy lies upstream of the aconitase-encoding region. Therefore, aconitase gene expression should depend directly on the deleted version of the promoter. Cells carrying this construction were grown in minimalglutamine medium containing glucose as the carbon source, and a sample was harvested in the exponential phase. Aconitase activity in strain SMY::pAF65 was as high in glucose medium as it was in wild-type cells in citrate medium (Fig. 5). (Aconitase specific activity was twofold higher when strain SMY: :pAF65 was grown in minimal-citrate medium instead of minimal-glucose medium.) These results confirm that loss of the region upstream of position -67 leads to substantial reduction in the glucose effect. Definition of the target of induction by decoyinine. Sporulation-related regulation of citB expression in strains carrying wild-type and deleted fusion constructs was also tested. The addition of decoyinine induced lacZ expression within

15 min in SMY::pKM7 cells grown in glucose-glutamine medium (Fig. 6A) or in glycerol-glutamine medium (data not shown). This drug is known to cause aconitase activity to increase within 30 min of its addition (4, 32, 33). In strain BCDC8, which carries a citB-lacZ fusion at the citB locus, an increase in ,3-galactosidase activity could be detected within 15 min of addition of the drug (4). All of the constructs carrying deleted versions of the citB promoter at the amyE locus, except for pAF24, had the same phenotype. That is, when decoyinine was added to cells growing exponentially in minimal-glucose-glutamine medium a substantial increase in ,3-galactosidase activity was observed within 15 min (Fig. 6A and B). In strain SMY::pAF24, however, P-galactosidase activity decreased after the addition of decoyinine (Fig. 6C). This unexpected result was also obtained for the veg promoter construct (SMY::pAF25; data not shown). A likely explanation is that addition of decoyinine normally stimulates RNA and protein turnover as well as expression from certain promoters, such as the wild-type citB promoter. In addition, decoyinine treatment may lead to a decrease in the rate of transcription of some vegetative genes. Since the deleted citB promoter in SMY::pAF24 was expressed constitutively in the minimal-glucose-glutamine growth medium before the addition of decoyinine, addition of the drug led to no further increase in the rate of expression but only to more rapid degradation of new and preexisting mRNA and protein. At a minimum, one can conclude that deletion of the 17 bp between positions -84 and -67 eliminates the normal responses to both the carbon source and decoyinine. Either the repressing effect of the carbon source and the inducing effect of decoyinine involve DNA sequences that are very close, perhaps even overlapping, or they involve the same DNA sequence. It should be noted, however, that the decoyinine test might be misleading. Since cells in this case were grown in a medium in which citB-lacZ expression in SMY::pAF24 was already at a high level before addition of the drug, it is conceivable that the decoyinine effect was somehow masked.

J. BACTERIOL.

FOUET AND SONENSHEIN

840

2

15

.

A

B 10-

.; 0.. a a

o E CLu_ -Co

Si-: o,10z

aC2 In .

-2

0

-1

0

1

I

I

-2

2

'1

0

I

I

1

2

3

Time

Time I

n

D 140-

a

;-

'_ 120;

So6 a

°

E M0. _

E

CL

co _

0

c _

S0%m a

-

0

-2

a *

-20

lnme

.

.

.

.

.

2 lime

FIG. 6. Induction of ,-galactosidase activity by decoyinine. SMY strains carrying pKM7 (A), pAF23 (B), or pAF24 (C) integrated at the amyE locus were grown in TSS supplemented with glucose, glutamine, and chloramphenicol (5 ,ug/ml). (D) SMY::pKM7 was grown in TSS in which glucose was replaced by citrate. Samples were removed periodically and assayed for turbidity (not shown) and ,-galactosidase activity. When the turbidity reached 100 Klett units, the culture was split into two 20-ml portions to which 0.1 ml of either 1 M KOH (control) or decoyinine (100 mg/ml in 1 M KOH) was added. Time zero corresponds to the time of addition of decoyinine. Symbols: *, decoyinine-treated culture; O, control culture. Time points represent hours after addition of decoyinine.

