Journal of Dairy Research, Page 1 of 8. doi:10.1017/S0022029915000047
© Proprietors of Journal of Dairy Research 2015
1
The sheep growth hormone gene polymorphism and its effects on milk traits Maria Luisa Dettori1*, Michele Pazzola1, Emanuela Pira1, Pietro Paschino1 and Giuseppe Massimo Vacca1,2 1 2
Dipartimento di Medicina Veterinaria, Università degli Studi di Sassari, via Vienna, 2 07100 Sassari, Italy Centro di Competenza Biodiversità Animale, viale Adua 2C, 07100 Sassari, Italy
Received 4 September 2014; accepted for publication 5 November 2014
Growth hormone (GH) is encoded by the GH gene, which may be single copy or duplicate in sheep. The two copies of the sheep GH gene (GH1/GH2-N and GH2-Z) were entirely sequenced in one 106 ewes of Sarda breed, in order to highlight sequence polymorphisms and investigate possible association between genetic variants and milk traits. Milk traits included milk yield, fat, protein, casein and lactose percentage. We evidenced 75 nucleotide changes. Transcription factor binding site prediction revealed two sequences potentially recognised by the pituitary-specific transcription factor POU1FI at the GH1/GH2-N gene, which were lost at the promoter of GH2-Z, which might explain the different tissues of expression of GH1/GH2-N (pituitary) and GH2-Z (placenta). Significant differences in milk traits were observed among genotypes at polymorphic loci only for the GH2-Z gene. Sheep with homozygote genotype ss748770547 CC had higher fat percentage (P < 0·01) than TT. SNP ss748770547 was part of a potential transcription factor binding site for C/EBP alpha (CCAAT/Enhancer Binding Protein), which is involved in the regulation of adipogenesis and adipoblast differentiation. SNP ss748770547, located in the GH2-Z gene 5′ flanking region, may be a causal mutation affecting milk fat content. These findings might contribute to the knowledge of the sheep GH locus and might be useful in selection processes in sheep. Keywords: Sheep milk, Sarda sheep breed, growth hormone gene, sheep GH gene, duplicate GH gene.
Growth hormone (GH) is encoded by the GH gene belonging to the growth hormone-prolactin gene family: prolactin (PRL) and GH are hormones/cytokines, which coordinate a wide range of biological processes in vertebrates (Vijayakumar et al. 2010). GH promotes somatic growth, influencing muscle and bone metabolism and lactation (Giustina & Veldhuis, 1998) and, in sheep, it is involved in the response to stress (Carcangiu et al. 2008). The PRL and GH gene family is characterised by species-specific gene expansion probably due to gene duplication and natural selection (Otha, 1993). The human genome contains a cluster of five GH genes, while cattle have only one (bovine GH, bGH), and sheep (ovine GH, oGH) (as well as goats) display a copy number variant (CNV) polymorphism, with the Gh1 allele carrying the only GH1 copy and the Gh2 duplicate allele carrying the GH2-N and GH2-Z gene copies, separated by a 3·5 kb long DNA intercopy region (Valinsky et al. 1990). The sheep GH locus was mapped to chromosome 11q25 and has
*For correspondence; e-mail: [email protected]
5 exons spanning approximately 2 kb for the Gh1 allele and 7·5 kb for the duplicate Gh2 allele (Ofir & Gootwine, 1997). The products of the two sheep GH gene copies show different biological properties and differ in their receptor-binding ability (Reicher et al. 2008) and in stage and organ of expression: GH1/GH2-N is expressed in the pituitary, while GH2-Z is expressed in the placenta (Lacroix et al. 1996; Gootwine, 2004). Sheep GH1, GH2-N and GH2-Z genes share the same nucleotide sequence, except for nucleotide (nt) variations which do not represent a distinctive feature. The only element that allows distinguishing GH1/GH2-N from GH2-Z is a segment of the promoter region of GH2-Z, which is included in the intercopy region (Marques et al. 2006). Genetic variants at the GH locus were reported to affect milk productions in cattle (Dybus et al. 2004), growth rate (An et al. 2010) and milk yield (Malveiro et al. 2001; Dettori et al. 2013) in goats, milk yield in Serra da Estrela (Marques et al. 2006) and Sarda ewes (Vacca et al. 2013). Sequences of the complete GH1 (GenBank accession number: DQ450146-DQ450147), GH2-N (GenBank: DQ461644-DQ461681) and GH2-Z (GenBank: DQ461615-DQ461643) gene copies have been
2
ML Dettori and others
Table 1. Oligonucleotides utilised for PCR amplification and sequencing, at the sheep GH locus Primer name
Primer sequence (5′−3′)
Reference
GHTF GHTR GH2ZF GH2ZR RTGH2F RTGH2R GH4F RTGH3R RTGH4R RTGH5F
CCAGAGAAGGAACGGGAACAGGATGAG ATAGAGCCCACAGCACCCCTGCTATTG TGGCTACACCTCTTCCTGCTTTCTGG GGAGGAACCGGGTCAATTAT TGCCCTGGACTCAGGTG GACACATCTCTGGGGAGCTT CTGCCAGCAGGACTTGGAGC GTCCTAGGTGGCCACTCACT CTCCAGGTCCTTCAGCTTCT GCAGATCCTCAAGCAGACCT
Marques et al. 2006
reported for the Serra da Estrela sheep, revealing several polymorphic sites (Marques et al. 2006; Marques, 2007). In this research we separately amplified, by PCR, the two copies of the sheep duplicate GH gene, which differ only in terms of their 5′ flanking regions. Then each gene copy was completely sequenced in all the sheep of the experiment. Analysis of the sequencing traces revealed polymorphisms occurring in each copy, and the relationship between polymorphisms and milk traits was evaluated. The Sarda sheep breed is autochthonous to the island of Sardinia, where about 3 million head are reared and it is the most important Italian dairy sheep breed (Vacca et al. 2008). Owing to its high production and rusticity and adaptability to Mediterranean climate characteristics (Carcangiu et al. 2011), it has spread to other Italian regions and to several North African Countries, where it is reared either as purebred or crossbred (Vacca et al. 2010). In the present investigation, the GH1/GH2-N and GH2-Z gene copies were entirely sequenced in a population of Sarda breed sheep (Ovis aries), in order to highlight sequence polymorphisms and evaluate association between genetic variants at the GH1/GH2-N and GH2-Z gene copies and milk traits. Materials and methods Animals and samples One-hundred-and-six clinically healthy multiparous ewes of Sarda breed, aged 4 years, in their third lactation, were randomly selected from four commercial farms showing similar management and feeding systems, located on the island of Sardinia (Italy). Daily milk yield was recorded from each sheep of the experiment once a month, from February to June which corresponds to different stages of the milking period after lambs’ weaning according to ICAR guidelines (ICAR, 2012), measured as days in milk (DIM) from 15 ± 3 to 135 ± 3 d (15, 45, 75, 105 and 135 DIM). Individual milk samples were taken for milk analysis and individual blood samples were taken for DNA extraction. Milk was collected by hand milking. Approximately 5 ml of blood was collected by puncture via the jugular vein with only physical restraint. Blood samples were taken solely for
Vacca et al. 2013 This paper This paper Marques et al. 2006 This paper This paper This paper
research purposes and experienced veterinarians performed blood collection and all efforts were made to minimise suffering. No specific permission to an animal ethics committee was required for these locations and activities, because according to Article 2 of the EC Directive 86/609/EEC, none of the procedures used here met the criteria to be defined as experiments, then specific approval was not necessary. Milk analysis Milk traits recorded included milk yield; protein, fat and lactose percentage, determined by infrared spectrophotometer (Milko-Scan 133B; Foss Electric, DK-3400 Hillerød, Denmark) (IDF Standard No 141C, 2000); casein content (IDF Standard No 29, 1964); milk energy, estimated on the bases of calories provided by total solid components (National Research Council, 2007). DNA analysis DNA was obtained from leucocytes using a commercial kit (NucleoSpin Blood, Macherey-Nagel). DNA concentration and purity were measured by spectrophotometer (Eppendorf Biophotometer, Hamburg, Germany). The GH1/GH2-N gene was amplified by polymerase chain reaction (PCR) with the primer pair GHTF/GHTR (Marques et al. 2006) to produce a DNA fragment of about 2·05 kb, and the GH2-Z gene was amplified with the primer pair GH2ZF/GH2ZR to give a fragment of about 2·22 kb (Vacca et al. 2013) (Table 1). The two gene copies were analysed by Sanger sequencing in all the animals of the experiment, in the forward direction. Sequencing oligonucleotides were designed with the Primer3Plus software (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus. cgi/) based on GenBank: DQ450546 and DQ461643 (Table 1). Prior to sequencing, amplicons were purified with Agencourt® AMPure® kit (Beckman Coulter, USA), then sequencing was obtained with an Applied Biosystems 3730 DNA Analyser (Applied Biosystems, Foster City CA, USA). To test the quality of sequencing reactions, about 15% of the samples were also sequenced in the reverse direction, as well as those subjects who showed a heterozygous insertion/deletion (indel), and thus alteration of the sequencing reaction downstream of it.
