Eur J Pediatr DOI 10.1007/s00431-014-2436-x
ORIGINAL ARTICLE
Sequencing of the DKK1 gene in patients with anorectal malformations and hypospadias Romy van de Putte & Charlotte H. W. Wijers & Ivo de Blaauw & Wout F. J. Feitz & Carlo L. M. Marcelis & Marina Hakobjan & Cornelius E. J. Sloots & Yolande van Bever & Han G. Brunner & Nel Roeleveld & Iris A. L. M. van Rooij & Loes F. M. van der Zanden
Received: 18 August 2014 / Revised: 30 September 2014 / Accepted: 2 October 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Anorectal malformations (ARM) are rare congenital malformations of the gastrointestinal tract. Approximately 60 % of the patients have additional congenital malformations, such as hypospadias. A recently published article showed that deletion of one single gene, dickkopf WNT signaling pathway inhibitor-1 (Dkk1), resulted in an imperforate anus with rectourinary fistula and preputial hypospadias in mice. To determine whether DKK1 also plays a role in the etiology of ARM and hypospadias in humans, we sequenced the four exons of the DKK1 gene in 17 patients
affected with both ARM and hypospadias. No new potential disease-causing variant was identified. However, we detected a known non-synonymous variant in one patient, which was predicted in silico to be damaging, and the corresponding unaffected amino acid is highly conserved. Conclusion: In this human study, a potential interesting non-synonymous variant was found in the DKK1 gene. Whether this variant plays a contributory role in the genesis of ARM or hypospadias would require a much larger study.
Communicated by Beat Steinmann R. van de Putte : C. H. W. Wijers : N. Roeleveld : I. A. L. M. van Rooij : L. F. M. van der Zanden (*) Department for Health Evidence (133), Radboud university medical center, P.O. Box 9101, 6500 HB Nijmegen, The Netherlands e-mail: [email protected] R. van de Putte e-mail: [email protected] C. H. W. Wijers e-mail: [email protected] N. Roeleveld e-mail: [email protected] I. A. L. M. van Rooij e-mail: [email protected] I. de Blaauw Department of Surgery-Pediatric surgery, Radboudumc Amalia Children’s Hospital, Radboud university medical center, 6500 HB Nijmegen, The Netherlands e-mail: [email protected] I. de Blaauw : C. E. J. Sloots Department of Pediatric Surgery, Sophia’s Children’s Hospital, Erasmus Medical Centre, 3000 CA Rotterdam, The Netherlands C. E. J. Sloots e-mail: [email protected]
W. F. J. Feitz Department of Urology-Pediatric urology, Radboudumc Amalia Children’s Hospital, Radboud university medical center, 6500 HB Nijmegen, The Netherlands e-mail: [email protected] C. L. M. Marcelis : M. Hakobjan : H. G. Brunner Department of Human Genetics, Radboud university medical center, 6500 HB Nijmegen, The Netherlands C. L. M. Marcelis e-mail: [email protected] M. Hakobjan e-mail: [email protected] H. G. Brunner e-mail: [email protected] Y. van Bever Department of Clinical Genetics, Erasmus Medical Centre, 3000 CA Rotterdam, The Netherlands e-mail: [email protected] N. Roeleveld Department of Pediatrics, Radboudumc Amalia Children’s Hospital, Radboud university medical center, 6500 HB Nijmegen, The Netherlands
Eur J Pediatr
Keywords Anal atresia . DKK1 . Genetic . Human . Urogenital Abbreviations ARM Anorectal malformations PCR Polymerase chain reaction UTR Untranslated region
Introduction Anorectal malformations (ARM) are one of the most commonly occurring congenital malformations of the gastrointestinal tract, with a prevalence ranging from 2 to 6 per 10,000 births worldwide [12]. The severity of ARM ranges from anal atresia with or without fistulas to neighboring organs to complex cloacal malformations [11]. ARM is present as part of a recognized syndrome in 5–10 % of the ARM patients [7], such as Townes-Brocks (OMIM #107480), Currarino (OMIM #176450), and Pallister-Hall (OMIM #146510) syndromes, caused by mutations in the SALL1 [14, 24], HLBX9 [10, 22], and GLI3 [13, 20] genes, respectively. This indicates a monogenic etiology for syndromic ARM. In 60 % of the patients with non-syndromic ARM, additional congenital malformations are present [7]. One of these additional malformations is hypospadias, which is a frequently occurring congenital hypoplasia of the penis, with displacement of the urethral opening along the ventral surface. Hypospadias is the most commonly occurring urogenital birth defect in boys, with a prevalence ranging from 4 to 43 cases per 10,000 births across countries [15, 21]. The etiologies of both ARM and hypospadias are still unknown. Misra et al. (1996) found an occurrence of imperforate anus in combination with hypospadias in 2 out of 95 ARM patients (2 %) [18]. A few studies tried to identify the etiology of ARM in combination with hypospadias. For example, Yucel et al. (2007) showed that the Eph/ephrin signaling pathway is crucial in both urogenital and anal development in mice, illustrating the interplay between anorectal and urogenital development [26]. A recently published article by Guo et al. (2014) demonstrated that the deletion of one single gene, dickkopf WNT signaling pathway inhibitor-1 (Dkk1), resulted in a mouse model with imperforate anus with rectourinary fistula, preputial hypospadias, and premature urethral canalization [9]. In addition, a de novo duplication of another member of the dickkopf family of WNT regulators, dickkopf WNT signaling pathway inhibitor-4 (DKK4) gene, was identified in a patient with isolated ARM [25]. Dkk1 is hypothesized to regulate behavior of dorsal peri-cloacal mesenchymal progenitors during normal cloacal morphogenesis. Deletion of Dkk1 results in an elevation of Wnt/β-catenin activity and upregulation of the signaling molecules sonic hedgehog (Shh),
fibroblast growth factor 8 (Fgf8), and bone morphogenic protein 4 (Bmp4) [9]. WNT, SHH, FGF8, and BMP4 may be involved in the etiology of ARM and hypospadias, as crosstalk between the Wnt and Shh pathways is essential for growth and patterning of the genital tubercle [17, 19], mutations in BMP4 and FGF8 were found in patients with hypospadias [2, 6], and expression of SHH and BMP4 was found to be significantly decreased in the posterior wall of the terminal rectum in high-type ARM patients compared to controls [27]. This decreased expression of SHH and BMP4 seems to be in contradiction to the upregulation of Shh and Bmp4 found in the Dkk1 deleted mouse model with ARM and hypospadias. Thus, it is unclear how DKK1 could be involved in the etiology of these malformations. Therefore, we sequenced the coding regions of the DKK1 gene in 17 patients with ARM and hypospadias to investigate whether DKK1 is also involved in the etiology of these anomalies in humans.