Expression of citB is normally high when cells are grown in minimal-citrate medium. Decoyinine was therefore added to SMY: :pKM7 cells grown in minimal-citrate-glutamine medium (Fig. 6D); again, no induction of synthesis of ,-galactosidase was observed and the preexisting 3-galactosidase activity decreased. This is consistent with the notion that decoyinine acts at the citB promoter by antagonizing the negative effect of glucose, but does not rule out independent or additional modes of action of decoyinine. Titration of the glucose regulator. The fact that deletion of a segment of the citB promoter region leads to high-level expression that is independent of the carbon source suggests that the carbon source effect is mediated by a form of negative regulation. This correlates well with the previous observation that cells carrying the citB promoter (positions -400 to +200) on a multicopy plasmid show partially constitutive expression of citB (4). A simple interpretation of the latter result is that multiple copies of the promoter titrate a negative-regulatory protein present at a low level in the cells.

It was therefore interesting to see whether the deleted versions of the citB promoter region described above would show the same titration phenomenon. The various fragments that had been cloned in pAF1 were subcloned in pMK3-1, a B. subtilis-E. coli shuttle vector (31). These plasmids, pAF60 to pAF64, were introduced into strain SMY by transformation, with selection for Kanr. The cells were grown in minimal-glucose-glutamine medium, and the specific activity of aconitase was measured. Similar aconitase activities were found in extracts of SMY(pMK3-1), which has no extra copies of the citB promoter, and SMY(pAF64), which carries on the plasmid the citB sequence between positions -67 and +36 (Fig. 7); these were at a level typical for wild-type cells grown under repressing conditions (Fig. 5). Strains carrying plasmid pDWD1 (-400 to +200) (4), pAF61 (-84 to +200), pAF62 (-84 to +92), or pAF63 (-84 to +36), however, had partially derepressed levels of aconitase (Fig. 7 and data not shown), suggesting that they contained sequences that were able to titrate. (Analysis of the plasmid

B. SUBTILIS citB REGULATORY MUTANTS

VOL. 172, 1990

3.

2001

A

841

B

0 0-~

3

0

4_ CL0

od. 0

0

Q. >

4

0 0

CO

E

100-

'

2

o

a

6c*

E

0

C; C

0 S Cc

-

_

0

C5r

1'-

0

'E1

0

SMY

WK3'

pDWD

pAF63

pAF64

FIG. 7. Effect of multiple copies of the citB promoter on enzyme activities. Aconitase, citrate synthase, and isocitrate dehydrogenase activities in extracts of strain SMY transformed by pMK3-1, pDWD1, pAF63, and pAF64 were assayed as indicated under each set of columns. The cells were grown in TSS supplemented with glucose, glutamine, and kanamycin (5 ,ug/ml) to a turbidity of 100 Klett units. Relative specific activities are indicated, with the specific activity of each enzyme in the extract of SMY(pMK3-1) as the reference. The actual specific activities found for that strain were 9 U/mg for aconitase (M), 2.4 U/mg for citrate synthase ( EM), and 1.5 U/mg for isocitrate dehydrogenase ( E3 ). One unit of citrate synthase converts 1 nmol of acetyl coenzyme A to coenzyme A per min; 1 unit of isocitrate dehydrogenase causes the reduction of 1 nmol of NADP to NADPH per min.

contents of these strains indicated no significant difference in copy number.) Thus, the removal of bases -84 through -68 not only led to catabolite-insensitive expression of citB when the gene was present in single copy, but also impeded the ability of the citB promoter region to titrate an apparent negative regulator of transcription. The simplest explanation for this result is that the 17 bp between -84 and -67 form a site, or at least part of a site, at which a negative regulator acts on citB transcription. As a first test of this hypothesis, we synthesized this 17-bp segment and cloned it in multimeric form in the pMK3-1 vector. No titration effect on citB expression was seen in this case (data not shown). This led us to conclude that the 17-bp segment represents only a part of the putative regulatory target. Since the constitutivity seen in titration experiments was only partial, we added decoyinine to a sample of each of the cultures to see whether higher levels of expression could be obtained. An increase in aconitase specific activity was observed for all strains (data not shown). This could mean that decoyinine acts by a mechanism that is independent of carbon source regulation. It is equally plausible, however, that a single mechanism is involved; according to this view, decoyinine treatment inactivates the amount of putative negative regulator that was not sequestered by binding to the plasmid-borne copies of the citB promoter region. Specificity of citB regulation. The suggestion that a negative regulator mediates the response of the citB promoter to the carbon source raises the issue of the specificity of such a regulator. The two most obvious cases to test are those of citrate synthase and isocitrate dehydrogenase, since these enzymes function just before and after aconitase in the Krebs cycle. In addition, their expression has been shown to be sensitive to the presence of glucose (2). The specific activity of citrate synthase was threefold higher than normal in cells carrying pAF63, but was at the wild type level in