Sheep GH gene effects on milk traits Analysis of the sequencing data The Phred/Phrap/Crossmatch softwares were used to compute data quality information from chromatogram files and to construct contig sequences (Ewing & Green, 1998; Ewing et al. 1998). PolyPhred was used to compare sequence traces and search for homozygotes and heterozygotes in these contigs (Nickerson et al. 1997; Bhangale et al. 2006). PolyPhred polymorphism tags were examined using Consed for each putative SNP (Gordon et al. 1998; 2001; Gordon, 2004). Sequence polymorphisms were described according to the Human Genome Variation Society (http://www.hgvs.org/mutnomen/). The Haploview software package (Barrett et al. 2005) was used to estimate minor allele frequency (MAF), observed and expected heterozygosity, and to test genotype distributions for departure from Hardy-Weinberg equilibrium at each polymorphic locus. The Alibaba (v.2·1) software and the TRANSFAC (v.7·0) database (http://www.gene-regulation.com/pub/programs/ alibaba2) were used to find motifs in promoter regions. Nucleotide sequences were translated into amino acids using ExPASy Bioinformatics Resource Portal (http://www. expasy.org/) and compared with the translated amino acid sequence of GenBank: DQ450146 (GH1) and GenBank: DQ461643 (GH2-Z). Association analysis Association analysis between the SNPs at GH1/GH2-N and GH2-Z and milk traits (milk yield, protein, fat, casein and lactose percentages and energy) was performed with the SAS Software (SAS Inst. Inc., Cary NC, USA) using the mixed effect model procedure and the following model: yijkl ¼ μ þ Hi þ DIMj þ Gk þ H × DIMij þ al ðGk Þ þ eijkl where yijkl is the analysed variable, μ is the general mean, Hi is the fixed effect of the herd (i = 4 levels), DIMj is the fixed effect of the stage of milking measured as days after lambs’ weaning ( j = 5 levels 15, 45, 75, 105 and 135 DIM), Gk is the fixed effect of genotype at each SNP (k = 2 or 3 levels), H × DIMij is the interaction effect between the herd and the stage of lactation, al(Gi) is the random effect of lth animal nested within the kth genotype and eijkl is the error effect. Because of the low frequency of some genotypes and the resulting rank deficiency in contingency tables, each SNP was analysed at a time. In order to avoid a bias of results, SNPs with MAF A c.−119 T > C c.−118 G > A c.−39 C > T c.−19 T > A c.−15 G > A c.13 + 49 C > T c.13 + 95 C > T c.13 + 99 T > C c.13 + 105 T > C c.13 + 120 G > A c.14 − 122_14 − 121 ins A c.14 − 99 G > A c.14 − 71_14 − 70 ins G c.59 C > T c.174 + 50 del A c.174 + 54 C > T c.174 + 72 T > C c.174 + 115 G > A c.175 − 97 del T c.175 − 96 A > G c.175 − 92 A > G c.175 − 41 C > A c.179 G > A c.255 G > A c.292 − 30 A > G c.292 − 22 G > C c.453 + 12 A > G c.453 + 35 A > G c.453 + 84 T > G c.454 − 102 C > T c.454 − 12 C > T c.*30 del T c.*53 G > T c.*90 C > T c.*101 C > G c.*110 T > G c.*120 C > G c.*148 G > A c.*149 G > C c.*156 C > T
5′flanking
— T/(C) G/(A) C/(T) T/(A) G/(A) C/(T) C/(T) T/(C) T/(C) G/(A) (A)/_ (G)/A (G)/_ C/(T) A/(_) C/(T) T/(C) G/(A) T/(_) A/(G) A/(G) C/(A) G/(A) (G)/A A/(G) G/(C) A/(G) A/(G) T/(G) C/(T) C/(T) (T)/_ G/(T) C/(T) C/(G) (T)/G (C)/G (G)/A G/(C) C/(T)
— 0·04 0·03 0·07 0·05 0·06 0·20 0·06 0·06 0·06 0·06 0·12 0·45 0·01 0·07 0·17 0·05 0·05 0·05 0·06 0·09 0·01 0·05 0·02 0·06 0·15 0·17 0·16 0·16 0·05 0·05 0·04 0·10 0·03 0·03 0·03 0·0 0·0 0·01 0·20 0·03
— 0·09 0·05 0·10 0·07 0·09 0·32 0·11 0·11 0·11 0·11 0·21 0·52 0·03 0·01 0·28 0·07 0·07 0·07 0·11 0·17 0·02 0·06 0·05 0·08 — 0·31 0·27 0·27 0·08 0·09 0·08 0·16 0·05 0·06 0·06 0·0 0·0 0·01 0·31 0·05
— 0·08 0·05 014 0·09 0·11 0·32 0·11 0·11 0·11 0·11 0·21 0·50 0·03 0·01 0·28 0·10 0·10 0·10 0·11 0·16 0·02 0·09 0·05 0·11 — 0·28 0·26 0·26 0·10 0·09 0·08 0·18 0·05 0·06 0·06 0·0 0·0 0·01 0·32 0·05
— 1·0 1·0 1·10 0·33 0·42 1·0 1·0 1·0 1·0 1·0 1·0 0·88 1·0 1·0 1·0 0·29 0·29 0·29 1·0 1·0 1·0 0·23 1·0 0·32 1·0 0·76 1·0 1·0 0·42 1·0 1·0 0·48 1·0 1·0 1·0 1·0 1·0 1·0 0·99 1·0
5′UTR
Intron-1
Exon-2 Intron-2
Exon-3 Intron-3 Intron-4
3′UTR 3′flanking
Polymorphic sites shared by the GH1/GH2-N and GH2-Z gene copies are shown in bold type. SNP ID, submitted SNP accession number from the dbSNP database; DQ450146, nucleotide positions relative to GenBank DQ450146 (GH1); X12546, nucleotide positions related to GenBank X12546; MAF, minor allele frequency; Ho, observed heterozygosity; He, expected heterozygosity; HWpval, Hardy Weinberg P value †Variations already described in Vacca et al. (2013) ‡Variations already described in Marques et al. (2006) §Variations already described in Marques (2007) ¶Single nucleotide deletion ††Rare allele in brackets
stage or tissue of expression, as well as its functions, having an impact on production traits. No homozygote Gh1 subjects were found in the study population, while 1·14% Gh1/Gh1 subjects have been reported for the Serra da Estrela sheep (Marques et al. 2006). Also the Texel sheep, utilised for the sheep genome reference sequence, carries the Gh1 allele, mapped to chromosome 11, GenBank: NC_019468·1 (47540064.47541799, complement) (International Sheep
Genomics Consortium et al. 2010). The Gh1 allele has been found to be associated with lower milk yield in the Serra da Estrela sheep (Marques et al. 2006), then this allele might have undergone negative selection in the Sarda sheep, which has been selected for many decades to improve milk production (Mura et al. 2012). A total of 72 polymorphic sites were evidenced at the GH1/GH2-N and GH2-Z genes, plus 3 monomorphic
Sheep GH gene effects on milk traits
5
Table 3. SNPs at the GH2-Z gene in Sarda sheep SNP ID
Nt position
X12546
Polymorphism
Gene gion
Allele††
MAF
Ho
He
HWpval
ss748770547 ss748770548 ss748770549 ss748770550 ss748770551 ss748770552 ss748770553 ss748770554 ss748770555 ss748770556 ss748770557 ss748770558 ss748770559 ss748770560 ss748770561 ss748770562 ss748770563 ss748770564 ss748770565 ss748770566 ss748770567 ss748770568 ss748770569 ss748770570 ss748770571 ss748770572 ss748770573 ss748770574 ss748770575 ss748770576 ss748770577 ss748770578 ss748770579 ss748770580
