doi: 10.1111/age.12099

Regulatory mutations in the A2M gene are involved in the mastitis susceptibility in dairy cows X. G. Wang*, J. M. Huang*, M. Y. Feng*, Z. H. Ju*, C. F. Wang*, G. W. Yang†, J. D. Yuan† and J. F. Zhong* *Laboratory of Molecular Genetics and Breeding, Dairy Cattle Research Center, Shandong Academy of Agricultural Sciences, Jinan, 250131, China. †Department of Biotechnology, Shandong Normal University, Jinan, 250014, China.

Summary

Mutations, such as single nucleotide polymorphisms (SNPs), in the 5′-flanking and microRNA (miRNA) regulatory regions may result in altered gene expression levels and cause diseases. Alpha-2-macroglobulin (A2M) has the function of binding host or foreign peptides and particles, and thereby serves as a defense barrier against pathogens in the plasma and tissues of animals. To investigate the functional markers of the A2M gene associated with mastitis, the promoter was characterized and SNPs that affect promoter activity or binding affinity with the target miRNA were identified using the luciferase reporter assay and real-time quantitative PCR method. Results showed that the core promoter of A2M was found between the bases g.-2641 and g.-2479. Four novel SNPs (g.-724A>G, g.-665G>A, g.-535C>G and g.-520_-519insA) in the promoter region were completely linked. The activity of the mutant haplotype (GAGA) increased by 177% compared with that of the wild haplotype (AGC-). Bta-miR-2898 was upregulated by 6.25fold in the mammary gland tissues of mastitis-infected cows compared with that of the healthy cows. One SNP (c.4659_4661delC) located in the 3′-untranslated region of the A2M gene may affect the binding affinity with the target bta-miR-2898. Five SNPs exhibited tight linkage. Association analysis showed that the milk somatic cell score for cows with the mutant haplotype (GAGA-) was lower than that for cows with the wild haplotype. Thus, the mutant type can be used as a potential functional marker for a mastitis resistance breeding program in dairy cows. Our findings provided the molecular basis for A2M transcriptional and post-transcriptional regulations. A close relationship between regulatory mutations and mastitis susceptibility of cows also was established. Keywords 3′-UTR, alpha-2-macroglobulin, bta-miR-2898, functional SNP, haplotype, promoter

Introduction Alpha-2-macroglobulin (A2M), an evolutionarily conserved arm of the innate immune system (Armstrong & Quigley 1999), modulates mitogen- and antigen-driven T-cell response, macrophage proliferation and cytokine-binding

Adderss for correspondence J. Huang, J. Zhong, Laboratory of Molecular Genetics and Breeding, Dairy Cattle Research Center, Shandong Academy of Agricultural Sciences, Industry North Road 159, Jinan 250131, Shandong, China. E-mails: [email protected]; [email protected] and J. D. Yuan, Department of Biotechnology, Shandong Normal University, Eastern Wenhua Road, Jinan 250014, Shandong, China. E-mail: [email protected] Accepted for publication 23 September 2013

28

function (Banks et al. 1990; Bonacci et al. 2007). A2M is a member of the alpha-macroglobulin (aM) family of proteins, along with C3, C4 and C5 of the complement system (Levashina et al. 2001). A2M, a non-specific protease inhibitor in mammals, is involved in the host defense mechanism, thereby inhibiting endogenous and exogenous proteases by a unique ‘trapping’ mechanism (Enghild et al. 1989; Sottrup-Jensen 1989). Previous studies suggested that an increase in A2M gene transcription levels has an important function in the defense against pathogens (Zuo & Woo 1997; Saeij et al. 2003). Mastitis, an inflammatory disease of the mammary gland, is the most common and complex disease in dairy cattle, thereby resulting in a large economic loss in dairy farming (Seegers et al. 2003). Several bacteria causing bovine mastitis, including Staphylococcus aureus, Streptococcus agalactiae and Escherichia coli, secrete proteases playing a role in © 2013 Stichting International Foundation for Animal Genetics, 45, 28–37

Regulatory mutations of the bovine A2M gene invasion of the udder (Mason 2006). The A2M protease inhibitor, which is involved in the predominant defense mechanism in the plasma and tissues, has important functions in host immunity by inactivating and clearing the protease virulence factors of pathogens (Armstrong 2006). Our previous study showed that the expressions of A2M mRNA and proteins are up-regulated significantly more in the mastitis-infected mammary tissues of cows than in healthy tissues, suggesting that A2M is a mastitis-related gene (Wang et al. 2012b). The regulatory mutations that affect either the expression or function of a gene product are important in controlling phenotypic variations (King & Wilson 1975; Gruber et al. 2012). Functional single nucleotide polymorphisms (SNPs), common forms of genetic variations in the mammalian genome, are associated with several diseases, including bovine mastitis (Nicoloso et al. 2010; Li et al. 2012; Poletto et al. 2012). In general, the effects of functional SNPs include protein coding, splicing regulation, or transcriptional and post-transcriptional regulations. The 5′-flanking region of the gene, particularly the minimal promoter, is the key transcriptional regulatory region in gene expression (Saeki et al. 2011; Amin et al. 2012). MicroRNAs (miRNAs), on average 22 nucleotides in size, are a family of endogenous non-coding RNAs (Bartel 2009). miRNAs are post-transcriptional regulators, which bind primarily to the 3′-untranslated region (UTR) of the target mRNAs, followed by the coding sequence and the 5′-UTR. This binding affects mRNA stability and its translation (Filipowicz et al. 2008). Variants, such as SNPs in miRNA regulatory regions, which are a novel resource of phenotypic variation, may result in altered protein levels and diseases (Georges et al. 2006; Thomas et al. 2011; Wang et al. 2012a,b). Researchers are currently attempting to identify the mutations that are involved in phenotypic plasticity. The mechanism by which A2M gene expression is regulated and whether functional mutations are found in 5′-flanking and 3′-UTR regions as well as their relationship with mastitis susceptibility remains largely unknown. In the present study, we aimed to determine the minimal promoter region and target miRNAs. We also aimed to identify potentially functional polymorphisms in the regulatory regions that affect the gene transcription level. These findings provided insights into the regulatory mechanisms of the A2M gene under pathological conditions.