Materials and methods Patient selection Patients affected with both ARM and hypospadias were derived from the AGORA (Aetiologic research into Genetic and Occupational/environmental Risk factors for Anomalies in children) data- and biobank of the Radboud university medical center in Nijmegen, The Netherlands. Clinical data were available from 615 patients with ARM treated at the departments of pediatric surgery of the Radboudumc, Sophia Children’s Hospital-Erasmus MC Rotterdam, or the University Medical Center Groningen in The Netherlands. Of these 615 patients, 23 patients (4 %) had ARM in combination with hypospadias. We excluded four patients with a genetic syndrome or a chromosomal aberration and two patients whose DNAs were not available. This resulted in 17 male study participants with ARM and hypospadias. Almost all patients (n=16) were from Caucasian origin, while one patient had an Indian grandparent. The AGORA study protocol was approved by the Regional Committee on Research Involving Human Subjects Arnhem-Nijmegen, and written informed consent was obtained from all participants and/or their parents. DNA isolation and mutation analysis DNA was extracted from either blood or saliva using standard methods. The four exons of DKK1 (801 bp) including the intron-exon boundaries (at least 50 bp), as well as the whole 5′-untranslated region (UTR) (154 bp) and 185 bp of the 3′ UTR were amplified in four amplicons using the primers depicted in Table 1. Polymerase chain reaction (PCR) was carried out in a 15-μl reaction volume containing 5 pmol of
Eur J Pediatr Table 1 Sequences of the PCR primers, annealing temperatures, and sequencing directions
PCR primer
Exon 1 Exon 2 Exon 3 Exon 4
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
Sequence 5′–3′
Annealing temperature
Sequencing direction
TTGTTGTCTCCCTCCCAAG GCGCTGATCACAGTCCTTATC AGAACGTGCTGAATGTGTGC TAGACGCTCAAAGGCTGGAC ACTTGCCCCTACCACAGTTG CACAATCCTGAGGCACAGTC AGCACCTTGGATGGGTATTC CTGCAATCACAGGGGAGTTC
56 °C
Reverse
59 °C
Forward
56 °C
Reverse
54 °C
Forward
each primer, 30 ng genomic DNA, and 7.5 μl AmpliTaq Gold® 360 PCR Master Mix (Applied Biosystems). For exon 1, 1.5 μl AmpliTaq Gold Enhancer (Applied Biosystems) was added because of the high GC content of this amplicon. The PCR conditions were 95 °C for 10 min followed by 35 cycles of 95 °C for 30 s, different annealing temperatures for 30 s (Table 1), and 72 °C for 1 min, followed by a final extension step of 72 °C for 7 min using a Dyad Peltier Thermal Cycler (Bio-Rad). PCR products were purified using ExoSAP-IT [3], and 1 μl of the purified PCR product was unidirectionally sequenced using Sanger sequencing on a 3730xl DNA sequencer (Applied Biosystems). Experiments were performed in a laboratory recognized and granted accreditation for quality control by the coordinating committee for improvement of quality control of laboratory research in health care. The sequences obtained were compared with the reference sequence NM_012242 derived from the UCSC genome browser (Build hg19) using VECTOR NTI software 11.0 by two independent researchers. The in silico prediction programs MutPred [16], SNPs&Go [5], MutationTaster [23], and PolyPhen-2 [1] were used to predict whether the variants found could cause disease.
Results Eight of the 17 patients (47 %) included in this study had ARM with a rectourethral fistula in combination with hypospadias, similar to the description of the mouse model.
Table 2 Variants detected in the patients with anorectal malformation and hypospadias
Another 3 patients had a perineal fistula, 2 patients had a rectovesical fistula, 1 patient had a rectum atresia, and 3 patients had ARM without fistulas, all in combination with hypospadias. Seven of 17 patients had anterior hypospadias (with a glandular or (sub)coronal opening), 2 patients had an urethral opening on the penile shaft, 4 others had a penoscrotal urethral opening, and for 4 patients, the exact location of the opening was unknown. All patients showed additional congenital malformations, especially other urogenital and renal malformations, such as bifid scrotum (7/17) and dysplastic kidney (3/17). We identified four known variants (two intronic, one synonymous, and one non-synonymous; Table 2), but no new variants. Two of the known variants were only found in one (the non-synonymous variant) or two (an intronic variant) patients, in heterozygous state, whereas the two other variants were more frequent and were also seen in the homozygous state. The intronic and synonymous variants are assumed to have no effect on urogenital and/or anal development since synonymous variants do not alter amino acids, and most part of the introns is not coding for amino acids. The nonsynonymous variant was found in one patient, who had ARM without fistulas, glandular hypospadias, renal agenesis, posterior urethral valves, and a small dilatation of the right ureter. This variant (NP_036374.1:p.Arg120Leu, rs149268042) had a Grantham score of 102 [8]. The phyloP score of the variant was 5.61 and the phastCons was 1, indicating a high conservation of the unaffected amino acid during evolution. Three out of the four prediction programs predicted this variant to be disease-causing: MutationTaster
Variant
Gene region
Homozygotes ancestral allele N patients (%)
Heterozygotes N patients (%)
Homozygotes variant allele N patients (%)
rs41281546 C>T rs2241529 G>A rs149268042 G>T rs1569198 T>C
Intron 1 Exon 2, synonymous Exon 2, non-synonymous Intron 3
15 (88) 8 (47) 16 (94) 3 (18)
2 (12) 6 (35) 1 (6) 8 (47)
0 (0) 3 (18) 0 (0) 6 (35)
Eur J Pediatr
predicted this with a probability of 0.99, MutPred predicted that this variant would be deleterious at a probability of 0.93, and PolyPhen-2 predicted the variant to be probably damaging. According to SNPs&Go, however, the variant has a disease reliability index of 2, indicating a low reliability to be disease-causing.
