JOURNAL

OF

BACTERIOLOGY, May 1990,

p.

Vol. 172, No. 5

2535-2540

0021-9193/90/052535-06$02.00/0 Copyright © 1990, American Society for Microbiology

Site-Directed Mutations in the repA C-Terminal Region of Plasmid Rtsl: Pleiotropic Effects on the Replication and Autorepressor Functions HONG ZENG, TETSUYA HAYASHI, AND YOSHIRO TERAWAKI* Department of Bacteriology, Shinshu University School of Medicine, Asahi 3-1-1, Matsumoto 390, Japan Received 15 November 1989/Accepted 13 February 1990

We induced site-directed mutations near the 3' terminus of the gene repA, which encodes the protein of 288 amino acid residues essential for plasmid Rtsl replication, and obtained seven repA mutants. Three of them contained small deletions at the 3' terminus. Mutant repAzAC4, which encodes a RepA protein that lacks the C-terminal four amino acids, expressed a high-copy-number phenotype and had lost both autorepressor and incompatibility functions. Deletion of one additional amino acid residue to form the RepAzAC5 protein caused restoration of the wild-type copy number and strong incompatibility. Studies of the remaining four repA mutants, each of which contained a single amino acid substitution near the RepA C terminus, suggested that Lys-268 is involved in both ori(Rtsl) activation and autorepressor-incompatibility activities and that Arg-279 contributes to ori(Rtsl) activation but not to incompatibility. Lys-268 is part of a dual-lysine sequence with Lys-267 and is located 21 amino acids upstream of the RepA C terminus. A dual-lysine sequence is also found at a similar position in both mini-F RepE and mini-Pl RepA proteins.

key-Gal plates were prepared by adding galactose to a final concentration of 0.7% to MacConkey agar base (Difco). Chemicals. Restriction endonucleases, T4 DNA ligase, T4 polynucleotide kinase, and alkaline phosphatase C75 were from Takara Shuzo, Kyoto, Japan. Synthesis of oligonucleotides. Oligonucleotides were synthesized on a Zeon Genet A-III synthesizer (Nihon Zeon, Tokyo, Japan) by the phosphoramidite method. The oligonucleotides synthesized were cleaved from the solid support with concentrated NH40H and incubation at 55°C for 5 h and purified by using oligonucleotide purification cartridges (Applied Biosystems, Foster, Calif.) The mutagenic oligonucleotides used contained 17 to 22 nucleotides, with the mismatched base situated approximately in the center as shown in Fig. 1. Oligonucleotide-directed mutagenesis. The HindIIl fragment of pTW119 that contains the wild-type repA gene with its promoter (mini-Rtsl coordinates 1191 to 216) (31) (Fig. 2A) was cloned into the unique HindIII site of M13tv18 replicative-form (RF) DNA with the same orientation as lacZ. The 3' terminus of repA was used as the template for site-directed mutagenesis. We utilized a Mutan-G system (Takara Shuzo) to carry out the mutagenesis by the gapped duplex DNA method of Kramer and Frits (18). The gapped duplex DNA of M13 RF, consisting of one strand with amber mutations (from M13tv18) and the other non-amber mutant strand (from M13mpl8) with PvuII-digested ends, was prepared. The synthetic oligonucleotides were hybridized to the template of the single-strand repA (wild type) inserted in the M13tv18 strand of the gapped duplex. The gapped portion was sealed by synthesis of the complementary strand in extensibn buffer (50 mM Tris hydrochloride [pH 8.0], 60 mM sodium acetate, 5 mM MgCl2, 5 mM dithiothreitol, 1 mM NAD, 0.5 mM each deoxynucleoside triphosphates) in the presence of T4 DNA polymerase and Escherichia coli ligase. The hybrid M13 RF DNA obtained was transfected to E. coli mutS (defective in mismatch repair), and the single-stranded bacteriophage DNAs were recovered, in which the nonamber mutant phage containing the mutagenized repA and