SMY::pAF65

SMY

SMY::pAF65

FIG. 8. Aconitase and citrate synthase activities in strain SMY::pAF65. Strains SMY and SMY::pAF65 were grown in TSS medium supplemented with glucose and glutamine. For SMY:: pAF65, chloramphenicol (2.5 ,ug/ml) was also added. Cells were harvested when the turbidity reached 100 Klett units. Aconitase (A) and citrate synthase (B) were assayed in each extract.

SMY(pAF64) (Fig. 7). This indicates that the condition that leads to titration with respect to aconitase activity has the same effect on citrate synthase. By contrast, the activity of isocitrate dehydrogenase was not affected by the presence of high-copy plasmids carrying the citB promoter (Fig. 7). The effect of pAF63 on citrate synthase activity can be explained in two ways. First, the same regulator may control both aconitase and citrate synthase; partial titration of the regulator by multiple copies of the citB promoter region would give partial constitutivity of both enzymes. Second, the effect on citrate synthase may be indirect. That is, overexpression of aconitase caused by the presence of multiple copies of the citB promoter might lead to a severe drop in the intracellular pool of citrate. Since citrate may regulate citrate synthase activity or synthesis, this enzyme might become derepressed or more active under these conditions. To discriminate between these two hypotheses, we assayed citrate synthase activity in strain SMY::pAF65, in which constitutivity of aconitase activity was due to alteration of the citB promoter region rather than titration of a putative regulator. In this strain, aconitase activity (160 U/mg) was even higher than in strain SMY(pAF63) (25 U/mg) (compare Fig. 5, 7, and 8A). However, citrate synthase activity was not derepressed in SMY::pAF65 (1.6 U/mg, versus 2.4 U/mg for strain SMY [Fig. 8B]). This indicates that citrate synthase is not derepressed whenever aconitase activity is unusually high and lends credence to the idea that citrate synthase and aconitase are subject to a common regulatory mechanism. On the other hand, isocitrate dehydrogenase activity is probably controlled by an independent mechanism. Regulation of citB in nutrient broth medium. The data presented above provide evidence that the mechanisms regulating citB expression in response to the carbon source overlap substantially with those controlling its expression at the onset of sporulation, at least when sporulation is induced by the addition of decoyinine. The relationship of such regulation to mechanisms controlling citB in nutrient broth medium is unknown. To address this question, strain SMY::pKM7 and strains carrying different deleted versions of the citB promoter upstream of lacZ were grown in DSM and P-galactosidase levels in samples harvested at different times during exponential and stationary phases were assayed. The appearance of ,B-galactosidase activity had the

842

FOUET AND SONENSHEIN 2A I

J. BACTERIOL. ,

A

120 100

2.2 -

2A

-120

.B

1160

2.2-

c,o 0

0

680

D= *0. eI-=Y.

2.0-

C

2.0-

_S

6-

'a

.60

60

_

1.

1i 40

.40

0 -J

1.6 -

1A'

20

1.6 IA

|1 T2

3

4

5

I~~Jllz -1

o

,

;

1

,

3

.20

I0

i,

2

a

0 CO a

4

5

0

1

3

2

4

5

Time FIG. 9. 1-Galactosidase activity in different lacZ fusion strains grown in DSM. The medium contained chloramphenicol (2.5 ,g/ml). Samples were assayed periodically for turbidity (U, O) and 3-galactosidase activity (0, 0). (A) Strains SMY::pKM7 (citBp fused to lacZ and integrated at the amyE locus) (U, 0) and BCDC8 (citBp fused to lacZ in the citB locus) (O, 0). (B) Strains SMY::pAF23 (U, 0) and SMY::pAF24 (C1, 0). (C) Strains SMY::pKM7 (U, 0) and SMY::pAF3 (the spac promoter fused to lacZ and integrated at the amyE locus) (O, 0). lime