Discussion Animal models are often helpful in understanding the etiology of congenital malformations in humans. The previously reported animal model of the Dkk1 mutant mice showed that deletion of Dkk1 induced ARM and hypospadias [9]. In sequencing the DKK1 gene in 17 patients suffering from both ARM and hypospadias, we identified four known variants: one was a non-synonymous variant (rs149268042) that was identified, among others, in the Genome of the Netherlands (GoNL) project [4]. We found 1 out of 17 Dutch patients (6 %) to be heterozygous for this variant, whereas one heterozygote was identified among the 494 Dutch individuals sequenced in the GoNL project (0.2 %) [4]. This non-synonymous variant is in an amino acid that is highly conserved, and the variant was predicted in silico to be damaging so it may contribute to the etiology of ARM and hypospadias, possibly in combination with other factors in a multifactorial etiological model. Because we detected this heterozygous variant in only 1 patient in a very small group of 17 patients, it would require a much larger study to determine whether this variant does have a contributory role in the genesis of ARM or hypospadias. It is clear that our study is underpowered to detect a possible contribution of single nucleotide polymorphisms as predisposing alleles of low or moderate effect. We did not detect any novel, potentially disease-causing variants in humans. The animal model showed that deletion of the total Dkk1 gene resulted in an upregulation of the signaling molecules Shh, Wnt, Bmp4, and Fgf8 [9]. We did not find a total deletion of the DKK1 gene in our patients but only detected a single nucleotide variant in exon 2. This non-synonymous variant alone may also have an effect on the expression of the signaling molecules SHH, WNT, BMP4, and FGF8 but this remains unknown from this study. It would be interesting to perform an expression study of these signaling molecules in patients with and without the non-synonymous variant in the DKK1 gene. In conclusion, deletion of Dkk1 induced ARM with hypospadias in mice but we identified no new, potentially diseasecausing mutation in 17 patients with both ARM and hypospadias. Therefore, the involvement of DKK1 in the etiology of ARM and hypospadias is not established in humans yet, but the non-synonymous variant (rs149268042) in DKK1 that we found in one patient requires further research.
Acknowledgments We thank the surgical and other staff members of the Departments of Surgery-Pediatric surgery and Urology-Pediatric urology, Radboudumc Amalia Children’s Hospital of the Radboud university medical center in Nijmegen, the Department of Pediatric Surgery of the Sophia Children’s Hospital, and the Department of Clinical Genetics of the Erasmus Medical Centre in Rotterdam for their collaboration in collecting data from patients. We also thank the staff members of the Department of Human Genetics from the Radboud university medical center in Nijmegen for their guidance and assistance with Sanger sequencing. Finally, we are grateful to the patients who participated in this study. This study was funded by the Radboud university medical center, Nijmegen, The Netherlands. Conflict of interest The authors have no conflict of interest to disclose. Ethical standards The AGORA study protocol was approved by the Regional Committee on Research Involving Human Subjects ArnhemNijmegen, and written informed consent was obtained from all participants and/or their parents.
References 1. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR (2010) A method and server for predicting damaging missense mutations. Nat Methods 7:248– 249. doi:10.1038/nmeth0410-248 2. Beleza-Meireles A, Lundberg F, Lagerstedt K, Zhou X, Omrani D, Frisen L, Nordenskjold A (2007) FGFR2, FGF8, FGF10 and BMP7 as candidate genes for hypospadias. Eur J Hum Genet 15:405–410 3. Bell J (2008) A simple way to treat PCR products prior to sequencing using ExoSAP-IT. Biotechniques 44:834. doi:10.2144/000112890 4. Boomsma DI, Wijmenga C, Slagboom EP, Swertz MA, Karssen LC, Abdellaoui A, Ye K, Guryev V, Vermaat M, van Dijk F, Francioli LC, Hottenga JJ, Laros JF, Li Q, Li Y, Cao H, Chen R, Du Y, Li N, Cao S, van Setten J, Menelaou A, Pulit SL, Hehir-Kwa JY, Beekman M, Elbers CC, Byelas H, de Craen AJ, Deelen P, Dijkstra M, den Dunnen JT, de Knijff P, Houwing-Duistermaat J, Koval V, Estrada K, Hofman A, Kanterakis A, Dv E, Mai H, Kattenberg M, van Leeuwen EM, Neerincx PB, Oostra B, Rivadeneira F, Suchiman EH, Uitterlinden AG, Willemsen G, Wolffenbuttel BH, Wang J, de Bakker PI, van Ommen GJ, van Duijn CM (2014) The Genome of the Netherlands: design, and project goals. Eur J Hum Genet 22:221– 227. doi:10.1038/ejhg.2013.118 5. Calabrese R, Capriotti E, Fariselli P, Martelli PL, Casadio R (2009) Functional annotations improve the predictive score of human disease-related mutations in proteins. Hum Mutat 30:1237–1244. doi:10.1002/humu.21047 6. Chen T, Li Q, Xu J, Ding K, Wang Y, Wang W, Li S, Shen Y (2007) Mutation screening of BMP4, BMP7, HOXA4 and HOXB6 genes in Chinese patients with hypospadias. Eur J Hum Genet 15:23–28 7. Cuschieri A, Group EW (2002) Anorectal anomalies associated with or as part of other anomalies. Am J Med Genet 110:122–130 8. Grantham R (1974) Amino acid difference formula to help explain protein evolution. Science 185:862–864 9. Guo C, Sun Y, Guo C, MacDonald BT, Borer JG, Li X (2014) Dkk1 in the peri-cloaca mesenchyme regulates formation of anorectal and genitourinary tracts. Dev Biol 385:41–51 10. Hagan DM, Ross AJ, Strachan T, Lynch SA, Ruiz-Perez V, Wang YM, Scambler P, Custard E, Reardon W, Hassan S, Nixon P, Papapetrou C, Winter RM, Edwards Y, Morrison K, Barrow M, Cordier-Alex MP, Correia P, Galvin-Parton PA, Gaskill S, Gaskin KJ, Garcia-Minaur S, Gereige R, Hayward R, Homfray T (2000)