Materials and methods Ethics statement All experiments were carried out according to the Regulations for the Administration of Affairs Concerning Experimental Animals published by the Ministry of Science and Technology, China (2004) and approved by the Animal Care and Use Committee in Shandong Academy of Agricultural Sciences, Shandong, China. © 2013 Stichting International Foundation for Animal Genetics, 45, 28–37

SNPs and haplotype analysis of the 5′-flanking and 3′-UTR regions of the bovine A2M gene Two primer pairs, namely A2M-1 (F, 5′-TGATTTCCTTTC CAAGACCCAA-3′; R, 5′-TGTCGGCAGCAAGAGCAG-3′, product size = 1162 bp) and A2M-2 (F, 5′-GACTCTATCTTCC CAACTCT-3′; R, 5′-ATTGCCTTTACCATCTACT-3′, product size = 1259 bp) of the bovine A2M gene (GenBank: AC_000162.1), were designed for the amplification of the A2M partial 5′-flanking region. Based on the previous A2M gene sequence reference, a pair of A2M-3′-UTR (F, 5′-GAGTACAGTGCTCCTTGC-3′; R, 5′-TAGTTGTGGTGAG TGGG-3′; product size = 882 bp) primers was designed for the 3′-UTR region. The corresponding PCR products were sent to a commercial service for sequencing. The sequenced results were analyzed using DNAMAN v5.2.2 (Lynnon Biosoft) and DNASTAR LASERGENE 7.1 software to search for SNPs. Linkage disequilibrium and haplotype analysis were performed using SHESIS software (http://analysis.bio-x.cn/my Analysis.php) (Li et al. 2009). Genomic DNA was isolated from 232 Chinese Holstein cows from the standardized dairy cattle farms in Shandong, China. All of the dairy cows were 3.0–3.5 years old with the same lactation period. The PCR products were genotyped by DNA product direct sequencing. For the somatic cell count (SCC) measurement, milk samples from the cows were collected thrice daily for a month. SCC was determined using the Fossomatic 5000 cell counter (Foss Electric). The distribution frequency of SCC usually is skewed. Therefore, the SCC values were converted into somatic cell scores (SCSs) according to a previously described method (Huang et al. 2010). The corresponding SCSs from dairy herd improvement records were used for statistical analysis.

Isolation of RNA and cDNA synthesis To investigate the relative expressions of A2M mRNA and target miRNA, 12 healthy and Staphylococcus aureus mastitis-infected mammary gland tissues were collected from first-lactating Chinese Holstein cows (2.8–3.0 years old) from the Duoshi Liuyingzi Commercial Slaughter Farm in Jinan, Shandong Province, China. We obtained permission from this slaughterhouse to use these animal parts. The detailed protocols for the total RNA extraction and reverse transcription into cDNA were described in our previous study (Li et al. 2012).

Bioinformatics analysis of target miRNA The target miRNAs of the bovine A2M 3′-UTR region, including the c.4659_4661delC SNP, were predicted using RNA22 MICRORNA TARGET DETECTION (http://cbcsrv.watson.ibm. com/rna22.html). The minimum free energy hybridization of miRNA with wild and mutant A2M 3′-UTR was predicted

29

30

Wang et al. using RNAHYBRID (http://bibiserv.techfak.uni-bielefeld.de/ rnahybrid/submission.html) software.

Relative quantitative analysis of target miRNA cDNA from six healthy and Staphylococcus aureus mastitisinfected mammary gland tissues were used for the relative expression of bta-miR-2898. Real-time quantitative PCR (RT-qPCR) was performed using the miScript PCR system (Qiagen) according to the manufacturer’s specifications. The primer for bta-miR-2898 has the same sequence as its mature miRNA. Bta-let-7 g was used as an internal control. The detailed procedure was described in a previous report (Huang et al. 2011). The relative expression of bta-miR2898 was analyzed through differential fold change.

Plasmid constructs A2M promoter plasmid constructs Nucleotide positions were numbered with respect to A of the translation start codon ATG, and A was defined as position +1. The PCR product, including the 5′-flanking region of A2M from position g.-2641 to g.-36, was amplified from the DNA of the cows, digested with KpnI and MluI enzymes, purified using the gel/PCR extraction kit (Biomiga), inserted into KpnI and MluI sites of the pGL3-basic vector (Promega) with T4 DNA ligase, and designated as pGL3-2641. All of the other deleted constructs, namely pGL3-2641, pGL32479, pGL3-2229, pGL3-2077, pGL3-1965, pGL3-1377, pGL3-1093, pGL3-1093′, pGL3-680 and pGL3-323, were created via PCR amplification using the same method. Both pGL3-1093 and pGL3-1093′ correspond to the haplotypes AGC- and GAGA of the four SNPs (g.-724A>G, g.-665G>A, g.-535C>G and g.-520_-519insA) respectively. All of the plasmid constructs had a variable position at the 5′-end but a common position at the 3′-end. All of the primers used in the plasmid constructs are listed in Table 1. All of the constructs were verified by direct sequencing using RVPRIMER3 (5′-CTAGCAAAATAGGCTGTCCC-3′) and GLPRIMER2 (5′-CTTTATGTTTTTGGCGTCTTCCA-3′) primers. A2M 3′-UTR plasmid constructs A 165-bp fragment of the A2M 3′-UTR that includes the c.4659_4661delC SNP and contains the putative binding sequences for bta-miR-2898 was amplified from the A2M cDNA by using the 3′-UTR primers (F, 5′-CGACGCGTAC CATGTCAATGAAAA-3′; R, 5′-CCCAAGCTTAACATTTATT GAGTAAAT-3′). To construct the wild type PMIR-3′UTR-W and mutant type PMIR-3′UTR-M plasmids, the PCR products were cloned into the pMIR-REPORT vector (Ambion) via the MluI and HindIII restriction enzyme sites. Bta-miR2898 expression (precursor sequence: gguuuaaugcucugcugu