The essential components of the minimal replicon of plasmids F (24), P1 (1), Rtsl (16), R6K (30), and pSC101 (39) are a gene, rep, which encodes Rep protein, and an origin region (ori), which contains direct repeat sequences and DnaA boxes. The Rep protein plays a key role in initiation and regulation of plasmid replication. It binds to the ori sequence, leading to initiation of replication, and also binds to the promoter of rep, resulting in autoregulation of Rep protein synthesis. In addition to these functions, the Rep proteins of P1 (3), R6K (8), and Rtsl (34) inhibit plasmid replication when supplied in excess. Rtsl is the prototype of IncT plasmids (5) and has pleiotropic temperature sensitivities (11, 25, 33, 35). Its minimal replicon, mini-Rtsl, of 1,855 base pairs, codes for the RepA protein consisting of 288 amino acids (16). The replication of mini-Rtsl is also temperature sensitive (12). The DnaA boxes in ori of Rtsl [ori(Rtsl)] are dispensable, but DnaA function of the host is required for mini-Rtsl replication (13). We previously isolated a high-copy mutant, mini-Rtslcopl, that contains a single amino acid substitution (Arg-142 to Lys) in RepA (16) and recently isolated several other repA mutants, which have served for the analysis of the various functions of the protein. It became clear in those studies that the C terminus of RepA was important for its functions, since the repA mutants modified at the 3'-terminal region had lost the initiator function and partially lost the incompatibility and autorepressor activities, depending on the extent of the modification (31). In this study, therefore, we introduced site-directed mutations near the 3' terminus of the repA gene and examined the functions of the mutants obtained. MATERIALS AND METHODS Bacterial strains and plasmids. The bacterial strains and plasmids used are listed in Table 1. Media. L broth (7), Penassay broth (Difco Laboratories, Detroit, Mich.), 2/TY broth (28), and M9 medium (7) with 0.2% glucose were used for cultivation of bacteria. MacCon*

Corresponding author. 2535

2536

ZENG ET AL.

J. BACTERIOL.

TABLE 1. Bacterial strains and plasmids Strain or plasmid

Escherichia coli K-12 strains JM1o0 JC1569 JG112 AB1157 BMH71-18 MV1184

Phage and plasmids M13tv18 pFD51 pACYC184 pKP1013 pTW601 pTW119 pTW1213-Xa pTW11:repA pTW11:repAzc pTW100 pTW100(repAz) a

Genotype or characteristics'

Reference or source

A(lac-proAB) thi supE(F' traD36 proAB lacIqZAM15) recA gal leu his arg met str polA lacY thy str galK lacY ara mtl xyl thr leu pro his arg thi str A(lac-proAB) thi supE mutS2J5::TnlO(Tetr)(F' proAB lacIqZAM15) A(lac-proAB) ara strA thi(480 lacZAM15) (srl-recA)306::TnlO (Tetr)(F' traD36 proAB lacIqZAM15)

22 4 23 10 18 38

18 27 2 21 17 31 31

Promoterless galK Apr Cpr Tcr Mini-F Cpr Spr Mini-Rtsl Spr pBR322 (1191-216)b pFD51 (1213-516)b pACYC184 (1191-216)b pACYC184:repAzc pFD51:ori:repA pFD51:ori:repAzc

This This This This

study study study study

Ap, Ampicillin; Cp, chloramphenicol; Tc, tetracycline; Sp, spectinomycin.

bMini-Rtsl coordinates (16). c

repA contains a mutation near the 3' terminus.

the amber mutant phage carrying the wild-type repA were present. The non-amber mutant recombinant phage was selected by infection of E. coli sup'. The recombinant phage DNAs were isolated, the DNA sequences of the 3'-terminal region of repA were determined by the dideoxy method (29), and the DNAs containing the expected mutations were selected. Cloning of the mutant repA genes and construction of the repA ori(Rtsl) plasmids. The Hindlll fragments of the recombinant M13 RF DNAs, each of which contains the mutated repA gene, were cloned individually into the unique HindIll site of pACYC184 and pFD51:ori(Rtsl). The orientation of the insertion was the same as that of tet in pACYC184 and as that of galK in pFD51:ori(Rtsl). The latter plasmid, pFD51: ori(Rtsl):repA(mutant), was designated a pTW100-type plasmid (Fig. 2B).