1130†§ 1220†§ 1357§ 1507§ 1578 1705 1715‡ 1783‡ 1857 1865 1868 1871_1872§¶ 1941§ 1958 1996§ 2007§ 2117 2127‡ 2170‡§ 2173 2455 2555 2556 2579 2621§ 2628§ 2774 2922†‡ 2966 3035†‡ 3049_3050†‡ 3100 3167 3168
— — 288 438 508 634 644 712 786 794 797 801 871 888 926 937 1047 1057 1100 1103 1385 1485 1486 1509 1551 1558 1704 1852 1896 1965 1980 2029 2097 2098
c.−259 T > C c.−169 C > G c.−32 C > T c.13 + 106 A > G c.14 − 72 C > T c.69 G > A c.79 G > A c.147 A > G c.174 + 47 A > G c.174 + 55 A > G c.174 + 58 A > C c.174 + 61_174 + 62 ins C c.174 + 131 A > G c.175 − 79 G > T c.175 − 41 A > C c.175 − 30 G > T c.255 A > G c.265 A > G c.291 + 17 A > G c.291 + 20 C > T c.364 G > A c.453 + 11 C > T c.453 + 12 G > A c.453 + 35 G > A c.453 + 77 C > T c.453 + 84 T > G c.454 − 46 G > A c.556 G > A c.600 G > A c.*15 C > T c.*29_30 insT c.*80 T > C c.*147 A > G c.*148 G > C
5′flanking
(T)/C C/(G) (C)/T (A)/G C/(T) G/(A) G/(A) A/(G) A/(G) (A)/G A/(C) (C)/_ A/(G) G/(T) (A)/C G/(T) (A)/G A/(G) A/(G) C/(T) G/(A) C/(T) G/(A) G/(A) C/(T) T/(G) G/(A) G/(A) G/(A) (C)/T (T)/_ (T)/C A/(G) G/(C)
0·36 0·35 0·11 0·14 0·07 0·17 0·16 0·11 0·07 0·13 0·17 0·20 0·07 0·05 0·16 0·11 0·18 0·09 0·09 0·02 0·05 0·01 0·0 0·03 0·16 0·13 0·18 0·03 0·01 0·12 0·18 0·04 0·04 0·21
0·37 0·36 0·17 0·21 0·13 0·34 0·19 0·19 0·05 0·09 0·14 0·24 0·04 0·05 0·17 0·14 0·24 0·06 0·03 0·03 0·07 0·02 0·0 0·06 0·23 0·17 0·23 0·04 0·01 0·22 0·29 0·0 0·06 0·28
0·46 0·46 0·19 0·24 0·12 0·28 0·27 0·19 0·13 0·23 0·28 0·32 0·12 0·09 0·27 0·20 0·29 0·16 0·16 0·03 0·09 0·02 0·0 0·06 0·26 0·22 0·29 0·06 0·01 0·21 0·29 0·08 0·08 0·33
0·07 0·05 0·58 0·51 1·0 0·08 0·03 1·0 0·00 0·00 0·00 0·03 0·00 0·01 0·01 0·08 0·27 0·00 0·00 1·0 0·34 1·0 1·0 1·0 0·36 0·08 0·09 0·15 1·0 1·0 1·0 0·00 0·20 0·29
5′UTR Intron-1 Exon-2
Intron-2
Exon-3 Intron-3 Exon-4 Intron-4
Exon-5 3′UTR
3′flanking
Polymorphic sites shared by the GH1/GH2-N and GH2-Z gene copies are reported in bold type. SNP ID, submitted SNP accession number from the dbSNP database; DQ461643, nucleotide positions relative to GenBank DQ461643 (GH2-Z); X12546, nucleotide positions in GenBank X12546; MAF, minor allele frequency; Ho, observed heterozygosity; He, expected heterozygosity; HWpval, Hardy Weinberg P value †Variations already described in Vacca et al. (2013) ‡Variations already described in Marques et al. (2006) §Variations already described in Marques (2007) ¶Single nucleotide deletion ††Rare allele in brackets
Table 4. Coding SNPs and putative amino acid changes at the Sarda sheep GH gene SNP ID
Polymorphism
Gene region
ss748770520 ss748770529 ss748770530 ss748770552 ss748770553 ss748770554 ss748770563 ss748770564 ss748770567 ss748770574 ss748770575
c.59 C > T c.179 G > A c.255 G > A c.69 G > A c.79 G > A c.147 A > G c.255 A > G c.265 A > G c.364 G > A c.556 G > A c.600 G > A
GH1/GH2-N GH1/GH2-N GH1/GH2-N GH2-Z GH2-Z GH2-Z GH2-Z GH2-Z GH2-Z GH2-Z GH2-Z
Putative aa change Exon-2 Exon-3 Exon-2
Exon-3 Exon-4 Exon-5
p.Pro20Leu p.Arg60His p.Pro85 p.Gln23 p.Ala27Thr p.Gln49 p.Pro85 p.Ser89Gly p.Val122Ile p.Gly186Ser p.Thr200
ML Dettori and others
6
Table 5. Analysis of variance (F values) showing the effects of herd (H), days in milking (DIM) and genotype (G) on milk traits SNP ss748770547 H DIM G SEM
ss748770553 H DIM G SEM
ss748770572 H DIM G SEM
Milk yield (g/d)
Fat (%)
Protein (%)
Casein (%)
Lactose (%)
Energy (MJ/kg)
22·71*** 26·62*** 2·81ns 11·60
3·29* 112·9*** 8·27*** 0·06
12·76*** 4·45** 2·50ns 0·03
17·00*** 12·87*** 3·86* 0·02
9·81*** 43·54*** 10·25*** 0·01
5·14** 69·86*** 7·45** 0·02
23·25*** 33·39*** 3·44* 12·90
3·24* 123·77*** 0·24ns 0·04
13·44*** 5·85*** 4·99** 0·00
17·64*** 15·5Y1*** 5·07** 0·00
8·80*** 51·05*** 6·30** 0·01
0·79ns 11·49*** 3·57* 0·00
21·43*** 28·44*** 4·76** 11·60
3·22* 119·70*** 1·48ns 0·06
13·31*** 5·45*** 5·38** 0·03
16·74*** 15·16*** 0·40ns 0·02
11·72*** 46·12*** 6·65*** 0·01
3·95** 73·30*** 0·96ns 0·02
*, **, and *** indicate significant F-values at P < 0·05, 0·01 and 0·001, respectively; ns not significant
Table 6. LS means of milk traits, according to genotypes at sheep GH gene SNP
Genotype
n
Milk yield (g/d)
Fat (%) B
Protein (%)
Casein (%) b
Lactose (%0) B
Energy (MJ/kg)
ss748770547
CC CT TT
48 37 18
1196 1094 1106
6·47 * 6·20AB 6·03A
5·90 5·92 5·76
4·66 4·65b 4·49a
4·89 4·86B 4·76A
4·71B 4·60AB 4·50A
ss748770553
AA AG GG
7 19 77
1042a 1030a 1159b
6·22 6·26 6·31
5·59A 5·95B 5·90B
4·38A 4·67B 4·64B
4·77A 4·80A 4·88B
4·11a 4·51b 4·95b
ss748770572
GG GT TT
4 18 83
1271B 996A 1159AB
5·99A 6·43B 6·30B
5·47 5·93 5·90
4·23 4·68 4·65
4·86B 4·78A 4·87B
4·19 4·71 4·63
n, number of animals. *Different capital letters in the same column indicate values significantly different (after Bonferroni correction) for each SNP at P < 0·01; lower case letters indicate significance at P < 0·05
nt changes compared to GenBank: DQ450146 and DQ461643 (dbSNP ss748770506 to ss748770580). The two sheep GH gene copies shared seven common SNPs, among these, the coding SNP c.255G>A (ss748770530 and ss748770563) and the intronic SNP c.453 + 35A>G (ss748770534 and ss748770570) have been reported also at the caprine GH locus (Dettori et al. 2013), indicating that they probably occurred in a common ancestor. Also SNP ss748770564, occurring only at sheep GH2-Z, has been revealed in the caprine GH gene, indicating that some sequences of the GH gene are more susceptible than others to the occurrence of mutations. According to MacDonald et al. (2011), indels occur in DNA regions with polynucleotide repeats or other repeat sequences, which are associated with the accumulation of nucleotide substitutions, over evolutionary time scales. For example, the indel c.*30delT (sheep ss748770538 and ss748770577) also occurs in goats, but with an inserted/deleted C (c.*30delC) rather than T (Vacca et al. 2013) and we detected a total of five indels at
