k.) 1991
Oxford University Press
Nucleic Acids Research, Vol. 19, No. 24 6983
Rsal polymorphism of the human growth hormone gene (GH1)
PCR-based detection of two MspI polymorphic sites at D18S8
J.Oriola, R.Casamitjana, N.Nogues, R.Pages, M.Romerol and F. Rivera-Fillat Servei d' Hormonologia and 1Servei d'Immunologia, Hospital Cli(nic, Villarroel 170, 08036, Barcelona, Spain
P.J.Parry, D.Markiel, E.R.Fearon2, J.M.Nigro2, B.Vogelstein2 and W.F.Bodmer1 Department of Clinical Genetics, Royal Free School of Medicine, Hampstead, London NW6 2QG, 'Imperial Cancer Research Fund, 44 Lincolns Inn Fields, London, WC2A 3PX, UK and 2The Oncology Center, The Johns Hopkins University School of Medicine, Baltimore, MD, USA
We report a method to analyze a RsaI polymorphism within the human growth hormone promoter gene using the polymerase
chain reaction. PCR Primers: The primer sequences corresponded to both normal human growth hormone gene (GH1) and the variable human growth hormone gene (GH2), including their promoter regions. 5' AGAGAGGCAAAGTTGGGTGGTA 3' sense oligo antisense oligo 5' GGTCACAGGGATGCCACC 3' Polymorphism: The digestion with RsaI (GTAC) produces various fragments proceeding from the two amplified genes. Two of the fragments are very similar in the number of base pairs, therefore a second digestion with BglII (AGATCT) is necessary to be able to differentiate them. BglII is not polymorphic in this region. The polymorphic fragments obtained are from GH 1 and are GI = 1080 bp + 178 bp and G2 = 1258 bp. Constant fragments: (GH1) - 283 bp, 191 bp, 75 bp and (GH2) - 898 bp, 728 bp, 191 bp. Fragments