cagcgcuuugaaauucuuacuaaucuuuuuuugguggagaugccggg gacguaauaauu) and its corresponding scrambled negative control miR-control vectors through the pEZX-MR04 vector construct were purchased from GeneCopoeia. The sequences of the constructed plasmids were confirmed by DNA direct sequencing.

Cell culture and transient transfection assays Human epithelial kidney 293T (HEK 293T) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM), which contains 10% fetal bovine serum (FBS), penicillin (100 U/l) and streptomycin (100 mg/l). The cells were grown under 5% CO2 atmosphere at 37 °C. At 24 h prior to transfection, the cells were transferred to 48-well culture plates at a density of 70% to 80% confluence at the time of transfection without antibiotics. To detect the promoter activities of different-sized fragments of the A2M 5′-flanking region, the cells were cotransfected with 0.4 lg of each luciferase reporter plasmid and 50 ng of the internal control pRL-TK plasmid (Promega) by using OPTI-MEM® I Medium (Invitrogen) and Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. The cells were then cotransfected with 0.4 lg of each PMIR luciferase reporter plasmid, 0.4 lg of each miRNA vector and 50 ng of the internal control pRL-TK plasmid to detect the binding affinity of bta-miR-2898 and A2M 3′-UTR. The medium was replaced with DMEM containing FBS 5 h after transfection was performed. At 24-h post-transfection, the cells were lysed and harvested with a passive lysis buffer (Promega). The reporter gene expression was analyzed using the dual-luciferase reporter assay system kit (Promega) according to the manufacturer’s protocol. The firefly luciferase activity was normalized to transfection efficiency based on Renilla luciferase activity. pGL3-control and pGL3-basic vectors were used as the positive and negative controls respectively. All of the experiments were performed six times for each plasmid.

RT-qPCR analysis of A2M mRNA RT-qPCR assay was performed to investigate the differential expression between wild (n = 6) and mutant (n = 6) types of the mammary gland tissues by using the SYBRâ Premix Ex Taq II (TaKaRa) according to the manufacturer’s protocol. Each experiment was performed in triplicate. The relative expression levels of A2M mRNA in wild and mutant types were normalized by b-actin, the housekeeping internal control gene. The RT-qPCR primers and the protocol were described in our previous study (Saeki et al. 2011).

Statistical analysis The relative quantification of A2M mRNA and luciferase activity was represented as mean
SE. The P-value for © 2013 Stichting International Foundation for Animal Genetics, 45, 28–37

Regulatory mutations of the bovine A2M gene Table 1 Primer pairs used to screen the A2M promoter.

Promoter construct

Primer sets

pGL3-2641

F: 5′-CGGGGTACCCTGATTCATTTCGCTCTA-3′ R: 5′-CGCACGCGT TGTTGCACCTTTCTCC-3′ F:5′-CGGGGTACCTTACTTAGGCTTACCTTACA-3′ R:5′-CGCACGCGT TGTTGCACCTTTCTCC-3′ F:5′-CGGGGTACC CAGCATCAGGGTCTTT-3′ R:5′-CGCACGCGT TGTTGCACCTTTCTCC-3′ F:5′-CGGGGTACCTCAAGCGTCTTCTCCA-3′ R:5′-CGCACGCGT TGTTGCACCTTTCTCC-3′ F:5′-CGGGGTACCAGCCCTCTGTTCTCGTT-3′ R:5′-CGCACGCGTTTGCACCTTTCTCCCT-3′ F:5′-CGGGGTACCCCCCAAGTACCCTAGT-3′ R:5′-CGCACGCGTTTGCACCTTTCTCCCT-3′ F:5′-CGGGGTACCCCTTTCCAAGACCCAA-3′ R:5′-CGCACGCGTTTGCACCTTTCTCCCT-3′ F:5′-CGGGGTACCGCTACTTCTCCTTTCGTCT-3′ R:5′-CGCACGCGTTTGCACCTTTCTCCCT-3′ F:5′-CGGGGTACCGATTGAAAAGCCGATTA-3′ R:5′-CGCACGCGTTTGCACCTTTCTCCCT-3′

pGL3-2479 pGL3-2229 pGL3-2077 pGL3-1965 pGL3-1377 pGL3-1093 pGL3-680 pGL3-323

Annealing temperature (°C)

Region

54

–2641 to –36

54

–2479 to –36

55.5

–2229 to –36

55

–2077 to –36

58

–1965 to –38

58

–1377 to –38

53.7

–1093 to –38

54

–680 to –38

55

–323 to –38

Underlined words refer to restriction endonucleases sites. KpnI: CGGGGTACC; MluI: CGCACGCGT

Student’s t-test was analyzed on SPSS v13.0 software. The association analysis between the SNP marker genotypes of the A2M gene and SCS was analyzed by the least squares method as applied in the GLM procedure of SAS (SAS Institute, Inc.). A modified procedure for the association analysis basing on the previous report (Huang et al. 2010) was as follows: Yijklmn ¼ l þ Fi þ Gj þ Sk þ El þ Hm þ eijklmn ; where Yijklmn was the observed value, l was the overall mean, Fi was the fixed effect of farm, Gj was the fixed effect of genotype or genotype combination, Sk was the fixed effect of sire, El was the fixed effect of season, Hm was the fixed effect of parity and eijklmn was the random residual effect. Number of samples G

