Nucleic Acids Research, Vol. 18, No. 24 7407
Structure and function of the enhancer 3' to the human Aoy globin gene Mary Purucker*, David Bodine, Henry Lin1, Kevin McDonagh and Arthur W.Nienhuis Clinical Hematology Branch, National Heart, Lung and Blood Institute, Bethesda, MD 20892 and 'Division of Medical Genetics, Research and Education Institute, Harbor-UCLA Medical Center, Torrance, CA 90502, USA Received June 26, 1990; Revised and Accepted October 29, 1990
ABSTRACT An enhancer is located immediately 3' to the Agamma globin gene. We have used DNase I footprinting to map the sites of interaction of nuclear proteins with the DNA sequences of this enhancer. Eight footprints were discovered, distributed over 600 base pairs of DNA. Three of these contain a consensus binding site for the erythroid specific factor GATA-1. Each of these GATA-1 sites had an enhancer activity when inserted into a reporter plasmid and tested in human erythroleukemia cells. Other footprints within the enhancer contained consensus binding sequences for the ubiquitous, positive regulatory proteins AP2 and CBP-1. An Spl-like recognition sequence was also identified. Synthetic oligonucleotides encompassing two of the footprints generated a slowly migrating complex in gel mobility shift assays. The same complex forms on a fragment of the human gamma globin gene promoter extending from 260 to 200. The DNasel footprint of this protein complex with the enhancer overlapped a sequence, AGGAGGA, found within the binding site for a protein that interacts with the chicken beta globin promoter and enhancer, termed the stage selector element. We propose that this complex of proteins may be involved in the human gamma globin promoterenhancer interaction. -
-
INTRODUCTION The human gamma globin genes, part of the beta-like globin multigene family, exhibit both tissue and developmentally specific expression. The duplicated gamma genes are transcriptionally silent during the embryonic phase of development but are expressed at a high level during the last two trimesters of gestation. A second developmental switch subsequently occurs in which the adult beta genes are activated and the gamma genes again become quiescent (reviewed in 1). Local and remote cisacting DNA regulatory sequences in combination with transacting nuclear factors are believed to control these developmental switches.
Local control elements include the promoters and enhancers of the individual beta-like globin genes. Each of the promoters (2,3,4) contain TATAA (5,6), CCAAT (7,8,9,10,11,12), and CACCC motifs (2,3,8,13) as well as binding sites for tissue (14,15,16,17) and possibly stage specific (18,19,20) factors. The chicken A beta promoter has been shown to interact with a downstream enhancer, located equidistant from the embryonic epsilon promoter. This enhancer has been shown to mediate a 50-100 fold increase in transcription from the A beta promoter in primary erythroid cells (21,22). Most of the enhancing activity can be localized to two binding sites for the erythroid-specific factor GATA-1 (23), formerly called, Eryfl (14,15), globin factor-l (GF-1) (16), or nuclear factor-erythroid 1 (NF-E1) (17), that also binds to sites in the promoter. In addition to its effect on transcription, this enhancer is believed to control the switch between epsilon and beta globin synthesis by competitive interaction during development with the promoter of one or the other gene. This interaction may be mediated by an erythroid specific factor NF-E4 and the 'stage selector element' ('SSE'; 19,24). At least four regions with enhancer activity have been identified within the human beta-like gene locus. The strongest activity coincides with a DNase I superhypersensitive site 10.9 Kb upstream from the epsilon gene originally identified by Tuan (25) within the locus activating (LAR) (26) or dominant control region (DCR) (27), now called the Locus Control Region or LCR (23). This enhancer consists of two tandem API binding sites and has the property of increasing gamma promoter function during hemin induced maturation of erythroleukemia cells (28). The beta gene has two enhancers, one within the third exon (29,30) and the other 550 bp downstream of the gene (17,29,31,32). The downstream enhancer encodes four binding sites for GATA-1 and is capable of increasing beta promoter expression 10-fold in transient assays (16,30). The fourth known enhancer is associated with the gamma genes and maps 3' to the A gamma gene (33). The human gamma enhancer was first identified in a screen of 22 kb of DNA surrounding the duplicated gamma genes. It was localized to a 750 bp EcoRI-HindIll fragment located 400
* To whom correspondence should be addressed at National Institutes of Health, 9000 Rockville Pike, USA
Building 10,
Room
7C-103, Bethesda, MD 20892,
7408 Nucleic Acids Research, Vol. 18, No. 24 bp downstream of the A gamma gene polyA site. This enhancer increased transcriptional expression 6-23 fold from a linked gamma promoter-reporter gene construct and from other promoters in erythroid and nonerythroid cells (33). We have demonstrated binding sites for both erythroid specific and ubiquitous proteins within this enhancer and identified a protein(s) that interacts with both the gamma promoter and enhancer. Enhancer activity was shown to be distributed over the 750 bp fragment and associated with binding sites for GATA-1.