same kinetics in strain SMY: :pKM7 as it did in cells carrying the same fusion at the citB locus (strain BCDC8 [Fig. 9A] [4]). Expression of lacZ in SMY::pAF23 and SMY::pAF24 was similar (the activity in SMY::pAF24 was no more than twofold higher than in SMY: :pAF23) and had essentially the same kinetics in these two strains as it did in SMY::pKM7 (Fig. 9A). As a control, we showed that a spac-lacZ fusion was not induced under these conditions (Fig. 9C). (The spac promoter is a hybrid of a phage SPOl promoter and the E. coli lac UV5 promoter [34]). We are led to conclude that the mechanism controlling citB expression in DSM medium is distinct from that which mediates catabolite repression in minimal medium.

DISCUSSION We found that removal from the citB promoter region of the 17 bp between positions -84 and -68 led to loss of repressibility by glucose and glycerol. This suggests that regulation of citB in minimal medium could be mediated through a carbon source-dependent negative regulatory molecule. The ability of multiple copies of the citB promoter region that include this 17-bp sequence to derepress transcription supports this hypothesis. The sequence between positions -84 and -67 includes the upstream arm of a region of dyad symmetry that extends from positions -73 to -59 (5). In addition, the sequence of the downstream arm occurs in direct repeat near position -30. These sequences are candidates for binding sites for the putative negative regulator.

The fact that wild-type cells grown under nonrepressing conditions (minimal-citrate medium) and mutant cells lacking the target for catabolite repression are not further induced for citB expression after addition of decoyinine correlates well with a model in which the carbon sourcedependent negative regulator is inactivated or repressed, directly or indirectly, by decoyinine treatment. The synthesis or activity of this regulator would be dependent on different effectors; it would be activated by 2-KG and antagonized, directly or indirectly, by citrate, the postulated inducer of citB expression (4, 24). Glucose and other rapidly metabolizable carbon sources or their metabolites could act by stimulating synthesis or activity of the repressor. Alternatively, the carbon effectors could have a less direct role;

Tlme

they could prevent the production of citrate, for example, by inhibiting the activity or repressing the synthesis of pyruvate dehydrogenase. This model is consistent with the known correlation between the intracellular concentration of 2-KG and the extent of repression of aconitase activity (9). It also correlates well with the ability of decoyinine to override catabolite-repressing conditions, since among the first events following the addition of this drug are activation of 2-KG dehydrogenase and a subsequent drop in the intracellular concentration of 2-KG (within 10 to 15 min) (32). In DSM medium, temporal regulation was observed even when the citB promoter region lacked the target for catabolite repression. This suggests the existence of an independent mechanism which can override the effect of 2-KG and citrate. Titration experiments seemed to indicate that aconitase and citrate synthase have a common regulatory mechanism. Since the gene for citrate synthase (citA) has not been characterized, we are unable to compare its regulatory region with that of citB. This mechanism is not necessarily shared with any other genes, even including the gene for isocitrate dehydrogenase. For instance, amyE, like citB, is turned on at the end of the exponential phase in DSM medium (12), but the effects of addition of decoyinine on the transcription of these two genes are different. In the presence of glucose, the addition of decoyinine has no effect on expression of the amyE locus, unless the target of glucose repression has been inactivated by mutation (21-23). For citB and amyE, the targets for glucose regulation appear to be localized in different parts of the promoter region. Whereas citB has a target near position -67, amyE has an operatorlike sequence centered at position +5 (23) and no glucose-sensitive targets upstream of position -35 (G. Chambliss, personal communication). The different positions of the targets and the different effects of decoyinine raise the possibility that the mechanisms of regulation of these promoters by glucose are not the same. The regulation of expression of spoVG has some features in common with that of citB; expression of both genes is enhanced by addition of decoyinine to cells in minimalglucose medium and increases at the end of exponential growth in DSM medium (4, 35). Still, the mechanisms of