GH1/GH2-N and two at GH2-Z, similar to the ones revealed in the caprine GH gene (Dettori et al. 2013). Some authors report that amino acid positions 9 and 63 (corresponding to 35 and 89 of the entire protein sequence, respectively) of the sheep GH protein sequence, allow differentiating the two gene copies GH2-N and GH2-Z (Lacroix et al. 1996; Wallis et al. 1998). We found that GH1/GH2-N always showed a glycine at position 35, while GH2-Z had an arginine, then this amino acid position was discriminating. In contrast, amino acid position 89 was not discriminating, as GH2-Z was polymorphic (p.S89G). The two copies of the sheep GH gene differ essentially in their 5′ flanking sequences (Marques et al. 2006), then we analysed these sequences to check whether the nt changes therein were involved in the alteration of transcription factor binding sites (TFBS). Several SNPs were part of putative TFBS, among them, SNP ss748770506 was part of a potential binding site for the pituitary-specific transcription factor POU1FI (formerly Pit-1), which remained
Sheep GH gene effects on milk traits unchanged when G or A occurred at nt position c.−183. The POU1FI transcription factor regulates the expression of pituitary genes, such as growth hormone and prolactin genes (Mura et al. 2012), specifically binding the consensus sequence 5′-TAAAT-3′. Two sequences potentially recognised by this TF were found at the GH1/GH2-N gene copy (−183/−174 and −142/−133), but no such sequence was found at the promoter of GH2-Z, which probably, during the duplication process, has retained only 82 nt of the 5′ flanking region of the original GH1 gene, losing the two potential POU1FI binding sites. This might explain the different tissues of expression of the two genes, pituitary for GH1/GH2-N and placenta for GH2-Z (Lacroix et al. 1996). A thorough analysis of the promoter regions at the sheep GH locus has been studied by Marques (2007). Association analysis Association analysis showed that polymorphism of three SNPs at the GH2-Z gene affected milk traits. SNP ss748770547, occurring exclusively in the 5′ flanking region of GH2-Z (c.−259 T>C), significantly affected milk fat percentage, as well as lactose percentage and energy values. This SNP was part of a potential transcription factor binding site (TFBS) for C/EBP alpha, when the C occurred, but when T substituted for C this binding site was lost, as already evidenced in the same sheep breed (Vacca et al. 2013). Transcription factor C/EBP alpha (CCAAT/Enhancer Binding Protein) is known to be involved in the regulation of adipogenesis and adipoblast differentiation (Payne et al. 2009; Siersbaek et al. 2012), then ss748770547 may be a causal mutation affecting milk fat content, which has been highlighted here for the first time. It is known that pituitary GH, in ruminants, is involved in the mobilisation of body lipid stores, in the early weeks of lactation, by an increase of lipoprotein lipase activity in the adipose tissues, with an increase of free fatty acids in plasma, which become available to the mammary gland (Palmquist, 2006; Vijayakumar et al. 2010). In addition, pituitary GH can affect the synthesis of fatty acids de novo via activation of Acetyl-CoA carboxylase, mediated by IGF-1 (Palmquist, 2006). The mechanism through which the sheep placental GH, expressed from day 27 to day 55 of lactation, may be involved in a process of adipogenesis, remains to be elucidated, and it could be different from that of pituitary GH. Polymorphism at the coding SNP ss748770553 affected milk yield, as well as protein, casein and lactose contents. This SNP is located in exon-2 of GH2-Z and corresponds to the nonsynonymous change p.Ala27Thr, which is the N-terminal residue of the mature protein. Although specific studies on the regulation of the half-life of GH are not reported in the literature, the abovementioned N-terminal residue might be involved in the regulation of GH degradation, through the N-End Rule Pathway (Tasaki et al. 2012). SNP ss748770572 (intron 4 of GH2-Z) significantly affected milk yield and lactose content (P < 0·01). It should
7
be noted that SNP ss748770572, describing the nt change c.453 + 84 T>G, was common to both GH1/GH2-N (SNP ss748770535) and GH2-Z, but ss748770535 was excluded from the statistical analysis because it showed MAF
© Proprietors of Journal of Dairy Research 2015
1
The sheep growth hormone gene polymorphism and its effects on milk traits Maria Luisa Dettori1*, Michele Pazzola1, Emanuela Pira1, Pietro Paschino1 and Giuseppe Massimo Vacca1,2 1 2
Dipartimento di Medicina Veterinaria, Università degli Studi di Sassari, via Vienna, 2 07100 Sassari, Italy Centro di Competenza Biodiversità Animale, viale Adua 2C, 07100 Sassari, Italy
Received 4 September 2014; accepted for publication 5 November 2014
Growth hormone (GH) is encoded by the GH gene, which may be single copy or duplicate in sheep. The two copies of the sheep GH gene (GH1/GH2-N and GH2-Z) were entirely sequenced in one 106 ewes of Sarda breed, in order to highlight sequence polymorphisms and investigate possible association between genetic variants and milk traits. Milk traits included milk yield, fat, protein, casein and lactose percentage. We evidenced 75 nucleotide changes. Transcription factor binding site prediction revealed two sequences potentially recognised by the pituitary-specific transcription factor POU1FI at the GH1/GH2-N gene, which were lost at the promoter of GH2-Z, which might explain the different tissues of expression of GH1/GH2-N (pituitary) and GH2-Z (placenta). Significant differences in milk traits were observed among genotypes at polymorphic loci only for the GH2-Z gene. Sheep with homozygote genotype ss748770547 CC had higher fat percentage (P < 0·01) than TT. SNP ss748770547 was part of a potential transcription factor binding site for C/EBP alpha (CCAAT/Enhancer Binding Protein), which is involved in the regulation of adipogenesis and adipoblast differentiation. SNP ss748770547, located in the GH2-Z gene 5′ flanking region, may be a causal mutation affecting milk fat content. These findings might contribute to the knowledge of the sheep GH locus and might be useful in selection processes in sheep. Keywords: Sheep milk, Sarda sheep breed, growth hormone gene, sheep GH gene, duplicate GH gene.