MATERIALS AND METHODS Oligonucleotides Oligonucleotides were synthesized on an Applied Biosystems DNA Synthesizer Model 3808 using phosphoramidite chemistry. The oligonucleotides were purified on OPC Cartridges (Applied Biosystems), by HPLC, or by electrophoresis in denaturing acrylamide gels. Oligonucleotides based on sequences in the Agamma enhancer were subcloned in a derivative of a pUC plasmid (28) for subsequent use. Oligonucleotides were numbered according to the convention used in Figure 3: I: nt 1-70 flanked by EcoRI (5') and BglII (3') sites II: nt 119-147 flanked by XhoI (5') and HindIll (3') sites III: nt 213 flanked by Sall sites (5' and 3') IV: nt 297 -356 flanked by Sall (5') and XhoI (3') sites V: nt 440-466 flanked by Apal (5') and Sall (3') sites VI: nt 471 -521 flanked by XhoI (5') and SalI (3') sites VII: nt 525-550 flanked by XhoI (5') and Sall (3') sites VIII: nt 581-620 flanked by XhoI (5') and Sall (3') sites The following additional oligonucleotides were utilized: Gamma Promoter: wt-bp -260 to -200. Mutants 1-10: -260 to -200 with 6 bp substitutions (34). AP2: 5' 6AACTGACCGCCCGCGGCCCGTG 3' (35). CCAAT: Sequence from the gamma promoter between - 130 to -54 (7,36). CAC: Sequence from the gamma promoter between - 163 to -128 (8). Spi: 5' CCCCGCCCCG 3' (37). Beta Enhancer: 5' GTCTGCTGGCTCCCTTATCATGTCCC 3' (17). -175: Sequence from the gamma promoter between -199 to -163 (8,16). The G-free cassette is a 400 bp DNA fragment which lacks cytidine residues on the sense strand and hence would generate a transcript with no guanosine residues (38). It was used as a 'neutral' control in transient expression assays.
create a gamma promoter-luciferase reporter construct. This 3066 bp reporter gene was excised using BamH 1 sites and cloned into a pUC9 or pUC007 vector containing a single enhancer or oligonucleotide fragment. In each case, the relative orientations of the gamma promoter-luciferase reporter gene and the enhancer fragment were determined using asymmetric restriction enzymes sites or by direct sequencing within the polylinker. Only those clones which preserved the genomic orientation of the two regulatory regions were analyzed further.
Transient assays K562 cells (43) were grown in 3 liter rotary Wheaton Magnaflex flasks using RPMI media (Biofluids) supplemented with 5 % fetal bovine serum, glutamine, penicillin, and streptomycin. Cells were harvested in midlog phase, washed once using HBSS without calcium or magnesium (Biofluids), and resuspended in this same buffer to a total concentration of approximately 1.3 x 108 cells/ml. Aliquots containing 3.2 x 107 cells and 324g of supercoiled plasmid DNA in a total volume of 320Au were transferred to a 0.4cm electrode Gene Pulser Cuvette (Biorad) and electroporated as described by Potter (44) using a Biorad Gene Pulser set at .25 kV and 960 mliF. Supercoiled DNA consisted of 24Ag test plasmid and 8,gg pUC9 carrier DNA. All transfections were performed in triplicate. Following electroporation, cells were allowed to recover in supplemented RPMI media for exactly 48 hours. The cells were harvested, lysed by three cycles of freeze-thaw, and the protein concentration of the cleared lysate was determined using the Biorad protein assay reagent according to manufacturer's instructions (Biorad). Seventy-five jig protein from each transfection was analyzed for luciferase activity as described by deWet (42) using a Monolight 2001 luminometer (Analytical Luminescence Labortories). Nuclear Extracts Nuclear extracts were prepared from a total of 109 cells as described by Dignam (45) except that the protease inhibiters
L
30 I XY
40
50
LL
.