Transformation and incompatibility studies. Transformation was carried out by the method of Cohen et al. (6). Incompatibility between pACYC184:repA and mini-Rtsl plasmid was examined by transforming the pACYC184 chimeric DNA into JC1569 harboring pTW601. The transformants that developed on plates containing 10 ,ug of chloramphenicol per ml were picked individually and seeded into plates containing 30 p.g of spectinomycin per ml to check for the presence of the resident plasmid pTW601. Determination of plasmid copy number. As ampicillin resistance is dependent on gene dosage (37), the copy numbers of pTW100-type plasmids were estimated from the drug resistance level conferred on JG112 (polA) harboring these plasmids. The copy numbers were also determined by measuring the plasmid DNA content in JG112 harboring the pTW100-type plasmids along with pKP1013, which was used

5' 3' repA ... TCTATGGTGAAAAAAGGACAAGAGAATTACCTCATCATTCACAAGCGAAGTCCAAAGCTAAGTGTAATCAACGAATAAGTG...

(wild)... AGATACCACTTTTTTCCTGTTCTCTTAATGGAGTAGTAAGTGTTCGCTTCAGGTTTCGATTCACATTAGTTGCTTATTCAC...

SerMetValLysLysGlyGlnGluAsnTyrLeuIleIleHisLysArgSerProLysLeuSerValIleAsnGlu 265

270

275

280

285

z288

288

ATTAGTTGTTTATTCAC (Glu288

-

Lys)

A

TTCACATTAGTTGCTTATTC (Asn287 . Stop) A + TTTCGATTCACATTAGTTGCT (Val285 - Stop)

zAC2 zAC4

A

zAC5

AGGTTTCGATTCACATTAGTT (Ser284

z282

CTTCAGGTCTCGATTCA (Lys282

Glu)

AAGTGTTCCCTTCAGGT (Arg279 -. Gly)

z279 z268

-

Stop)

ACCACTTTGTTCCTGTT (Lys268

-

Gln)

FIG. 1. Oligonucleotides synthesized for site-directed mutagenesis. The nucleotide sequence at the top is the 3'-terminal region of wild-type repA, shown with the amino acid residues of its protein. Numbers below the sequence are the amino acid positions of RepA. Circles above nucleotides indicate the bases altered by substitution. Stop codons are underlined.

Rtsl MUTANT RepA PROTEINS WITH ALTERED FUNCTIONS

VOL. 172, 1990 A. ori incII

mncl

repA 1131

&

268

1403

1855

copl (707) GATC

box 1403

1360

0

1213

P

1191

1165

B.

FIG. 2. Map of mini-Rtsl (A) and a reconstituted mini-Rtsl (B). (A) Numbers are the coordinates of mini-Rtsl, starting at the EcoRI restriction site. The ori-incII region located upstream of the repA gene (the open reading frame, coordinates 1131 to 268) is shown enlarged. The repA promoter (P) (coordinates 1191 to 1165) and the operator (0) (coordinates 1213 to 1191) are indicated. Other features: cop], a single base substitution in the repA at coordinate 707; DnaA, tandem repeat of TTATCCACA sequence; GATC box, four repeats of GATC sequence; incI and incII, five and three iterons, respectively. (B) pTW100 is a reconstituted mini-Rtsl plasmid consisting of ori(Rtsl) (coordinates 1441 to 1194) and the repA gene with its native promoter (coordinates 1191 to 216), which were cloned in pFD51. Note that the inserted ori sequence is inverted in orientation relative to repA, consequently placing the operator sequence (coordinates 1213 to 1191) at the distal end from the promoter. Restriction sites: E, EcoRI; B, BamHI; H, HindIII.

internal standard. Both procedures were as described previously (32). The resistance level was the maximum concentration of ampicillin that allowed development of a considerable number of isolated colonies of the JG112 cells on the plates after 18 h of incubation at 37°C. To determine the plasmid DNA content, crude lysates of doubly infected JG112 cells were prepared by the method of Kado and Liu (14) and electrophoresed in a 0.8% agarose gel. The gel stained with ethidium bromide was photographed with type 665 positive-negative film (Polaroid, Cambridge, Mass.). The film negative was scanned on a Quick Scan scanner (Helena Laboratories, Beaumont, Tex.). galK expression study. The autorepressor activities of the mutant RepA proteins were examined by a galK expression system, as described previously (31). The effector plasmid pACYC184:repA was transferred to a galK host, AB1157, carrying the target plasmid pTW1213-Xa, which contains the promoter-operator sequence of repA in front of the galK structural gene from pFD51. If mutant RepA supplied in trans from the effector plasmid repressed the promoter in the target plasmid, the doubly infected cells formed white colonies on MacConkey-Gal plates containing both ampicillin and chloramphenicol. If no repression occurred, the colonies on the plates were red after 16 h of incubation at 37°C. as an