–38

2: g. -665G>A

LUC pGL3-1965 LUC pGL3-1377 LUC pGL3-1093 LUC pGL3-1093’ LUC pGL3-680 LUC pGL3-323 LUC pGL3-Basic

3: g. -535C>G - 520_ -519insA 4: g. -520_

(b)

LUC pGL3-2641

LUC pGL3-Control

–2641 –

––36

LUC

pGL3-2641 -

LUC

pGL3-2479 -

LUC

pGL3-2229 -

LUC

pGL3-2077 -

LUC

pGL3-Basic -

LUC

pGL3-Control

0

0.5 1 1.5 Relative luciferase activity

2

0

1 2 3 4 Relative luciferase activity

5

–36

– –2479

–36

– –2229 – –2077

–36

Figure 1 Functional analysis of the bovine A2M gene promoter. (a) Functional analysis of the different size A2M 5′-flanking fragment and allelic variants by luciferase reporter gene. A. Left panel shows the schematic representations of each luciferase reporter plasmid that contains 5′-flanking regions of different lengths. The relative luciferase activities between the wild-type pGL3-1093 construct and the mutant-type pGL3-1093′ construct were assayed after they were transfected into 293 cells. pGL3-Basic and pGL3-Control serve as negative and positive controls. (b) Corresponding relative luciferase activities (firefly/Renilla) of different reporter gene constructs are shown in the right panel. The constructs were cotransfected with pRL-TK vector into HEK 293T cells. The firefly luciferase activities were normalized to the luciferase activity of the internal Renilla control. Vertical bars represent the means
SE of six replication experiments. (b) Deletion constructs of g.-2641 to g.-1965 and definition of the A2M minimal promoter by transient transfection in HEK 293T cells. A. Left panel representations show different constructs that contain different lengths of the 5′-flanking region. B. Normalized transcriptional activity of the A2M promoter serial deletion constructs is shown in the right panel. Vertical bars represent the means
SE of six replication experiments.

(g.-724A>G, g.-665G>A, g.-535C>G and g.-520_-519insA) were found in the promoter region, whereas no SNPs were found in the core region (Fig. 1). Figure S2 shows this finding in more detail. To identify their effects on the promoter activity, we amplified the region from bases g.-1056 to g.-38 with genomic DNA samples and constructed pGL3-1093 (wild haplotype: AGC-) and pGL31093′ (mutant haplotype: GAGA) vectors. Interestingly, the dual-luciferase reporter assay suggested that the pGL31093′ construct affected the transcription level of the reporter gene and showed a significant 177% increase in the transcription activity compared with the pGL3-1093 construct (Fig. 1a). This result indicated that the four SNPs can affect the promoter activity. TFSEARCH and CLUSTER BUSTER (http://zlab.bu.edu/ cluster-buster/cbust.html) were used to analyze whether SNPs change the putative transcription factor binding sites. The results showed that the g.-724A>G mutation created an NKx-2.5 transcription factor binding site and the other g.-520_-519insA mutation increased a C/EBPb-binding site. Fig. S3 shows this result in more detail.

Identification of functional SNPs in the A2M 3′-UTR region We found that the A2M 3′-UTR has putative bta-miR-2898binding sites (Fig. 2a) by using RNA22 and miRNA web miRbase programs. In addition, SNP c.4659_4661delC, located within the bta-miR-2898-binding site, was found using DNA direct sequencing (Fig. 2a,b). To test whether bta-miR-2898 binds with the 3′-UTR or the SNP causes differential binding affinity, we cloned different A2M 3′-UTR genotypes in the luciferase reporter vector and constructed wild-type (PMIR-3′UTR-W) and mutant-type (PMIR-3′UTRM) plasmids. We then evaluated the differential binding affinity of bta-miR-2898 with the two 3′-UTR types by performing a luciferase reporter assay. The results show that bta-miR-2898 reduced the luciferase reporter gene activity and has a higher binding affinity for the wild type 3′-UTR compared with the mutant type 3′-UTR (Fig. 2c), which is consistent with the computational prediction result. The results also demonstrated that bta-miR-2898 led to increased potency in the inhibiting luciferase activity © 2013 Stichting International Foundation for Animal Genetics, 45, 28–37

Regulatory mutations of the bovine A2M gene bta-miR-2898 has an important function associated with the A2M gene. The bta-miR-2898 expression was upregulated 6.25-fold in the mammary gland tissues of mastitis-infected cows compared with that in the healthy cow tissues (P < 0.05).

Gene expressions of various haplotypes of SNPs in the 5′-flanking and 3′-UTR regions The relative quantification in the mammary tissues was performed using RT-qPCR to illustrate the relationship between different haplotypes and A2M gene expression. The mammary gland tissues with the mutant haplotype (GAGA) of promoter SNPs showed a significantly (P < 0.05) higher A2M mRNA expression compared with those with the wild haplotype (AGC-) (Fig. 3a). The CC genotype CC mammary tissues showed a significantly lower (P < 0.05) A2M mRNA expression compared with that of the genotype – mammary gland tissues (Fig. 3b).