Eur J Pediatr Mutation analysis and embryonic expression of the HLXB9 Currarino syndrome gene. Am J Hum Genet 66:1504–1515 11. Holschneider A, Hutson J, Peña A, Beket E, Chatterjee S, Coran A, Davies M, Georgeson K, Grosfeld J, Gupta D, Iwai N, Kluth D, Martucciello G, Moore S, Rintala R, Smith ED, Sripathi DV, Stephens D, Sen S, Ure B, Grasshoff S, Boemers T, Murphy F, Söylet Y, Dübbers M, Kunst M (2005) Preliminary report on the International Conference for the Development of Standards for the Treatment of Anorectal Malformations. J Pediatr Surg 40:1521–1526 12. International Clearinghouse (2012) Annual report 2012— International clearinghouse for birth defects surveillance and research. Available at: http://www.icbdsr.org/filebank/documents/ ar2005/Report2012.pdf. Accesssed May 25, 2013. 13. Kang S, Graham JM Jr, Olney AH, Biesecker LG (1997) GLI3 frameshift mutations cause autosomal dominant Pallister-Hall syndrome. Nat Genet 15:266–268 14. Kohlhase J, Wischermann A, Reichenbach H, Froster U, Engel W (1998) Mutations in the SALL1 putative transcription factor gene cause Townes-Brocks syndrome. Nat Genet 18:81–83 15. Kurahashi N, Murakumo M, Kakizaki H, Nonomura K, Koyanagi T, Kasai S, Sata F, Kishi R (2004) The estimated prevalence of hypospadias in Hokkaido, Japan. J Epidemiol 14:73–77 16. Li B, Krishnan VG, Mort ME, Xin F, Kamati KK, Cooper DN, Mooney SD, Radivojac P (2009) Automated inference of molecular mechanisms of disease from amino acid substitutions. Bioinformatics 25:2744–2750. doi:10.1093/bioinformatics/btp528 17. Lin C, Yin Y, Veith GM, Fisher AV, Long F, Ma L (2009) Temporal and spatial dissection of Shh signaling in genital tubercle development. Development 136:3959–3967. doi:10.1242/dev.039768 18. Misra D, Mushtaq I, Drake DP, Kiely EM, Spitz L (1996) Associated urologic anomalies in low imperforate anus are capable of causing significant morbidity: a 15-year experience. Urology 48:281–283 19. Miyagawa S, Moon A, Haraguchi R, Inoue C, Harada M, Nakahara C, Suzuki K, Matsumaru D, Kaneko T, Matsuo I, Yang L, Taketo MM, Iguchi T, Evans SM, Yamada G (2009) Dosage-dependent hedgehog signals integrated with Wnt/beta-catenin signaling regulate
20.
21.
22.
23.
24.
25.
26.
27.
external genitalia formation as an appendicular program. Development 136:3969–3978. doi:10.1242/dev.039438 Narumi Y, Kosho T, Tsuruta G, Shiohara M, Shimazaki E, Mori T, Shimizu A, Igawa Y, Nishizawa S, Takagi K, Kawamura R, Wakui K, Fukushima Y (2010) Genital abnormalities in Pallister-Hall syndrome: report of two patients and review of the literature. Am J Med Genet A 152A:3143–3147. doi:10.1002/ajmg.a.33720 Nassar N, Bower C, Barker A (2007) Increasing prevalence of hypospadias in Western Australia, 1980–2000. Arch Dis Child 92: 580–584 Ross AJ, Ruiz-Perez V, Wang Y, Hagan DM, Scherer S, Lynch SA, Lindsay S, Custard E, Belloni E, Wilson DI, Wadey R, Goodman F, Orstavik KH, Monclair T, Robson S, Reardon W, Burn J, Scambler P, Strachan T (1998) A homeobox gene, HLXB9, is the major locus for dominantly inherited sacral agenesis. Nat Genet 20:358–361 Schwarz JM, Rodelsperger C, Schuelke M, Seelow D (2010) MutationTaster evaluates disease-causing potential of sequence alterations. Nat Methods 7:575–576. doi:10.1038/nmeth0810-575 Sudo Y, Numakura C, Abe A, Aiba S, Matsunaga A, Hayasaka K (2010) Phenotypic variability in a family with Townes-Brocks syndrome. J Hum Genet 55:550–551. doi:10.1038/jhg.2010.64 Wong EH, Cui L, Ng CL, Tang CS, Liu XL, So MT, Yip BH, Cheng G, Zhang R, Tang WK, Yang W, Lau YL, Baum L, Kwan P, Sun LD, Zuo XB, Ren YQ, Yin XY, Miao XP, Liu J, Lui VC, Ngan ES, Yuan ZW, Zhang SW, Xia J, Wang H, Sun XB, Wang R, Chang T, Chan IH, Chung PH, Zhang XJ, Wong KK, Cherny SS, Sham PC, Tam PK, Garcia-Barcelo MM (2013) Genome-wide copy number variation study in anorectal malformations. Hum Mol Genet 22:621–631. doi:10.1093/hmg/dds451 Yucel S, Dravis C, Garcia N, Henkemeyer M, Baker LA (2007) Hypospadias and anorectal malformations mediated by Eph/ephrin signaling. J Pediatr Urol 3:354–363 Zhang J, Zhang ZB, Gao H, Zhang D, Wang WL (2009) Downregulation of SHH/BMP4 signalling in human anorectal malformations. J Int Med Res 37:1842–1850
ORIGINAL ARTICLE
Sequencing of the DKK1 gene in patients with anorectal malformations and hypospadias Romy van de Putte & Charlotte H. W. Wijers & Ivo de Blaauw & Wout F. J. Feitz & Carlo L. M. Marcelis & Marina Hakobjan & Cornelius E. J. Sloots & Yolande van Bever & Han G. Brunner & Nel Roeleveld & Iris A. L. M. van Rooij & Loes F. M. van der Zanden
Received: 18 August 2014 / Revised: 30 September 2014 / Accepted: 2 October 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Anorectal malformations (ARM) are rare congenital malformations of the gastrointestinal tract. Approximately 60 % of the patients have additional congenital malformations, such as hypospadias. A recently published article showed that deletion of one single gene, dickkopf WNT signaling pathway inhibitor-1 (Dkk1), resulted in an imperforate anus with rectourinary fistula and preputial hypospadias in mice. To determine whether DKK1 also plays a role in the etiology of ARM and hypospadias in humans, we sequenced the four exons of the DKK1 gene in 17 patients
affected with both ARM and hypospadias. No new potential disease-causing variant was identified. However, we detected a known non-synonymous variant in one patient, which was predicted in silico to be damaging, and the corresponding unaffected amino acid is highly conserved. Conclusion: In this human study, a potential interesting non-synonymous variant was found in the DKK1 gene. Whether this variant plays a contributory role in the genesis of ARM or hypospadias would require a much larger study.