60 9Kb y promoter
Relaative Actitivity
1
2
1
Rsal 1 2
EcoRI
2 I
Plasmid Constructions The 750 nt EcoRI-HindiH minimal enhancer described by Bodine and Ley (33) was cleaved into overlapping and nonoverlapping fragments (Fig. 1,2). Fragments were next blunt-ended using mung bean nuclease under standard conditions (39) and cloned into the SmaI site of pUC9 (40). In the case of the oligonucleotides II, V, and VII (Fig. 4), fragments were cloned into the polylinker of pUC007 (28) and oligo sequences were verified via sequencing using the dideoxy chain termination method (41). The Agamrma promoter segment (-384 to -26 relative to the CAP site) (33) was inserted between the BglII and HindIll sites of the luciferase expression vector pSV232ALA delta S (42) to
20
10 e
1
3
750 bp
Hind III
SstI
±71
264±67 3
1
480±51
523±98 2
513±86 3
Enhancer
fragments
480±114
-G-free casette"
100:17
y promoter alone
100%
Figure 1. Schematic representation of the human Beta gene cluster showing the location of the 3' A gamma enhancer. The 750 bp EcoRI-HindlIl fragment containing enhancer activity (33) and several subfragments were cloned into the luciferase vector (42) shown at the right. Plasmid DNA was electroporated into K562 cells and transient expression assays were performed. The activity of each subclone relative to the vector without an enhancer is shown. The error values shown are the 95 percent confidence intervals (49).
..: 3_J=:B*w.
Nucleic Acids Research, Vol. 18, No. 24 7409
leupeptin (25 .tg/ml), aprotinin (50 Atg/ml), and pepstatin (1 Ag/ml) were added to the nuclear lysis buffer. The protein concentration was usually 10mg/ml with a total yield of approximately 20mg of protein from 109 cells.
Assays of DNA-protein interactions DNase I footprinting studies were carried out as described by Wall (17) using a total of 3000cpm labeled probe and 10pg K562 nuclear extract. Sequencing reactions yielding purine-specific DNA cleavages were prepared as described by Maxam and Gilbert (46) and were utilized as standards on all analytical gels. Electrophoresis was carried out through 6% denaturing polyacrylamide gels under standard conditions (39). Gel mobility shift assays were performed exacdly as described by Yoshida (47) except that probes were prepared from synthetic oligonucleotides
A.
3' end labeled using 32PdNTP's and Klenow fragment under standard conditions (39) and binding reactions were carried out at 0.8 mM MgCl. Copper phenanthroline cleavage of DNAprotein complexes was carried out as described (48). Products were analyzed on 8% denaturing polyacrlyamide gels.
RESULTS
Enhancer Activity is Distributed Throughout the 750 Base Pair Fragment A survey of the gamma and beta globin gene region has previously identified enhancer activity within a 750 bp EcoRIHindHI fragment 3' to the A gamma globin gene (Figure 1; 33). Our initial experiments were directed toward localizing and determining the structural basis for the enhancer activity within B.
SENSE
ANTISENSE
ExtJant
o _
0 - 45 - 65 - 130 - 140 -
-
182 195
"
(1)
"
(I1
(11}
SENSE
393
-
*-
-
1-
*
Z:
-
750
447
- 330
.
_
-457 r - 476 1 -500A - 522 ' -545 i
V
_
s.... F
* _
..
-
-140
592 1
-615
=130
i
^ ....
w .w
-512 -592
l SIIl
^ jj.
::
w E X. .,F. E. w.
-
-
-193 - 179
i i
- s: s
;~
ANTISENSE
Extract 393
VIII
^ =
?X
?'
'::
.::^}.
- 545
-.
11
- 511
^
* .wO
s*,.. .*....
=: w
- 490
1
-410
i
-462
-]
s
U
** '* s B¢.S,@
*
::a
s
- 304
s
_Ki ORG
- ..:...
..
4*:..:. Z.w.:..ii
I
...w.
i_
s .. SF
I-
-
*:
330
-66
..w.
s ,g...... g ...i
4..
::.
:::.
w :
, .. ....
sf
.,^.
- 448
-
, W.::
^
rD
:::
...:
r?.e.
V
...i
::
..
z
z
y
-32
44
Z-
393
393
353
0 Eco RI
Sense Antisense -3
A.
393
Ava II 3 15 5
B.
750 Hirndi lII 3
13
Figure 2. DNase I footprint analysis of the 750 bp enhancer. On each panel the first lane contains a Maxam and Gilbert (46) sequencing ladder. Lanes labeled (-) indicate DNase I digestion without added extract and (+) indicate digestion following the addition of 10 ug of K562 nuclear extract. In each case a titration of increasing DNase I was performed and lanes selected that exhibited equivalent digestion. The titration is shown for the antisense strand in Panel A. The enhancer was cleaved at the unique central AvaIl site and two fragments, A and B, were analyzed separately. The data for each are shown in the corresponding panel of the figure. Numbers indicate the position of the footprint or nucleotide relative to the 5' end of the enhancer. A: Sense and antisense strands of fragment A demonstrate the presence of four footprinted regions. The first 6 lanes contain the same probe run for 3 hours (first three lanes) or 1.5 hours (second three lanes) to visualize different ends of the fragment. The series of lanes labeled antisense demonstrate DNaseI (U.S. Biochemicals) titration using 0.1, 0.2, 0.3, 1.0, 2.0, or 3.0x 10-2 units of DNase I per digestion for one minute at room temperature (46). B: Sense and antisense strands of subclone B demonstrate the presence of four additional footprinted regions.