Relationships among SNP genotype, haplotype of A2M and milk SCS

Figure 2 Functional validation of bta-miR-2898 that binds to A2M 3′UTR and the effect of SNP c.4659_4661delC on binding affinity. (a) c.4659_4661delC polymorphism in the A2M 3′-UTR and the miR2898:mRNA interaction are shown. The altered allele is highlighted. (b) Computational modeling of the interaction between miR-2898 and 3′UTR that contains two genotypes was performed on RNAHYBRID software online. Bta-miR-2898-binding energy for the different alleles in the 3′UTR is shown. (c) Luciferase activity analysis in HEK 293T cells. Cells were transiently cotransfected with constructs and miR-2898 or scrambled with the negative control (miR-control) for 24 h. Firefly luciferase activity was normalized to Renilla luciferase activity. Data are from the three transfection experiments with assays performed in six replications. Wild-type: PMIR-3′UTR-W; Mutant-type: PMIR-3′UTRM. Vertical bars represent the means
SE of six replication experiments.

of the wild-type (PMIR-3′UTR-W) plasmid compared with that of the mutanttype PMIR-3′UTR-M plasmid.

Expression of bta-miR-2898 in the mammary gland tissues of healthy and mastitis-infected cows The bta-miR-2898 expression in mammary gland tissues was investigated using the RT-qPCR to understand whether © 2013 Stichting International Foundation for Animal Genetics, 45, 28–37

Somatic cell count is genetically positively correlated with clinical mastitis and considered an indicator for dairy mastitis (Koivula et al. 2005). To investigate whether or not the five SNPs were associated with mastitis in dairy cows, a genetic association analysis was performed between the genotypes, haplotypes and SCSs in 232 cows (Table 2). The cows with the homozygous wild-type genotype had significantly higher SCS than those with other genotypes (P < 0.05). Linkage disequilibrium tests showed that four SNPs of A2M 5′-flanking regions were completely linked in the detected Chinese Holstein cow population (Fig. 4). Moreover, five SNPs (g.-724A>G, g.-665G>A, g.-535C>G, g.-520_-519insA and c.4659_4661delC) were used for haplotype reconstruction, in which four haplotypes (H1, AGC–; H2, AGC-C; H3, GAGA- and H4, GAGAC) were found. Seven combined haplotypes (H1H1, H1H2, H1H3, H1H4, H2H2, H2H4 and H3H3) were found in the Chinese Holstein population, and their estimated frequencies of haplotype combination were 0.86%, 3.4%, 0.86%, 47.41%, 31.03%, 4.31% and 12.07% respectively (Table 3). The cows with the haplotype combination H1H2, H1H3 and H2H4 showed a significantly lower SCS (P < 0.05) than did the individuals with other haplotype combinations (Table 3).

Discussion In the present study, we initially validated that the 5′flanking region of bases g.-2641 to g.-1965 is one of the bovine A2M gene promoters. Based on the bioinformatics estimation for the sequence of bases g.-2641 to g.-1965, several putative transcription factor binding sites, such as AP-1, E2F, Sp1, NKx-2.5, GATA, and TATA box motif,

33

Wang et al.

Relative quantity

(a) 0.006

P = 0.0457

0.005 0.004 0.003 0.002 0.001 0

Wild type

(b) 0.006 Relative quantity

34

Mutant type

P = 0.0485

0.005 0.004 0.003 0.002 0.001 0

Wild type

Mutant type

Figure 3 . Relative expression of A2M mRNA in the mammary gland tissues of wild- and mutant-type cows. (a) Relative mRNA levels between haplotype AGC- and GAGA were determined using RT-qPCR. Wild-type: haplotype AGC-. Mutant-type: haplotype GAGA. (b) Relative mRNA levels between genotype CC and – were determined using RT-qPCR. Wild-type: genotype CC. Mutant-type: genotype –. Vertical bars represent SE.

were identified. We subsequently delimited the A2M minimal promoter to a 163-bp region (bases g.-2641 to g.2479). Considering that the pGL3-2641 construct represents a higher luciferase activity than does the pGL3-2479 construct, E2F, AP-1 and TATA box from the region that contains bases g.-2641 to g.-2479 may be the positive/

negative regulators, which may be the keys to the constitutive activity of the bovine A2M promoter. By comparing the activities of the pGL3-2229 and pGL3-2077 constructs, the region between bases g.-2229 and g.-2077 possibly contains positive regulatory elements. Software predictions revealed that AP-1 and Sp1 binding sites are found in this region. Sp1 is a member of the Sp family of transcription factor binding sites that promotes the transcription of several genes (Suske 1999). Further experiments should be performed to confirm the functions of these elements involved in the regulation of the A2M promoter activity. Three other predicted promoters of the bovine A2M gene would be confirmed in the next experiment. The susceptibility to pathogenic bacteria among the cows is partly attributed to mutations of immune function-related genes (Smirnova et al. 2000; Michel et al. 2003). We sequenced the A2M gene 5′-flanking sequence and detected four complete linkage SNPs (g.-724A>G, g.-665G>A, g.-535C>G and g.-520_-519insA) located in the promoter region, which caused a 177% increase in the transcription activity. Among these complete linkage SNPs, the g.-724A>G mutation created a putative NKx-2.5 transcription factor binding site. Studies have shown that NKx-2.5 can bind to its response element in the gene promoter to induce gene expression and the NKx-2.5 mutation can affect the gene promoter activity (Small & Krieg 2003; Ferdous et al. 2009). However, the g.-520_-519insA mutation formed a putative C/EBPb-binding site, which is involved in activating gene transcription and diseases (Chen et al. 2005). Other approaches are necessary to assess the effects of four SNPs on the transcription factor binding sites. In addition, RT-qPCR analysis was performed to examine the effect of the four polymorphisms on A2M

Table 2 Association analysis between different genotypes and somatic cell scores (SCSs) in Chinese Holstein cattle.