2537

Preparation of anti-RepA antibody. Purified RepA protein (50 ,ug) (15) emulsified in complete Freund adjuvant was injected three times into a New Zealand White rabbit. The rabbit serum taken 2 weeks after the last injection was absorbed by using a CNBr-activated Sepharose 4B column (Pharmacia, Uppsala, Sweden) coupled with sonicated E. coli JC1569 cells without plasmid. Immunoblot analysis of the mutant RepA proteins. JC1569 cells harboring pACYC184:repA(mutant) plasmids were grown in 1.5 ml of L broth at 37°C. Cells harvested at an optical density at 550 nm of 0.5 were suspended in 100 ,ul of saline. A portion of the suspension (5 ,ul) was used to measure the total protein content by the method of Lowry et al. (20). The remaining suspension was mixed with the same volume of sample buffer (0.125 M Tris hydrochloride [pH 6.8], 20% glycerol, 4% sodium dodecyl sulfate, 10% 2mercaptoethanol, 0.01% bromphenol blue), boiled for 5 min, and centrifuged at 6,500 x g for 5 min. The supernatant was used for immunoblot analysis. The cell lysates were adjusted to contain the same amount of total protein in each well and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis by the method of Laemmli (19). Polypeptides in the gel were transferred to a nitrocellulose filter (pore size, 0.45 ,um) by the method of Towbin et al. (36). The filter was first blocked with bovine serum albumin, treated with antiRepA antibody, and then treated with alkaline phosphataseconjugated second antibody (Promega Biotec, Madison, Wis.) followed by color development as recommended by the supplier. RESULTS Construction of site-directed repA mutants. By the procedure described in Materials and Methods, we obtained seven mutants of repA. Three of them encode RepA proteins with deletions of the last two, four, or five amino acids of the C terminus (named RepAzAC2, RepAzAC4, and RepAzAC5, respectively) which were constructed by introducing premature stop signals near the 3' terminus of repA. The remaining four RepA mutants each contain a single amino acid substitution at amino acid 288, 282, 279, or 268 (named RepAz288, RepAz282, RepAz279, and RepAz268, respectively) (Fig. 1). It should be noted that in the latter three mutants, the positively charged amino acids were substituted with either negatively charged (in RepAz282) or noncharged (in Rep Az279 and RepAz268) amino acids. Incompatibility and autorepressor functions expressed by the cloned mutant repA gene. The HindIII fragments in the M13 RF recombinants, each of which contained a mutant repA gene with its native promoter but without the operator sequence (see Materials and Methods), were isolated and cloned individually into pACYC184 with the same orientation as the tet gene. The 3'-terminal regions of the mutant repA genes (repAz) were sequenced by recloning the HindlIl repAz fragments into M13 from pACYC184:repAz, and the altered sequences were confirmed. The pACYC184:repAz plasmids (named pTW11: repAzAC2, etc.) were used for examining the incompatibility and autorepressor functions of the mutant RepA proteins encoded by the recombinant plasmids (Table 2). The donor plasmids pTW11:repAzAC5 and pTW11:repAz279 excluded completely the resident plasmid pTW601, just as did pTW11: repA(wild), whereas the other five pTW11:repAz plasmids coexisted with pTW601. We previously reported that the operator sequence cloned with its promoter and truncated repA (coordinates 1213 to 516) exhibited strong incompati-

2538

J. BACTERIOL.

ZENG ET AL.

TABLE 2. Incompatibility and autorepressor functions of mutant RepA protein Incompatibility studya No o Donor Donorp plasmid d No. of transformants

pTW11:repA(wild) pTW11:repAzAC2 pTW11:repAzAC4 pTW11:repAzAC5 pTW11:repAz288 pTW11:repAz282 pTW11:repAz279 pTW11:repAz268 pACYC184

1.6 3.3 2.3 2.6 1.5 7.8 1.4 7.5 8.3

x 104 x x x x x x x

10" 10" 10" 10" 10"

10" 103

x 103

Transformants with resident

plasmidc 1 100 97