Growth hormone (GH) is encoded by the GH gene belonging to the growth hormone-prolactin gene family: prolactin (PRL) and GH are hormones/cytokines, which coordinate a wide range of biological processes in vertebrates (Vijayakumar et al. 2010). GH promotes somatic growth, influencing muscle and bone metabolism and lactation (Giustina & Veldhuis, 1998) and, in sheep, it is involved in the response to stress (Carcangiu et al. 2008). The PRL and GH gene family is characterised by species-specific gene expansion probably due to gene duplication and natural selection (Otha, 1993). The human genome contains a cluster of five GH genes, while cattle have only one (bovine GH, bGH), and sheep (ovine GH, oGH) (as well as goats) display a copy number variant (CNV) polymorphism, with the Gh1 allele carrying the only GH1 copy and the Gh2 duplicate allele carrying the GH2-N and GH2-Z gene copies, separated by a 3·5 kb long DNA intercopy region (Valinsky et al. 1990). The sheep GH locus was mapped to chromosome 11q25 and has
*For correspondence; e-mail: [email protected]
5 exons spanning approximately 2 kb for the Gh1 allele and 7·5 kb for the duplicate Gh2 allele (Ofir & Gootwine, 1997). The products of the two sheep GH gene copies show different biological properties and differ in their receptor-binding ability (Reicher et al. 2008) and in stage and organ of expression: GH1/GH2-N is expressed in the pituitary, while GH2-Z is expressed in the placenta (Lacroix et al. 1996; Gootwine, 2004). Sheep GH1, GH2-N and GH2-Z genes share the same nucleotide sequence, except for nucleotide (nt) variations which do not represent a distinctive feature. The only element that allows distinguishing GH1/GH2-N from GH2-Z is a segment of the promoter region of GH2-Z, which is included in the intercopy region (Marques et al. 2006). Genetic variants at the GH locus were reported to affect milk productions in cattle (Dybus et al. 2004), growth rate (An et al. 2010) and milk yield (Malveiro et al. 2001; Dettori et al. 2013) in goats, milk yield in Serra da Estrela (Marques et al. 2006) and Sarda ewes (Vacca et al. 2013). Sequences of the complete GH1 (GenBank accession number: DQ450146-DQ450147), GH2-N (GenBank: DQ461644-DQ461681) and GH2-Z (GenBank: DQ461615-DQ461643) gene copies have been
2
ML Dettori and others
Table 1. Oligonucleotides utilised for PCR amplification and sequencing, at the sheep GH locus Primer name
Primer sequence (5′−3′)
Reference
GHTF GHTR GH2ZF GH2ZR RTGH2F RTGH2R GH4F RTGH3R RTGH4R RTGH5F
CCAGAGAAGGAACGGGAACAGGATGAG ATAGAGCCCACAGCACCCCTGCTATTG TGGCTACACCTCTTCCTGCTTTCTGG GGAGGAACCGGGTCAATTAT TGCCCTGGACTCAGGTG GACACATCTCTGGGGAGCTT CTGCCAGCAGGACTTGGAGC GTCCTAGGTGGCCACTCACT CTCCAGGTCCTTCAGCTTCT GCAGATCCTCAAGCAGACCT
Marques et al. 2006
reported for the Serra da Estrela sheep, revealing several polymorphic sites (Marques et al. 2006; Marques, 2007). In this research we separately amplified, by PCR, the two copies of the sheep duplicate GH gene, which differ only in terms of their 5′ flanking regions. Then each gene copy was completely sequenced in all the sheep of the experiment. Analysis of the sequencing traces revealed polymorphisms occurring in each copy, and the relationship between polymorphisms and milk traits was evaluated. The Sarda sheep breed is autochthonous to the island of Sardinia, where about 3 million head are reared and it is the most important Italian dairy sheep breed (Vacca et al. 2008). Owing to its high production and rusticity and adaptability to Mediterranean climate characteristics (Carcangiu et al. 2011), it has spread to other Italian regions and to several North African Countries, where it is reared either as purebred or crossbred (Vacca et al. 2010). In the present investigation, the GH1/GH2-N and GH2-Z gene copies were entirely sequenced in a population of Sarda breed sheep (Ovis aries), in order to highlight sequence polymorphisms and evaluate association between genetic variants at the GH1/GH2-N and GH2-Z gene copies and milk traits. Materials and methods Animals and samples One-hundred-and-six clinically healthy multiparous ewes of Sarda breed, aged 4 years, in their third lactation, were randomly selected from four commercial farms showing similar management and feeding systems, located on the island of Sardinia (Italy). Daily milk yield was recorded from each sheep of the experiment once a month, from February to June which corresponds to different stages of the milking period after lambs’ weaning according to ICAR guidelines (ICAR, 2012), measured as days in milk (DIM) from 15 ± 3 to 135 ± 3 d (15, 45, 75, 105 and 135 DIM). Individual milk samples were taken for milk analysis and individual blood samples were taken for DNA extraction. Milk was collected by hand milking. Approximately 5 ml of blood was collected by puncture via the jugular vein with only physical restraint. Blood samples were taken solely for
Vacca et al. 2013 This paper This paper Marques et al. 2006 This paper This paper This paper
research purposes and experienced veterinarians performed blood collection and all efforts were made to minimise suffering. No specific permission to an animal ethics committee was required for these locations and activities, because according to Article 2 of the EC Directive 86/609/EEC, none of the procedures used here met the criteria to be defined as experiments, then specific approval was not necessary. Milk analysis Milk traits recorded included milk yield; protein, fat and lactose percentage, determined by infrared spectrophotometer (Milko-Scan 133B; Foss Electric, DK-3400 Hillerød, Denmark) (IDF Standard No 141C, 2000); casein content (IDF Standard No 29, 1964); milk energy, estimated on the bases of calories provided by total solid components (National Research Council, 2007). DNA analysis DNA was obtained from leucocytes using a commercial kit (NucleoSpin Blood, Macherey-Nagel). DNA concentration and purity were measured by spectrophotometer (Eppendorf Biophotometer, Hamburg, Germany). The GH1/GH2-N gene was amplified by polymerase chain reaction (PCR) with the primer pair GHTF/GHTR (Marques et al. 2006) to produce a DNA fragment of about 2·05 kb, and the GH2-Z gene was amplified with the primer pair GH2ZF/GH2ZR to give a fragment of about 2·22 kb (Vacca et al. 2013) (Table 1). The two gene copies were analysed by Sanger sequencing in all the animals of the experiment, in the forward direction. Sequencing oligonucleotides were designed with the Primer3Plus software (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus. cgi/) based on GenBank: DQ450546 and DQ461643 (Table 1). Prior to sequencing, amplicons were purified with Agencourt® AMPure® kit (Beckman Coulter, USA), then sequencing was obtained with an Applied Biosystems 3730 DNA Analyser (Applied Biosystems, Foster City CA, USA). To test the quality of sequencing reactions, about 15% of the samples were also sequenced in the reverse direction, as well as those subjects who showed a heterozygous insertion/deletion (indel), and thus alteration of the sequencing reaction downstream of it.