Communicated by Beat Steinmann R. van de Putte : C. H. W. Wijers : N. Roeleveld : I. A. L. M. van Rooij : L. F. M. van der Zanden (*) Department for Health Evidence (133), Radboud university medical center, P.O. Box 9101, 6500 HB Nijmegen, The Netherlands e-mail: [email protected] R. van de Putte e-mail: [email protected] C. H. W. Wijers e-mail: [email protected] N. Roeleveld e-mail: [email protected] I. A. L. M. van Rooij e-mail: [email protected] I. de Blaauw Department of Surgery-Pediatric surgery, Radboudumc Amalia Children’s Hospital, Radboud university medical center, 6500 HB Nijmegen, The Netherlands e-mail: [email protected] I. de Blaauw : C. E. J. Sloots Department of Pediatric Surgery, Sophia’s Children’s Hospital, Erasmus Medical Centre, 3000 CA Rotterdam, The Netherlands C. E. J. Sloots e-mail: [email protected]
W. F. J. Feitz Department of Urology-Pediatric urology, Radboudumc Amalia Children’s Hospital, Radboud university medical center, 6500 HB Nijmegen, The Netherlands e-mail: [email protected] C. L. M. Marcelis : M. Hakobjan : H. G. Brunner Department of Human Genetics, Radboud university medical center, 6500 HB Nijmegen, The Netherlands C. L. M. Marcelis e-mail: [email protected] M. Hakobjan e-mail: [email protected] H. G. Brunner e-mail: [email protected] Y. van Bever Department of Clinical Genetics, Erasmus Medical Centre, 3000 CA Rotterdam, The Netherlands e-mail: [email protected] N. Roeleveld Department of Pediatrics, Radboudumc Amalia Children’s Hospital, Radboud university medical center, 6500 HB Nijmegen, The Netherlands
Eur J Pediatr
Keywords Anal atresia . DKK1 . Genetic . Human . Urogenital Abbreviations ARM Anorectal malformations PCR Polymerase chain reaction UTR Untranslated region
Introduction Anorectal malformations (ARM) are one of the most commonly occurring congenital malformations of the gastrointestinal tract, with a prevalence ranging from 2 to 6 per 10,000 births worldwide [12]. The severity of ARM ranges from anal atresia with or without fistulas to neighboring organs to complex cloacal malformations [11]. ARM is present as part of a recognized syndrome in 5–10 % of the ARM patients [7], such as Townes-Brocks (OMIM #107480), Currarino (OMIM #176450), and Pallister-Hall (OMIM #146510) syndromes, caused by mutations in the SALL1 [14, 24], HLBX9 [10, 22], and GLI3 [13, 20] genes, respectively. This indicates a monogenic etiology for syndromic ARM. In 60 % of the patients with non-syndromic ARM, additional congenital malformations are present [7]. One of these additional malformations is hypospadias, which is a frequently occurring congenital hypoplasia of the penis, with displacement of the urethral opening along the ventral surface. Hypospadias is the most commonly occurring urogenital birth defect in boys, with a prevalence ranging from 4 to 43 cases per 10,000 births across countries [15, 21]. The etiologies of both ARM and hypospadias are still unknown. Misra et al. (1996) found an occurrence of imperforate anus in combination with hypospadias in 2 out of 95 ARM patients (2 %) [18]. A few studies tried to identify the etiology of ARM in combination with hypospadias. For example, Yucel et al. (2007) showed that the Eph/ephrin signaling pathway is crucial in both urogenital and anal development in mice, illustrating the interplay between anorectal and urogenital development [26]. A recently published article by Guo et al. (2014) demonstrated that the deletion of one single gene, dickkopf WNT signaling pathway inhibitor-1 (Dkk1), resulted in a mouse model with imperforate anus with rectourinary fistula, preputial hypospadias, and premature urethral canalization [9]. In addition, a de novo duplication of another member of the dickkopf family of WNT regulators, dickkopf WNT signaling pathway inhibitor-4 (DKK4) gene, was identified in a patient with isolated ARM [25]. Dkk1 is hypothesized to regulate behavior of dorsal peri-cloacal mesenchymal progenitors during normal cloacal morphogenesis. Deletion of Dkk1 results in an elevation of Wnt/β-catenin activity and upregulation of the signaling molecules sonic hedgehog (Shh),
fibroblast growth factor 8 (Fgf8), and bone morphogenic protein 4 (Bmp4) [9]. WNT, SHH, FGF8, and BMP4 may be involved in the etiology of ARM and hypospadias, as crosstalk between the Wnt and Shh pathways is essential for growth and patterning of the genital tubercle [17, 19], mutations in BMP4 and FGF8 were found in patients with hypospadias [2, 6], and expression of SHH and BMP4 was found to be significantly decreased in the posterior wall of the terminal rectum in high-type ARM patients compared to controls [27]. This decreased expression of SHH and BMP4 seems to be in contradiction to the upregulation of Shh and Bmp4 found in the Dkk1 deleted mouse model with ARM and hypospadias. Thus, it is unclear how DKK1 could be involved in the etiology of these malformations. Therefore, we sequenced the coding regions of the DKK1 gene in 17 patients with ARM and hypospadias to investigate whether DKK1 is also involved in the etiology of these anomalies in humans.