B. SUBTILIS citB REGULATORY MUTANTS

VOL. 172, 1990

regulation of expression of spoVG and citB do not overlap completely, since a block in 2-KG dehydrogenase activity does not prevent the induction of spoVG by decoyinine (P. Zuber, personal communication) and mutations in spoOA, spoOB, or spoOH do not affect the transcription of citB (4). Furthermore, these two genes are transcribed by RNA polymerases containing different cu factors. We were not able to identify any sequence similar to the 17 bp between positions -84 and -67 of citB in the spoVG promoter (20). The citG gene, coding for fumarase (an enzyme of the dicarboxylic acid part of the Krebs cycle), is subject to still different regulation. It is derepressed in minimal-glucose medium (8) and is not further induced by the addition of decoyinine (V. Price and A. Moir, personal communication); its expression rises at the end of exponential growth in nutrient broth medium, but is reduced by addition of glucose to this medium (8). This gene is transcribed from two tandem promoters, one used by the EauA form of RNA polymerase and the other by the EcrH form (31a). It therefore seems that genes expressed at the onset of sporulation are subject to overlapping but not identical regulatory mechanisms. Detailed analysis of these and other systems is required before it is possible to decide whether they have any aspects of regulation in common. Our goal for the citB gene is to define more precisely the target for catabolite repression and to identify the putative catabolite regulatory protein. ACKNOWLEDGMENTS We thank M. Malamy, J. Mueller, C. Mathiopoulos and F. Whipple for helpful comments on the manuscript. We also thank K. Madden for constructing pKM7, J. Mueller for the gift of pJPM1, R. Yasbin for providing pMK3-1, and G. B. Whitfield and R. L. Keene of The Upjohn Co. for the gift of decoyinine U-7984. This work was supported by Public Health Service research grants GM 36718 and GM 42219 from the National Institutes of Health. A.F. is a fellow of the Centre National de la Recherche Scientifique, France. LITERATURE CITED 1. Amory, A., F. Kunst, E. Aubert, A. Klier, and G. Rapoport. 1987. Characterization of the sacQ genes from Bacillus licheniformis and Bacillus subtilis. J. Bacteriol. 169:324-333. 2. Cox, D. P., and R. S. Hanson. 1968. Catabolite repression of aconitate hydratase in Bacillus subtilis. Biochim. Biophys. Acta

158:36-44. 3. Davis, R. W., D. Botstein, and J. R. Roth (ed.). 1981. Advanced bacterial genetics, p. 140-141. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 4. Dingman, D. W., M. S. Rosenkrantz, and A. L. Sonenshein. 1987. Relationship between aconitase gene expression and sporulation in Bacillus subtilis. J. Bacteriol. 169:3068-3075. 5. Dingman, D. W., and A. L. Sonenshein. 1987. Purification of aconitase from Bacillus subtilis and correlation of its N-terminal amino acid sequence with the sequence of the citB gene. J. Bacteriol. 169:3062-3067. 6. Donnelly, C. E., and A. L. Sonenshein. 1984. Promoter-probe plasmid for Bacillus subtilis. J. Bacteriol. 157:965-967. 7. Dubnau, D., and R. Davidoff-Abelson. 1971. Fate of transforming DNA following uptake by competent Bacillus subtilis. J. Mol. Biol. 56:209-221. 8. Feavers, I. M., V. Price, and A. Moir. 1988. The regulation of the fumarase (citG) gene of Bacillus subtilis 168. Mol. Gen. Genet. 211:465-471. 9. Fisher, S. H., and B. Magasanik. 1984. 2-Ketoglutarate and the regulation of aconitase and histidase formation in Bacillus subtilis. J. Bacteriol. 158:379-382. 10. Fortnagel, P., and E. Freese. 1968. Analysis of sporulation mutants. II. Mutants blocked in the citric acid cycle. J. Bacte-