Sheep GH gene effects on milk traits Analysis of the sequencing data The Phred/Phrap/Crossmatch softwares were used to compute data quality information from chromatogram files and to construct contig sequences (Ewing & Green, 1998; Ewing et al. 1998). PolyPhred was used to compare sequence traces and search for homozygotes and heterozygotes in these contigs (Nickerson et al. 1997; Bhangale et al. 2006). PolyPhred polymorphism tags were examined using Consed for each putative SNP (Gordon et al. 1998; 2001; Gordon, 2004). Sequence polymorphisms were described according to the Human Genome Variation Society (http://www.hgvs.org/mutnomen/). The Haploview software package (Barrett et al. 2005) was used to estimate minor allele frequency (MAF), observed and expected heterozygosity, and to test genotype distributions for departure from Hardy-Weinberg equilibrium at each polymorphic locus. The Alibaba (v.2·1) software and the TRANSFAC (v.7·0) database (http://www.gene-regulation.com/pub/programs/ alibaba2) were used to find motifs in promoter regions. Nucleotide sequences were translated into amino acids using ExPASy Bioinformatics Resource Portal (http://www. expasy.org/) and compared with the translated amino acid sequence of GenBank: DQ450146 (GH1) and GenBank: DQ461643 (GH2-Z). Association analysis Association analysis between the SNPs at GH1/GH2-N and GH2-Z and milk traits (milk yield, protein, fat, casein and lactose percentages and energy) was performed with the SAS Software (SAS Inst. Inc., Cary NC, USA) using the mixed effect model procedure and the following model: yijkl ¼ μ þ Hi þ DIMj þ Gk þ H × DIMij þ al ðGk Þ þ eijkl where yijkl is the analysed variable, μ is the general mean, Hi is the fixed effect of the herd (i = 4 levels), DIMj is the fixed effect of the stage of milking measured as days after lambs’ weaning ( j = 5 levels 15, 45, 75, 105 and 135 DIM), Gk is the fixed effect of genotype at each SNP (k = 2 or 3 levels), H × DIMij is the interaction effect between the herd and the stage of lactation, al(Gi) is the random effect of lth animal nested within the kth genotype and eijkl is the error effect. Because of the low frequency of some genotypes and the resulting rank deficiency in contingency tables, each SNP was analysed at a time. In order to avoid a bias of results, SNPs with MAF A c.−119 T > C c.−118 G > A c.−39 C > T c.−19 T > A c.−15 G > A c.13 + 49 C > T c.13 + 95 C > T c.13 + 99 T > C c.13 + 105 T > C c.13 + 120 G > A c.14 − 122_14 − 121 ins A c.14 − 99 G > A c.14 − 71_14 − 70 ins G c.59 C > T c.174 + 50 del A c.174 + 54 C > T c.174 + 72 T > C c.174 + 115 G > A c.175 − 97 del T c.175 − 96 A > G c.175 − 92 A > G c.175 − 41 C > A c.179 G > A c.255 G > A c.292 − 30 A > G c.292 − 22 G > C c.453 + 12 A > G c.453 + 35 A > G c.453 + 84 T > G c.454 − 102 C > T c.454 − 12 C > T c.*30 del T c.*53 G > T c.*90 C > T c.*101 C > G c.*110 T > G c.*120 C > G c.*148 G > A c.*149 G > C c.*156 C > T
5′flanking
— T/(C) G/(A) C/(T) T/(A) G/(A) C/(T) C/(T) T/(C) T/(C) G/(A) (A)/_ (G)/A (G)/_ C/(T) A/(_) C/(T) T/(C) G/(A) T/(_) A/(G) A/(G) C/(A) G/(A) (G)/A A/(G) G/(C) A/(G) A/(G) T/(G) C/(T) C/(T) (T)/_ G/(T) C/(T) C/(G) (T)/G (C)/G (G)/A G/(C) C/(T)
— 0·04 0·03 0·07 0·05 0·06 0·20 0·06 0·06 0·06 0·06 0·12 0·45 0·01 0·07 0·17 0·05 0·05 0·05 0·06 0·09 0·01 0·05 0·02 0·06 0·15 0·17 0·16 0·16 0·05 0·05 0·04 0·10 0·03 0·03 0·03 0·0 0·0 0·01 0·20 0·03
— 0·09 0·05 0·10 0·07 0·09 0·32 0·11 0·11 0·11 0·11 0·21 0·52 0·03 0·01 0·28 0·07 0·07 0·07 0·11 0·17 0·02 0·06 0·05 0·08 — 0·31 0·27 0·27 0·08 0·09 0·08 0·16 0·05 0·06 0·06 0·0 0·0 0·01 0·31 0·05
— 0·08 0·05 014 0·09 0·11 0·32 0·11 0·11 0·11 0·11 0·21 0·50 0·03 0·01 0·28 0·10 0·10 0·10 0·11 0·16 0·02 0·09 0·05 0·11 — 0·28 0·26 0·26 0·10 0·09 0·08 0·18 0·05 0·06 0·06 0·0 0·0 0·01 0·32 0·05
— 1·0 1·0 1·10 0·33 0·42 1·0 1·0 1·0 1·0 1·0 1·0 0·88 1·0 1·0 1·0 0·29 0·29 0·29 1·0 1·0 1·0 0·23 1·0 0·32 1·0 0·76 1·0 1·0 0·42 1·0 1·0 0·48 1·0 1·0 1·0 1·0 1·0 1·0 0·99 1·0
5′UTR
Intron-1
Exon-2 Intron-2
Exon-3 Intron-3 Intron-4
3′UTR 3′flanking
Polymorphic sites shared by the GH1/GH2-N and GH2-Z gene copies are shown in bold type. SNP ID, submitted SNP accession number from the dbSNP database; DQ450146, nucleotide positions relative to GenBank DQ450146 (GH1); X12546, nucleotide positions related to GenBank X12546; MAF, minor allele frequency; Ho, observed heterozygosity; He, expected heterozygosity; HWpval, Hardy Weinberg P value †Variations already described in Vacca et al. (2013) ‡Variations already described in Marques et al. (2006) §Variations already described in Marques (2007) ¶Single nucleotide deletion ††Rare allele in brackets
stage or tissue of expression, as well as its functions, having an impact on production traits. No homozygote Gh1 subjects were found in the study population, while 1·14% Gh1/Gh1 subjects have been reported for the Serra da Estrela sheep (Marques et al. 2006). Also the Texel sheep, utilised for the sheep genome reference sequence, carries the Gh1 allele, mapped to chromosome 11, GenBank: NC_019468·1 (47540064.47541799, complement) (International Sheep
Genomics Consortium et al. 2010). The Gh1 allele has been found to be associated with lower milk yield in the Serra da Estrela sheep (Marques et al. 2006), then this allele might have undergone negative selection in the Sarda sheep, which has been selected for many decades to improve milk production (Mura et al. 2012). A total of 72 polymorphic sites were evidenced at the GH1/GH2-N and GH2-Z genes, plus 3 monomorphic