Materials and methods Patient selection Patients affected with both ARM and hypospadias were derived from the AGORA (Aetiologic research into Genetic and Occupational/environmental Risk factors for Anomalies in children) data- and biobank of the Radboud university medical center in Nijmegen, The Netherlands. Clinical data were available from 615 patients with ARM treated at the departments of pediatric surgery of the Radboudumc, Sophia Children’s Hospital-Erasmus MC Rotterdam, or the University Medical Center Groningen in The Netherlands. Of these 615 patients, 23 patients (4 %) had ARM in combination with hypospadias. We excluded four patients with a genetic syndrome or a chromosomal aberration and two patients whose DNAs were not available. This resulted in 17 male study participants with ARM and hypospadias. Almost all patients (n=16) were from Caucasian origin, while one patient had an Indian grandparent. The AGORA study protocol was approved by the Regional Committee on Research Involving Human Subjects Arnhem-Nijmegen, and written informed consent was obtained from all participants and/or their parents. DNA isolation and mutation analysis DNA was extracted from either blood or saliva using standard methods. The four exons of DKK1 (801 bp) including the intron-exon boundaries (at least 50 bp), as well as the whole 5′-untranslated region (UTR) (154 bp) and 185 bp of the 3′ UTR were amplified in four amplicons using the primers depicted in Table 1. Polymerase chain reaction (PCR) was carried out in a 15-μl reaction volume containing 5 pmol of
Eur J Pediatr Table 1 Sequences of the PCR primers, annealing temperatures, and sequencing directions
PCR primer
Exon 1 Exon 2 Exon 3 Exon 4
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
Sequence 5′–3′
Annealing temperature
Sequencing direction
TTGTTGTCTCCCTCCCAAG GCGCTGATCACAGTCCTTATC AGAACGTGCTGAATGTGTGC TAGACGCTCAAAGGCTGGAC ACTTGCCCCTACCACAGTTG CACAATCCTGAGGCACAGTC AGCACCTTGGATGGGTATTC CTGCAATCACAGGGGAGTTC
56 °C
Reverse
59 °C
Forward
56 °C
Reverse
54 °C
Forward
each primer, 30 ng genomic DNA, and 7.5 μl AmpliTaq Gold® 360 PCR Master Mix (Applied Biosystems). For exon 1, 1.5 μl AmpliTaq Gold Enhancer (Applied Biosystems) was added because of the high GC content of this amplicon. The PCR conditions were 95 °C for 10 min followed by 35 cycles of 95 °C for 30 s, different annealing temperatures for 30 s (Table 1), and 72 °C for 1 min, followed by a final extension step of 72 °C for 7 min using a Dyad Peltier Thermal Cycler (Bio-Rad). PCR products were purified using ExoSAP-IT [3], and 1 μl of the purified PCR product was unidirectionally sequenced using Sanger sequencing on a 3730xl DNA sequencer (Applied Biosystems). Experiments were performed in a laboratory recognized and granted accreditation for quality control by the coordinating committee for improvement of quality control of laboratory research in health care. The sequences obtained were compared with the reference sequence NM_012242 derived from the UCSC genome browser (Build hg19) using VECTOR NTI software 11.0 by two independent researchers. The in silico prediction programs MutPred [16], SNPs&Go [5], MutationTaster [23], and PolyPhen-2 [1] were used to predict whether the variants found could cause disease.
Results Eight of the 17 patients (47 %) included in this study had ARM with a rectourethral fistula in combination with hypospadias, similar to the description of the mouse model.
Table 2 Variants detected in the patients with anorectal malformation and hypospadias
Another 3 patients had a perineal fistula, 2 patients had a rectovesical fistula, 1 patient had a rectum atresia, and 3 patients had ARM without fistulas, all in combination with hypospadias. Seven of 17 patients had anterior hypospadias (with a glandular or (sub)coronal opening), 2 patients had an urethral opening on the penile shaft, 4 others had a penoscrotal urethral opening, and for 4 patients, the exact location of the opening was unknown. All patients showed additional congenital malformations, especially other urogenital and renal malformations, such as bifid scrotum (7/17) and dysplastic kidney (3/17). We identified four known variants (two intronic, one synonymous, and one non-synonymous; Table 2), but no new variants. Two of the known variants were only found in one (the non-synonymous variant) or two (an intronic variant) patients, in heterozygous state, whereas the two other variants were more frequent and were also seen in the homozygous state. The intronic and synonymous variants are assumed to have no effect on urogenital and/or anal development since synonymous variants do not alter amino acids, and most part of the introns is not coding for amino acids. The nonsynonymous variant was found in one patient, who had ARM without fistulas, glandular hypospadias, renal agenesis, posterior urethral valves, and a small dilatation of the right ureter. This variant (NP_036374.1:p.Arg120Leu, rs149268042) had a Grantham score of 102 [8]. The phyloP score of the variant was 5.61 and the phastCons was 1, indicating a high conservation of the unaffected amino acid during evolution. Three out of the four prediction programs predicted this variant to be disease-causing: MutationTaster
Variant
Gene region
Homozygotes ancestral allele N patients (%)
Heterozygotes N patients (%)
Homozygotes variant allele N patients (%)
rs41281546 C>T rs2241529 G>A rs149268042 G>T rs1569198 T>C
Intron 1 Exon 2, synonymous Exon 2, non-synonymous Intron 3
15 (88) 8 (47) 16 (94) 3 (18)
2 (12) 6 (35) 1 (6) 8 (47)
0 (0) 3 (18) 0 (0) 6 (35)
Eur J Pediatr
predicted this with a probability of 0.99, MutPred predicted that this variant would be deleterious at a probability of 0.93, and PolyPhen-2 predicted the variant to be probably damaging. According to SNPs&Go, however, the variant has a disease reliability index of 2, indicating a low reliability to be disease-causing.