SNP

Genotype

Sample number

Genotypic frequencies (%)

Allelic frequencies (%)

g.-724A>G

AA AG GG

82 122 28

35.3 52.6 1.21

61.6 (A)

GG GA AA

82 122 28

35.3 52.6 1.21

61.6 (A)

CC CG GG

82 122 28

35.3 52.6 1.21

61.6 (G)

– /-A AA

82 122 28

35.3 52.6 1.21

61.6 (C)

CC C–

82 118 32

35.3 50.9 13.8

64.7 (C)

g.-665G>A

g.-535C>G

g.-520_-519insA

c.4659_4661delC

38.4 (G)

38.4 (G)

38.4 (A)

38.4 (A)

35.3 (-)

SCS 4.74
0.26a 4.62
0.26a 4.10
0.33b 4.74
0.26a 4.62
0.26a 4.10
0.33b 4.74
0.26a 4.62
0.26a 4.10
0.33b 4.74
0.26a 4.62
0.26a 4.10
0.33b 4.74
0.26a 4.63
0.26a 4.09
0.32b

Least square means indicated by different small letter superscripts within the same column differ significantly (P < 0.05). © 2013 Stichting International Foundation for Animal Genetics, 45, 28–37

Regulatory mutations of the bovine A2M gene

1

g.-665G>A

100

100 90

2

3

100 90

4

+1 ATG

g.-535C>G

100 90

5’ Flanking region

100 100

5’

g.-724A>G

A2M g.- 520_-519insA

90 c.4659_4661delC

3’ UTR

5

3’ Figure 4 Linkage disequilibrium (LD) tests for five SNPs in the A2M gene. Blank box represents the region from the translation start codon (ATG) to the stop codon. Black box represents A2M 5′-flanking region. Gray box represents the 3′-non-coding untranslated region (UTR). The icons on the left panel represent D’. LD relationship between each two SNPs was analyzed by SHESIS software. The D’ value for the comparison of the two SNPs is shown in white numbers.

Table 3 Association analysis between different the haplotype combinations and somatic cell scores (SCSs) in Chinese Holstein cows.

Haplotype combination

Sample number

Frequencies of haplotype combinations (%)

SCS

H1H1 H1H2 H1H3 H1H4 H2H2 H2H4 H3H3

2 8 2 110 72 10 28

0.86 3.4 0.86 47.41 31.03 4.31 12.07

3.94
0.57 3.88
0.51b 3.89
0.56 4.74
0.36a 4.88
0.36a 3.88
0.46b 4.61
0.32a

H1, AGC–; H2, AGC-C; H3, GAGA; H4, GAGAC. Frequency < 0.03 haplotype has been dropped. Least square means with different small letter superscripts within the same column differ significantly (P < 0.05).

mRNA expression between wild- and mutant-type mammary gland tissues of cows. As expected, the cows with mutant-type mammary gland tissues revealed a relatively high A2M mRNA expression compared with those with wild-type tissues. However, we did not negate other relevant elements that influence the A2M mRNA expression. Thus, the four SNPs may have important functions on the transcription levels of the A2M gene. miRNAs are non-coding RNAs that control gene expression at the post-transcriptional level and regulate homoeostasis of the immune system (Kan et al. 2012). Recent evidence also showed that alteration of miRNA © 2013 Stichting International Foundation for Animal Genetics, 45, 28–37

expression may be involved in immune-mediated diseases and immune function regulation (Sonkoly & St
ahle 2008). miRNAs regulate gene expression by binding to the 3′-UTR of the target gene transcript. Variants, such as SNPs in miRNA regulatory regions, may result in altered mRNA or protein levels and diseases. The seed region of miRNAs (nucleotides 2–7 of the 5′-end) is considered one of the most important regions in mRNA-targeting efficacy (Bartel 2009). In particular, miRNAs require almost perfect complementarity at the seed sites to bind and to reduce the protein levels of the targets (Brennecke et al. 2005). However, several reports have shown that SNPs in the no-seed sequence of miRNA also may affect the miRNA-binding ability (Luo et al. 2012; Zhang et al. 2012). In this study, the results suggested that the bovine A2M gene is a target for bta-miR-2898. Although the c.4659_4661delC SNP that occurred in the no-seed region of the bta-miR-2898 binding sites was found based on bioinformatics prediction, further transfection experiment in vitro confirmed that the SNP altered its binding affinity. We also found that bta-miR-2898 expression was significantly up-regulated in the mammary gland tissues of mastitisinfected cows compared with the healthy tissues. These data indicated that the altered bta-miR-2898 binding to the A2M 3′-UTR can participate in the regulation of the A2M expression and may be further involved in the immune function on mastitis susceptibility in dairy cattle. The A2M mRNA expression in the mammary gland tissues with different genotypes also supported this result. Although many phenotypes are modulated by stochastic or environmental effects, subjects with functional SNPs often cause phenotype variation (Dr€ ogem€ uller et al. 2011). Among these SNPs, 3′-UTR and 5′-promoter polymorphisms of the regulatory regions are likely associated with various human diseases (Colombo et al. 2011; Dasgupta et al. 2012). Mastitis is characterized by an influx of somatic cells into the mammary glands of dairy cattle, and SCC is a positive indicator of mastitis (Suske 1999). We suggest that the five SNPs in the regulatory regions can influence the function of A2M in bovine mastitis. To analyze the function of the five SNPs, an association analysis between haplotypes and SCS in dairy cattle was performed by detecting functional SNPs in the host response against bovine mastitis. The results showed that the haplotype combination H1H2, H1H3 and H2H4 was significantly associated with decreased SCS. In conclusion, reporter gene experiments were used to delimitate the A2M minimal promoter region and identify four complete linkages as well as functional SNPs in the 5′-flanking region. Software prediction and transfection experiment revealed that bta-miR-2898 can bind to the A2M 3′-UTR and that a SNP (c.4659_4661delC) located within the miRNA-binding sites affects binding affinity. Furthermore, the association analysis between haplotypes and SCS showed that the cows with haplotype combination H1H2, H1H3 and H2H4 were favorable to resistance in