843

riol. 95:1431-1438. 11. Hanson, R. S., and D. P. Cox. 1967. Effect of different nutritional conditions on the synthesis of tricarboxylic acid cycle enzymes. J. Bacteriol. 93:1777-1787. 12. Heineken, F., and R. O'Connor. 1972. Continuous culture studies on the biosynthesis of alkaline protease, neutral protease, and a-amylase by Bacillus subtilis NRRL-B3411. J. Gen. Microbiol. 73:35-44. 13. Ish-Horowicz, D., and J. F. Burke. 1981. Rapid and efficient cosmid cloning. Nucleic Acids Res. 9:2989-2998. 14. Jaacks, K. J., J. Healy, R. Losick, and A. D. Grossman. 1989. Identification and characterization of genes controlled by the sporulation-regulatory gene spoOH in Bacillus subtilis. J. Bacteriol. 171:4121-4129. 15. LeGrice, S. F. J., C.-C. Shih, F. Whipple, and A. L. Sonenshein. 1986. Separation and analysis of the RNA polymerase binding sites of a complex Bacillus subtilis promoter. Mol. Gen. Genet. 204:229-236. 16. Lopez, J. M., C. L. Marks, and E. Freese. 1979. The decrease of guanine nucleotides initiates sporulation of Bacillus subtilis. Biochim. Biophys. Acta 587:238-252. 17. Lowry, 0. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193:265-275. 18. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 19. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 20. Moran, C. P., Jr., N. Lang, C. D. B. Banner, W. G. Haldenwang, and R. Losick. 1981. Promoter for a developmentally regulated gene in Bacillus subtilis. Cell 25:783-791. 21. Nicholson, W. L., and G. H. Chambliss. 1985. Isolation and characterization of a cis-acting mutation conferring catabolite repression resistance to a-amylase synthesis of Bacillus subtilis. J. Bacteriol. 161:875-881. 22. Nicholson, W. L., and G. H. Chambliss. 1987. Effect of decoyinine on the regulation of a-amylase synthesis in Bacillus subtilis. J. Bacteriol. 169:5867-5869. 23. Nicholson, W. L., Y. K. Park. T. M. Henkin, M. Won, M. J. Weickert, J. A. Gaskell, and G. H. Chambliss. 1987. Catabolite repression-resistant mutations of the Bacillus subtilis alphaamylase promoter affect transcription levels and are in an operator-like sequence. J. Mol. Biol. 198:609-618. 24. Ohne, M. 1974. Regulation of aconitase synthesis in Bacillus subtilis: induction, feedback repression and catabolite repression. J. Bacteriol. 117:1295-1305. 25. Ollington, J. F., W. G. Haldenwang, T. V. Huynh, and R. Losick. 1981. Developmentally regulated transcription in a cloned segment of the Bacillus subtilis chromosome. J. Bacteriol. 147:432-442. 26. Rosenkrantz, M. S., D. W. Dingman, and A. L. Sonenshein. 1985. Bacillus subtilis citB gene is regulated synergistically by glucose and glutamine. J. Bacteriol. 164:155-164. 27. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 28. Sekiguchi, J., N. Takada, and H. Okada. 1975. Genes affecting the productivity of a-amylase in Bacillus subtilis Marburg. J. Bacteriol. 121:688-694. 29. Shimotsu, H., and D. J. Henner. 1986. Construction of a single-copy integration vector and its use in analysis of regulation of the trp operon of Bacillus subtilis. Gene 43:85-94. 30. Sonenshein, A. L., B. Cami, J. Brevet, and R. Cote. 1974. Isolation and characterization of rifampin-resistant and streptolydigin-resistant mutants of Bacillus subtilis with altered sporulation properties. J. Bacteriol. 120:253-265. 31. Sullivan, M. A., R. E. Yasbin, and F. E. Young. 1984. New shuttle vectors for Bacillus subtilis and Escherichia coli which allow rapid detection of inserted fragments. Gene 29:21-26. 31a.Tatti, K. M., H. L. Carter III, A. Moir, and C. P. Moran, Jr. 1989. Sigma H-directed transcription of citG in Bacillus subtilis. J. Bacteriol. 171:5928-5932.

844

FOUET AND SONENSHEIN

32. Uratani-Wong, B., J. M. Lopez, and E. Freese. 1981. Induction of citric acid cycle enzymes during initiation of sporulation by guanine nucleotide deprivation. J. Bacteriol. 146:337-344. 33. Vasantha, N., and E. Freese. 1980. Enzyme changes during Bacillus subtilis sporulation caused by deprivation of guanine nucleotides. J. Bacteriol. 144:1112-1125.

J. BACTERIOL.

34. Yansura, D. G., and D. J. Henner. 1984. Use of the Escherichia coli lac repressor and operator to control gene expression in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 81:439-443. 35. Zuber, P., and R. Losick. 1987. Role of abrB in spoOA- and spoOB-dependent utilization of a sporulation promoter in Bacillus subtilis. J. Bacteriol. 169:2223-2230.