Sheep GH gene effects on milk traits
5
Table 3. SNPs at the GH2-Z gene in Sarda sheep SNP ID
Nt position
X12546
Polymorphism
Gene gion
Allele††
MAF
Ho
He
HWpval
ss748770547 ss748770548 ss748770549 ss748770550 ss748770551 ss748770552 ss748770553 ss748770554 ss748770555 ss748770556 ss748770557 ss748770558 ss748770559 ss748770560 ss748770561 ss748770562 ss748770563 ss748770564 ss748770565 ss748770566 ss748770567 ss748770568 ss748770569 ss748770570 ss748770571 ss748770572 ss748770573 ss748770574 ss748770575 ss748770576 ss748770577 ss748770578 ss748770579 ss748770580
1130†§ 1220†§ 1357§ 1507§ 1578 1705 1715‡ 1783‡ 1857 1865 1868 1871_1872§¶ 1941§ 1958 1996§ 2007§ 2117 2127‡ 2170‡§ 2173 2455 2555 2556 2579 2621§ 2628§ 2774 2922†‡ 2966 3035†‡ 3049_3050†‡ 3100 3167 3168
— — 288 438 508 634 644 712 786 794 797 801 871 888 926 937 1047 1057 1100 1103 1385 1485 1486 1509 1551 1558 1704 1852 1896 1965 1980 2029 2097 2098
c.−259 T > C c.−169 C > G c.−32 C > T c.13 + 106 A > G c.14 − 72 C > T c.69 G > A c.79 G > A c.147 A > G c.174 + 47 A > G c.174 + 55 A > G c.174 + 58 A > C c.174 + 61_174 + 62 ins C c.174 + 131 A > G c.175 − 79 G > T c.175 − 41 A > C c.175 − 30 G > T c.255 A > G c.265 A > G c.291 + 17 A > G c.291 + 20 C > T c.364 G > A c.453 + 11 C > T c.453 + 12 G > A c.453 + 35 G > A c.453 + 77 C > T c.453 + 84 T > G c.454 − 46 G > A c.556 G > A c.600 G > A c.*15 C > T c.*29_30 insT c.*80 T > C c.*147 A > G c.*148 G > C
5′flanking
(T)/C C/(G) (C)/T (A)/G C/(T) G/(A) G/(A) A/(G) A/(G) (A)/G A/(C) (C)/_ A/(G) G/(T) (A)/C G/(T) (A)/G A/(G) A/(G) C/(T) G/(A) C/(T) G/(A) G/(A) C/(T) T/(G) G/(A) G/(A) G/(A) (C)/T (T)/_ (T)/C A/(G) G/(C)
0·36 0·35 0·11 0·14 0·07 0·17 0·16 0·11 0·07 0·13 0·17 0·20 0·07 0·05 0·16 0·11 0·18 0·09 0·09 0·02 0·05 0·01 0·0 0·03 0·16 0·13 0·18 0·03 0·01 0·12 0·18 0·04 0·04 0·21
0·37 0·36 0·17 0·21 0·13 0·34 0·19 0·19 0·05 0·09 0·14 0·24 0·04 0·05 0·17 0·14 0·24 0·06 0·03 0·03 0·07 0·02 0·0 0·06 0·23 0·17 0·23 0·04 0·01 0·22 0·29 0·0 0·06 0·28
0·46 0·46 0·19 0·24 0·12 0·28 0·27 0·19 0·13 0·23 0·28 0·32 0·12 0·09 0·27 0·20 0·29 0·16 0·16 0·03 0·09 0·02 0·0 0·06 0·26 0·22 0·29 0·06 0·01 0·21 0·29 0·08 0·08 0·33
0·07 0·05 0·58 0·51 1·0 0·08 0·03 1·0 0·00 0·00 0·00 0·03 0·00 0·01 0·01 0·08 0·27 0·00 0·00 1·0 0·34 1·0 1·0 1·0 0·36 0·08 0·09 0·15 1·0 1·0 1·0 0·00 0·20 0·29
5′UTR Intron-1 Exon-2
Intron-2
Exon-3 Intron-3 Exon-4 Intron-4
Exon-5 3′UTR
3′flanking
Polymorphic sites shared by the GH1/GH2-N and GH2-Z gene copies are reported in bold type. SNP ID, submitted SNP accession number from the dbSNP database; DQ461643, nucleotide positions relative to GenBank DQ461643 (GH2-Z); X12546, nucleotide positions in GenBank X12546; MAF, minor allele frequency; Ho, observed heterozygosity; He, expected heterozygosity; HWpval, Hardy Weinberg P value †Variations already described in Vacca et al. (2013) ‡Variations already described in Marques et al. (2006) §Variations already described in Marques (2007) ¶Single nucleotide deletion ††Rare allele in brackets
Table 4. Coding SNPs and putative amino acid changes at the Sarda sheep GH gene SNP ID
Polymorphism
Gene region
ss748770520 ss748770529 ss748770530 ss748770552 ss748770553 ss748770554 ss748770563 ss748770564 ss748770567 ss748770574 ss748770575
c.59 C > T c.179 G > A c.255 G > A c.69 G > A c.79 G > A c.147 A > G c.255 A > G c.265 A > G c.364 G > A c.556 G > A c.600 G > A
GH1/GH2-N GH1/GH2-N GH1/GH2-N GH2-Z GH2-Z GH2-Z GH2-Z GH2-Z GH2-Z GH2-Z GH2-Z
Putative aa change Exon-2 Exon-3 Exon-2
Exon-3 Exon-4 Exon-5
p.Pro20Leu p.Arg60His p.Pro85 p.Gln23 p.Ala27Thr p.Gln49 p.Pro85 p.Ser89Gly p.Val122Ile p.Gly186Ser p.Thr200
ML Dettori and others
6
Table 5. Analysis of variance (F values) showing the effects of herd (H), days in milking (DIM) and genotype (G) on milk traits SNP ss748770547 H DIM G SEM
ss748770553 H DIM G SEM
ss748770572 H DIM G SEM
Milk yield (g/d)
Fat (%)
Protein (%)
Casein (%)
Lactose (%)
Energy (MJ/kg)
22·71*** 26·62*** 2·81ns 11·60
3·29* 112·9*** 8·27*** 0·06
12·76*** 4·45** 2·50ns 0·03
17·00*** 12·87*** 3·86* 0·02
9·81*** 43·54*** 10·25*** 0·01
5·14** 69·86*** 7·45** 0·02
23·25*** 33·39*** 3·44* 12·90
3·24* 123·77*** 0·24ns 0·04
13·44*** 5·85*** 4·99** 0·00
17·64*** 15·5Y1*** 5·07** 0·00
8·80*** 51·05*** 6·30** 0·01
0·79ns 11·49*** 3·57* 0·00
21·43*** 28·44*** 4·76** 11·60
3·22* 119·70*** 1·48ns 0·06
13·31*** 5·45*** 5·38** 0·03
16·74*** 15·16*** 0·40ns 0·02
11·72*** 46·12*** 6·65*** 0·01
3·95** 73·30*** 0·96ns 0·02
*, **, and *** indicate significant F-values at P < 0·05, 0·01 and 0·001, respectively; ns not significant
Table 6. LS means of milk traits, according to genotypes at sheep GH gene SNP
Genotype
n
Milk yield (g/d)
Fat (%) B
Protein (%)
Casein (%) b
Lactose (%0) B
Energy (MJ/kg)
ss748770547
CC CT TT
48 37 18
1196 1094 1106
6·47 * 6·20AB 6·03A
5·90 5·92 5·76
4·66 4·65b 4·49a
4·89 4·86B 4·76A
4·71B 4·60AB 4·50A
ss748770553
AA AG GG
7 19 77
1042a 1030a 1159b
6·22 6·26 6·31
5·59A 5·95B 5·90B
4·38A 4·67B 4·64B
4·77A 4·80A 4·88B
4·11a 4·51b 4·95b
ss748770572
GG GT TT
4 18 83
1271B 996A 1159AB
5·99A 6·43B 6·30B
5·47 5·93 5·90
4·23 4·68 4·65
4·86B 4·78A 4·87B
4·19 4·71 4·63
n, number of animals. *Different capital letters in the same column indicate values significantly different (after Bonferroni correction) for each SNP at P < 0·01; lower case letters indicate significance at P < 0·05