35

36

Wang et al. cows and may be considered as genetic markers and, thus, may be beneficial to the breeding of mastitis-resistant cows in the future. Acting as a broad-spectrum protease-binding protein, A2M is involved in the predominant defense mechanism against host and pathogens that inactivates both endogenous and exogenous proteases (Armstrong 2006). Bovine mastitis, an inflammation of the mammary glands, is the most common complex disease causing large losses in dairy farming (Seegers et al. 2003). A2M, as a kind of protease inhibitor, may play important roles in bovine mastitis, preventing the invasion and host mammary gland destruction caused by the protease virulence factors of pathogens. Gene promoter and miRNA regulation act as crucial parts at the transcriptional level and post-transcriptional level respectively. As expected, four SNPs in the promoter were found that affected its activity, and a SNP in the 3′-UTR influences the binding activity of bovine A2M and bta-miR2898. We revealed that these SNPs affect the expression and the function activity of the A2M gene. We also conducted an association analysis between five SNPs and cows’ milk SCSs and found that four haplotype combinations have lower SCSs, which can be used in breeding of mastitis-resistant cows. These experiments provided the basis for further studies to elucidate the complex molecular mechanisms of A2M gene expression regulation.

Acknowledgements This study was supported by grants from the National Natural Science Foundation of China (31271328 and 31000543), the Support Program of the Ministry of Science and Technology, China (2011BAD19B02 and 2011BAD19B04), the Major Project of National Transgene in China (2013ZX08007-001) and the Program of National Cow Industrial Technology System (CARS-37).

References Amin A.S., Giudicessi J.R., Tijsen A.J. et al. (2012) Variants in the 3′ untranslated region of the KCNQ1-encoded Kv7.1 potassium channel modify disease severity in patients with type 1 long QT syndrome in an allele-specific manner. European Heart Journal 33, 714–23. Armstrong P.B. (2006) Proteases and protease inhibitors: a balance of activities in host-pathogen interaction. Immunobiology 211, 263–81. Armstrong P.B. & Quigley J.P. (1999) Alpha2-macroglobulin: an evolutionarily conserved arm of the innate immune system. Developmental and Comparative Immunology 23, 375–90. Banks R.E., Evans S.W., Van Leuven F., Alexander D., McMahon M.J. & Whicher J.T. (1990) Measurement of the ‘fast’ or complexed form of alpha 2-macroglobulin in biological fluids using a sandwich enzyme immunoassay. Journal of Immunological Methods 126, 13–20.

Bartel D.P.; MicroRNAs (2009) Target recognition and regulatory functions. Cell 136, 215–33. Bonacci G.R., Caceres L.C., Sanchez M.C. & Chiabrando G.A. (2007) Activated alpha(2)-macroglobulin induces cell proliferation and mitogen-activated protein kinase activation by LRP-1 in the J774 macrophage-derived cell line. Archives of Biochemistry and Biophysics 460, 100–6. Brennecke J., Stark A., Russell R. & Cohen S. (2005) Principles of microRNA-target recognition. PLoS Biology 3, 404–18. Chen J.Y., Wang C.M., Ma C.C., Chow Y.H. & Luo S.F. (2005) The -844C/T polymorphism in the Fas ligand promoter associates with Taiwanese SLE. Genes and Immunity 6, 123–8. Colombo F., Falvella F.S., Galvan A., Frullanti E., Kunitoh H., Ushijima T. & Dragani T.A. (2011) A 5′-region polymorphism modulates promoter activity of the tumor suppressor gene MFSD2A. Molecular Cancer 10, 81. Dasgupta S., Pal P., Mukhopadhyay N.D., Fu Y., Ratovitski E.A., Moon C.S., Hoque M.O., Fisher P.B. & Trink B. (2012) A single nucleotide polymorphism in the human PIGK gene associates with low PIGK expression in colorectal cancer patients. International Journal of Oncology 41, 1405–10. Dr€ ogem€ uller C., Reichart U., Seuberlich T. et al. (2011) An unusual splice defect in the mitofusin 2 gene (MFN2) is associated with degenerative axonopathy in Tyrolean Grey cattle. PLoS One 6, e18931. Enghild J.J., Salvesen G., Thøgersen I.B. & Pizzo S.V. (1989) Proteinase binding and inhibition by the monomeric alphamacroglobulin rat alpha 1-inhibitor-3. Journal of Biological Chemistry 264, 11428–35. Ferdous A., Caprioli A., Iacovino M. et al. (2009) Nkx2-5 transactivates the Ets-related protein 71 gene and specifies an endothelial/endocardial fate in the developing embryo. Proceedings of the National Academy of Sciences of the United States of America 106, 814–19. Filipowicz W., Bhattacharyya S.N. & Sonenberg N. (2008) Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nature Reviews Genetics 9, 102–14. Georges M., Clop A., Marcq F. et al. (2006) Polymorphic microRNA-target interactions: a novel source of phenotypic variation. Cold Spring Harbor Symposia on Quantitative Biology 71, 343–50. Gruber J.D., Vogel K., Kalay G. & Wittkopp P.J. (2012) Contrasting properties of gene-specific regulatory, coding, and copy number mutations in Saccharomyces cerevisiae: frequency, effects, and dominance. PLoS Genetics 8, e1002497. doi:10.1371/journal. pgen.1002497. Huang J.M., Wang H.M., Wang C.F., Li J.B., Li Q.L., Hou M.H. & Zhong J.F. (2010) Single nucleotide polymorphisms, haplotypes and combined genotypes of lactoferrin gene and their associations with mastitis in Chinese Holstein cattle. Molecular Biology Reports 37, 477–83. Huang J.M., Ju Z.H., Li Q.L. et al. (2011) Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle. International Journal of Biological Sciences 7, 1016–26. Kan A.A., van Erp S., Derijck A.A. et al. (2012) Genome-wide microRNA profiling of human temporal lobe epilepsy identifies modulators of the immune response. Cellular and Molecular Life Sciences 69, 3127–45.