Discussion Animal models are often helpful in understanding the etiology of congenital malformations in humans. The previously reported animal model of the Dkk1 mutant mice showed that deletion of Dkk1 induced ARM and hypospadias [9]. In sequencing the DKK1 gene in 17 patients suffering from both ARM and hypospadias, we identified four known variants: one was a non-synonymous variant (rs149268042) that was identified, among others, in the Genome of the Netherlands (GoNL) project [4]. We found 1 out of 17 Dutch patients (6 %) to be heterozygous for this variant, whereas one heterozygote was identified among the 494 Dutch individuals sequenced in the GoNL project (0.2 %) [4]. This non-synonymous variant is in an amino acid that is highly conserved, and the variant was predicted in silico to be damaging so it may contribute to the etiology of ARM and hypospadias, possibly in combination with other factors in a multifactorial etiological model. Because we detected this heterozygous variant in only 1 patient in a very small group of 17 patients, it would require a much larger study to determine whether this variant does have a contributory role in the genesis of ARM or hypospadias. It is clear that our study is underpowered to detect a possible contribution of single nucleotide polymorphisms as predisposing alleles of low or moderate effect. We did not detect any novel, potentially disease-causing variants in humans. The animal model showed that deletion of the total Dkk1 gene resulted in an upregulation of the signaling molecules Shh, Wnt, Bmp4, and Fgf8 [9]. We did not find a total deletion of the DKK1 gene in our patients but only detected a single nucleotide variant in exon 2. This non-synonymous variant alone may also have an effect on the expression of the signaling molecules SHH, WNT, BMP4, and FGF8 but this remains unknown from this study. It would be interesting to perform an expression study of these signaling molecules in patients with and without the non-synonymous variant in the DKK1 gene. In conclusion, deletion of Dkk1 induced ARM with hypospadias in mice but we identified no new, potentially diseasecausing mutation in 17 patients with both ARM and hypospadias. Therefore, the involvement of DKK1 in the etiology of ARM and hypospadias is not established in humans yet, but the non-synonymous variant (rs149268042) in DKK1 that we found in one patient requires further research.
Acknowledgments We thank the surgical and other staff members of the Departments of Surgery-Pediatric surgery and Urology-Pediatric urology, Radboudumc Amalia Children’s Hospital of the Radboud university medical center in Nijmegen, the Department of Pediatric Surgery of the Sophia Children’s Hospital, and the Department of Clinical Genetics of the Erasmus Medical Centre in Rotterdam for their collaboration in collecting data from patients. We also thank the staff members of the Department of Human Genetics from the Radboud university medical center in Nijmegen for their guidance and assistance with Sanger sequencing. Finally, we are grateful to the patients who participated in this study. This study was funded by the Radboud university medical center, Nijmegen, The Netherlands. Conflict of interest The authors have no conflict of interest to disclose. Ethical standards The AGORA study protocol was approved by the Regional Committee on Research Involving Human Subjects ArnhemNijmegen, and written informed consent was obtained from all participants and/or their parents.
References 1. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR (2010) A method and server for predicting damaging missense mutations. Nat Methods 7:248– 249. doi:10.1038/nmeth0410-248 2. Beleza-Meireles A, Lundberg F, Lagerstedt K, Zhou X, Omrani D, Frisen L, Nordenskjold A (2007) FGFR2, FGF8, FGF10 and BMP7 as candidate genes for hypospadias. Eur J Hum Genet 15:405–410 3. Bell J (2008) A simple way to treat PCR products prior to sequencing using ExoSAP-IT. Biotechniques 44:834. doi:10.2144/000112890 4. Boomsma DI, Wijmenga C, Slagboom EP, Swertz MA, Karssen LC, Abdellaoui A, Ye K, Guryev V, Vermaat M, van Dijk F, Francioli LC, Hottenga JJ, Laros JF, Li Q, Li Y, Cao H, Chen R, Du Y, Li N, Cao S, van Setten J, Menelaou A, Pulit SL, Hehir-Kwa JY, Beekman M, Elbers CC, Byelas H, de Craen AJ, Deelen P, Dijkstra M, den Dunnen JT, de Knijff P, Houwing-Duistermaat J, Koval V, Estrada K, Hofman A, Kanterakis A, Dv E, Mai H, Kattenberg M, van Leeuwen EM, Neerincx PB, Oostra B, Rivadeneira F, Suchiman EH, Uitterlinden AG, Willemsen G, Wolffenbuttel BH, Wang J, de Bakker PI, van Ommen GJ, van Duijn CM (2014) The Genome of the Netherlands: design, and project goals. Eur J Hum Genet 22:221– 227. doi:10.1038/ejhg.2013.118 5. Calabrese R, Capriotti E, Fariselli P, Martelli PL, Casadio R (2009) Functional annotations improve the predictive score of human disease-related mutations in proteins. Hum Mutat 30:1237–1244. doi:10.1002/humu.21047 6. Chen T, Li Q, Xu J, Ding K, Wang Y, Wang W, Li S, Shen Y (2007) Mutation screening of BMP4, BMP7, HOXA4 and HOXB6 genes in Chinese patients with hypospadias. Eur J Hum Genet 15:23–28 7. Cuschieri A, Group EW (2002) Anorectal anomalies associated with or as part of other anomalies. Am J Med Genet 110:122–130 8. Grantham R (1974) Amino acid difference formula to help explain protein evolution. Science 185:862–864 9. Guo C, Sun Y, Guo C, MacDonald BT, Borer JG, Li X (2014) Dkk1 in the peri-cloaca mesenchyme regulates formation of anorectal and genitourinary tracts. Dev Biol 385:41–51 10. Hagan DM, Ross AJ, Strachan T, Lynch SA, Ruiz-Perez V, Wang YM, Scambler P, Custard E, Reardon W, Hassan S, Nixon P, Papapetrou C, Winter RM, Edwards Y, Morrison K, Barrow M, Cordier-Alex MP, Correia P, Galvin-Parton PA, Gaskill S, Gaskin KJ, Garcia-Minaur S, Gereige R, Hayward R, Homfray T (2000)
Eur J Pediatr Mutation analysis and embryonic expression of the HLXB9 Currarino syndrome gene. Am J Hum Genet 66:1504–1515 11. Holschneider A, Hutson J, Peña A, Beket E, Chatterjee S, Coran A, Davies M, Georgeson K, Grosfeld J, Gupta D, Iwai N, Kluth D, Martucciello G, Moore S, Rintala R, Smith ED, Sripathi DV, Stephens D, Sen S, Ure B, Grasshoff S, Boemers T, Murphy F, Söylet Y, Dübbers M, Kunst M (2005) Preliminary report on the International Conference for the Development of Standards for the Treatment of Anorectal Malformations. J Pediatr Surg 40:1521–1526 12. International Clearinghouse (2012) Annual report 2012— International clearinghouse for birth defects surveillance and research. Available at: http://www.icbdsr.org/filebank/documents/ ar2005/Report2012.pdf. Accesssed May 25, 2013. 13. Kang S, Graham JM Jr, Olney AH, Biesecker LG (1997) GLI3 frameshift mutations cause autosomal dominant Pallister-Hall syndrome. Nat Genet 15:266–268 14. Kohlhase J, Wischermann A, Reichenbach H, Froster U, Engel W (1998) Mutations in the SALL1 putative transcription factor gene cause Townes-Brocks syndrome. Nat Genet 18:81–83 15. Kurahashi N, Murakumo M, Kakizaki H, Nonomura K, Koyanagi T, Kasai S, Sata F, Kishi R (2004) The estimated prevalence of hypospadias in Hokkaido, Japan. J Epidemiol 14:73–77 16. Li B, Krishnan VG, Mort ME, Xin F, Kamati KK, Cooper DN, Mooney SD, Radivojac P (2009) Automated inference of molecular mechanisms of disease from amino acid substitutions. Bioinformatics 25:2744–2750. doi:10.1093/bioinformatics/btp528 17. Lin C, Yin Y, Veith GM, Fisher AV, Long F, Ma L (2009) Temporal and spatial dissection of Shh signaling in genital tubercle development. Development 136:3959–3967. doi:10.1242/dev.039768 18. Misra D, Mushtaq I, Drake DP, Kiely EM, Spitz L (1996) Associated urologic anomalies in low imperforate anus are capable of causing significant morbidity: a 15-year experience. Urology 48:281–283 19. Miyagawa S, Moon A, Haraguchi R, Inoue C, Harada M, Nakahara C, Suzuki K, Matsumaru D, Kaneko T, Matsuo I, Yang L, Taketo MM, Iguchi T, Evans SM, Yamada G (2009) Dosage-dependent hedgehog signals integrated with Wnt/beta-catenin signaling regulate
20.
21.
22.
23.
24.
25.
26.
27.
external genitalia formation as an appendicular program. Development 136:3969–3978. doi:10.1242/dev.039438 Narumi Y, Kosho T, Tsuruta G, Shiohara M, Shimazaki E, Mori T, Shimizu A, Igawa Y, Nishizawa S, Takagi K, Kawamura R, Wakui K, Fukushima Y (2010) Genital abnormalities in Pallister-Hall syndrome: report of two patients and review of the literature. Am J Med Genet A 152A:3143–3147. doi:10.1002/ajmg.a.33720 Nassar N, Bower C, Barker A (2007) Increasing prevalence of hypospadias in Western Australia, 1980–2000. Arch Dis Child 92: 580–584 Ross AJ, Ruiz-Perez V, Wang Y, Hagan DM, Scherer S, Lynch SA, Lindsay S, Custard E, Belloni E, Wilson DI, Wadey R, Goodman F, Orstavik KH, Monclair T, Robson S, Reardon W, Burn J, Scambler P, Strachan T (1998) A homeobox gene, HLXB9, is the major locus for dominantly inherited sacral agenesis. Nat Genet 20:358–361 Schwarz JM, Rodelsperger C, Schuelke M, Seelow D (2010) MutationTaster evaluates disease-causing potential of sequence alterations. Nat Methods 7:575–576. doi:10.1038/nmeth0810-575 Sudo Y, Numakura C, Abe A, Aiba S, Matsunaga A, Hayasaka K (2010) Phenotypic variability in a family with Townes-Brocks syndrome. J Hum Genet 55:550–551. doi:10.1038/jhg.2010.64 Wong EH, Cui L, Ng CL, Tang CS, Liu XL, So MT, Yip BH, Cheng G, Zhang R, Tang WK, Yang W, Lau YL, Baum L, Kwan P, Sun LD, Zuo XB, Ren YQ, Yin XY, Miao XP, Liu J, Lui VC, Ngan ES, Yuan ZW, Zhang SW, Xia J, Wang H, Sun XB, Wang R, Chang T, Chan IH, Chung PH, Zhang XJ, Wong KK, Cherny SS, Sham PC, Tam PK, Garcia-Barcelo MM (2013) Genome-wide copy number variation study in anorectal malformations. Hum Mol Genet 22:621–631. doi:10.1093/hmg/dds451 Yucel S, Dravis C, Garcia N, Henkemeyer M, Baker LA (2007) Hypospadias and anorectal malformations mediated by Eph/ephrin signaling. J Pediatr Urol 3:354–363 Zhang J, Zhang ZB, Gao H, Zhang D, Wang WL (2009) Downregulation of SHH/BMP4 signalling in human anorectal malformations. J Int Med Res 37:1842–1850