nt changes compared to GenBank: DQ450146 and DQ461643 (dbSNP ss748770506 to ss748770580). The two sheep GH gene copies shared seven common SNPs, among these, the coding SNP c.255G>A (ss748770530 and ss748770563) and the intronic SNP c.453 + 35A>G (ss748770534 and ss748770570) have been reported also at the caprine GH locus (Dettori et al. 2013), indicating that they probably occurred in a common ancestor. Also SNP ss748770564, occurring only at sheep GH2-Z, has been revealed in the caprine GH gene, indicating that some sequences of the GH gene are more susceptible than others to the occurrence of mutations. According to MacDonald et al. (2011), indels occur in DNA regions with polynucleotide repeats or other repeat sequences, which are associated with the accumulation of nucleotide substitutions, over evolutionary time scales. For example, the indel c.*30delT (sheep ss748770538 and ss748770577) also occurs in goats, but with an inserted/deleted C (c.*30delC) rather than T (Vacca et al. 2013) and we detected a total of five indels at
GH1/GH2-N and two at GH2-Z, similar to the ones revealed in the caprine GH gene (Dettori et al. 2013). Some authors report that amino acid positions 9 and 63 (corresponding to 35 and 89 of the entire protein sequence, respectively) of the sheep GH protein sequence, allow differentiating the two gene copies GH2-N and GH2-Z (Lacroix et al. 1996; Wallis et al. 1998). We found that GH1/GH2-N always showed a glycine at position 35, while GH2-Z had an arginine, then this amino acid position was discriminating. In contrast, amino acid position 89 was not discriminating, as GH2-Z was polymorphic (p.S89G). The two copies of the sheep GH gene differ essentially in their 5′ flanking sequences (Marques et al. 2006), then we analysed these sequences to check whether the nt changes therein were involved in the alteration of transcription factor binding sites (TFBS). Several SNPs were part of putative TFBS, among them, SNP ss748770506 was part of a potential binding site for the pituitary-specific transcription factor POU1FI (formerly Pit-1), which remained
Sheep GH gene effects on milk traits unchanged when G or A occurred at nt position c.−183. The POU1FI transcription factor regulates the expression of pituitary genes, such as growth hormone and prolactin genes (Mura et al. 2012), specifically binding the consensus sequence 5′-TAAAT-3′. Two sequences potentially recognised by this TF were found at the GH1/GH2-N gene copy (−183/−174 and −142/−133), but no such sequence was found at the promoter of GH2-Z, which probably, during the duplication process, has retained only 82 nt of the 5′ flanking region of the original GH1 gene, losing the two potential POU1FI binding sites. This might explain the different tissues of expression of the two genes, pituitary for GH1/GH2-N and placenta for GH2-Z (Lacroix et al. 1996). A thorough analysis of the promoter regions at the sheep GH locus has been studied by Marques (2007). Association analysis Association analysis showed that polymorphism of three SNPs at the GH2-Z gene affected milk traits. SNP ss748770547, occurring exclusively in the 5′ flanking region of GH2-Z (c.−259 T>C), significantly affected milk fat percentage, as well as lactose percentage and energy values. This SNP was part of a potential transcription factor binding site (TFBS) for C/EBP alpha, when the C occurred, but when T substituted for C this binding site was lost, as already evidenced in the same sheep breed (Vacca et al. 2013). Transcription factor C/EBP alpha (CCAAT/Enhancer Binding Protein) is known to be involved in the regulation of adipogenesis and adipoblast differentiation (Payne et al. 2009; Siersbaek et al. 2012), then ss748770547 may be a causal mutation affecting milk fat content, which has been highlighted here for the first time. It is known that pituitary GH, in ruminants, is involved in the mobilisation of body lipid stores, in the early weeks of lactation, by an increase of lipoprotein lipase activity in the adipose tissues, with an increase of free fatty acids in plasma, which become available to the mammary gland (Palmquist, 2006; Vijayakumar et al. 2010). In addition, pituitary GH can affect the synthesis of fatty acids de novo via activation of Acetyl-CoA carboxylase, mediated by IGF-1 (Palmquist, 2006). The mechanism through which the sheep placental GH, expressed from day 27 to day 55 of lactation, may be involved in a process of adipogenesis, remains to be elucidated, and it could be different from that of pituitary GH. Polymorphism at the coding SNP ss748770553 affected milk yield, as well as protein, casein and lactose contents. This SNP is located in exon-2 of GH2-Z and corresponds to the nonsynonymous change p.Ala27Thr, which is the N-terminal residue of the mature protein. Although specific studies on the regulation of the half-life of GH are not reported in the literature, the abovementioned N-terminal residue might be involved in the regulation of GH degradation, through the N-End Rule Pathway (Tasaki et al. 2012). SNP ss748770572 (intron 4 of GH2-Z) significantly affected milk yield and lactose content (P < 0·01). It should
7
be noted that SNP ss748770572, describing the nt change c.453 + 84 T>G, was common to both GH1/GH2-N (SNP ss748770535) and GH2-Z, but ss748770535 was excluded from the statistical analysis because it showed MAF