© 2013 Stichting International Foundation for Animal Genetics, 45, 28–37

Regulatory mutations of the bovine A2M gene King M.C. & Wilson A.C. (1975) Evolution at two levels in humans and chimpanzees. Science 188, 107–16. Koivula M., M€ antysaari E.A., Negussie E. & Serenius T. (2005) Genetic and phenotypic relationships among milk yield and somatic cell count before and after clinical mastitis. Journal of Dairy Science 88, 827–33. Levashina E.A., Moita L.F., Blandin S., Vriend G., Lagueux M. & Kafatos F.C. (2001) Conserved role of a complement-like protein in phagocytosis revealed by dsRNA knockout in cultured cells of the mosquito, Anopheles gambiae. Cell 104, 709–18. Li Z., Zhang Z., He Z., Tang W., Li T., Zeng Z., He L. & Shi Y. (2009) A partition-ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: update of the SHESIS. Cell Research 19, 519–23. Li L., Huang J., Zhang X. et al. (2012) One SNP in the 3′-UTR of HMGB1 gene affects the binding of target bta-miR-223 and is involved in mastitis in dairy cattle. Immunogenetics 64, 817–24. Luo J., Cai Q., Wang W. et al. (2012) A microRNA-7 binding site polymorphism in HOXB5 leads to differential gene expression in bladder cancer. PLoS One 7, e40127. Mason C. (2006) Basic mastitis bacteriology: untangling the pathogens. Irish Veterinary Journal 59, 453–9. Michel O., LeVan T.D., Stern D. et al. (2003) Systemic responsiveness to lipopolysaccharide and polymorphisms in the toll-like receptor 4 gene in human beings. The Journal of Allergy and Clinical Immunology 112, 923–9. Nicoloso M.S., Sun H., Spizzo R. et al. (2010) Single-nucleotide polymorphisms inside microRNA target sites influence tumor susceptibility. Cancer Research 70, 2789–98. Poletto V., Rosti V., Villani L. et al. (2012) A3669G polymorphism of glucocorticoid receptor is a susceptibility allele for primary myelofibrosis and contributes to phenotypic diversity and blast transformation. Blood 120, 3112–17. Saeij J.P., de V.B. & Wiegertjes G.F. (2003) The immune response of carp to Trypanoplasma borreli: kinetics of immune gene expression and polyclonal lymphocyte activation. Developmental and Comparative Immunology 27, 859–74. Saeki M., Kurose K., Hasegawa R. & Tohkin M. (2011) Functional analysis of genetic variations in the 5′-flanking region of the human MDR1 gene. Molecular Genetics and Metabolism 102, 91–8. Seegers H., Fourichon C. & Beaudeau F. (2003) Production effects related to mastitis and mastitis economics in dairy cattle herds. Veterinary Research 34, 475–91. Small E.M. & Krieg P.A (2003) Transgenic analysis of the atrial natriuretic factor (ANF) promoter. Nkx2-5 and GATA-4 binding

© 2013 Stichting International Foundation for Animal Genetics, 45, 28–37

sites are required for atrial specific expression of ANF. Developmental Biology 261, 116–31. Smirnova I., Poltorak A., Chan E.K., McBride C. & Beutler B. (2000) Phylogenetic variation and polymorphism at the toll-like receptor 4 locus (TLR-4). Genome Biology 1, RESEARCH002. Sonkoly E., St
ahle M. & Pivarcsi A. (2008) MicroRNAs immunity: novel players in the regulation of normal immune function and inflammation. Seminars in Cancer Biology 18, 131–40. Sottrup-Jensen L. (1989) Alpha-macroglobulins: structure, shape, and mechanism of proteinase complex formation. The Journal of Biological Chemistry 264, 11539–42. Suske G. (1999) The Sp-family of transcription factors. Gene 238, 291–300. Thomas L.F., Saito T. & Sætrom P. (2011) Inferring causative variants in microRNA target sites. Nucleic Acids Research 39, e109. Wang C., Guo Z., Wu C., Li Y. & Kang S. (2012a) A polymorphism at the miR-502 binding site in the 3′ untranslated region of the SET8 gene is associated with the risk of epithelial ovarian cancer. Cancer Genet 205, 373–6. Wang X., Huang J., Zhao L. et al. (2012b) The exon 29 c.3535A>T in the alpha-2-macroglobulin gene causing aberrant splice variants is associated with mastitis in dairy cattle. Immunogenetics 64, 807–16. Zhang S., Chen H., Zhao X., Cao J., Tong J., Lu J., Wu W., Shen H., Wei Q. & Lu D. (2012) REV3L 3′UTR 460 T>C polymorphism in microRNA target sites contributes to lung cancer susceptibility. Oncogene 32, 242–50. Zuo W. & Woo P.T.K. (1997) Natural anti-proteases in rainbow trout, Oncorhynchus mykiss and brook charr, Salvelinus fontinalis and the in vitro neutralization of fish alpha 2-macroglobulin by the metalloprotease from the pathogenic haemoflagellate, Cryptobia salmositica. Parasitology 114, 375–81.

Supporting information Additional supporting information may be found in the online version of this article. Figure S1. Promoter regions of the A2M gene were predicted by two programs. Figure S2. Sequencing analysis for the 5′ flanking region of the bovine A2M gene. Figure S3. Putative functional elements in the promoter of A2M and alterations of transcription binding sites in the four SNPs of the bovine A2M gene.

37