7410 Nucleic Acids Research, Vol. 18, No. 24 this fragment. The intact fragment and five overlapping or discrete subfragments were subcloned into a reporter plasmid containing the gamma promoter linked to the luciferase gene. An initial series of experiments were done using as an internal control a chloramphenicol acetyl transferase (CAT) reporter gene linked to the B19 or RSV promoter. However, the level of expression from the luciferase reporter construct was influenced by the presence and amount of the internal control plasmid suggesting competition for shared factors (data not shown). Similarly, reducing the amount of control plasmid relative to the test plasmid resulted in an influence on the control activity by the test plasmid (H.Lin and A.W.Nienhuis, unpublished observations). Subsequent experiments were performed without an internal control but in replicate and on multiple occasions to verify reproducibility. Shown in Figure 1 are the enhancer activities of the entire fragment and the various subfragments. The data displayed are the mean and 95 percent confidence interval (49) of 5 to 8 determinations with each construct done in two or three separate experiments with two different plasmid preparations. Each of the individual determinations represented a separate electroporation. Before calculation of the relative activity of the various constructs, the luciferase activity obtained with a plasmid lacking the gamma promoter was subtracted; this value averaged 3-4 percent of the activity of the construct containing both promoter and intact enhancer. We have previously established that the gamma promoter gives predominantly correctly initiated transcripts in K562 cells (28,33).
encompassing footprint V was subjected to copper phenanthroline footprint analysis demonstrating protection of the consensus GATA-1 sequence (Figure 4C). Additional retarded bands identified with 2 of the 3 probes (II and VII) represent interaction with proteins present in erythroid and non-erythroid cells. The slowly migrating band generated with the site II probe co-migrated with a band generated with a gamma promoter probe encompassing nucleotides - 130 to -50. The promoter band has previously been indentified as CBP-1 (7,36). Cross-competition for binding of this protein was also demonstrated between the two probes (data not shown). A binding sequence for CBP- 1 (CCAAT) is present within site II, overlapping the GATA- 1 binding site. These data are supportive of a CBP-1 binding site within footprint II. The synthetic oligonucleotides corresponding to footprints II, V, and VII were subcloned in the enhancer position of the reporter plasmid (Figure 1). In replicate assays, each gave a 4-5 fold augmentation of activity compared to that observed with the reporter plasmid lacking an enhancer fragment (Figure 4D). The contribution of CBP-1 binding to the activity of footprint II has not been resolved.
~~~~~~~~~~~~~~~~~~~~~~~~~
Structure and function of the enhancer 3' to the human Aoy globin gene Mary Purucker*, David Bodine, Henry Lin1, Kevin McDonagh and Arthur W.Nienhuis Clinical Hematology Branch, National Heart, Lung and Blood Institute, Bethesda, MD 20892 and 'Division of Medical Genetics, Research and Education Institute, Harbor-UCLA Medical Center, Torrance, CA 90502, USA Received June 26, 1990; Revised and Accepted October 29, 1990
ABSTRACT An enhancer is located immediately 3' to the Agamma globin gene. We have used DNase I footprinting to map the sites of interaction of nuclear proteins with the DNA sequences of this enhancer. Eight footprints were discovered, distributed over 600 base pairs of DNA. Three of these contain a consensus binding site for the erythroid specific factor GATA-1. Each of these GATA-1 sites had an enhancer activity when inserted into a reporter plasmid and tested in human erythroleukemia cells. Other footprints within the enhancer contained consensus binding sequences for the ubiquitous, positive regulatory proteins AP2 and CBP-1. An Spl-like recognition sequence was also identified. Synthetic oligonucleotides encompassing two of the footprints generated a slowly migrating complex in gel mobility shift assays. The same complex forms on a fragment of the human gamma globin gene promoter extending from 260 to 200. The DNasel footprint of this protein complex with the enhancer overlapped a sequence, AGGAGGA, found within the binding site for a protein that interacts with the chicken beta globin promoter and enhancer, termed the stage selector element. We propose that this complex of proteins may be involved in the human gamma globin promoterenhancer interaction. -
-
INTRODUCTION The human gamma globin genes, part of the beta-like globin multigene family, exhibit both tissue and developmentally specific expression. The duplicated gamma genes are transcriptionally silent during the embryonic phase of development but are expressed at a high level during the last two trimesters of gestation. A second developmental switch subsequently occurs in which the adult beta genes are activated and the gamma genes again become quiescent (reviewed in 1). Local and remote cisacting DNA regulatory sequences in combination with transacting nuclear factors are believed to control these developmental switches.
Local control elements include the promoters and enhancers of the individual beta-like globin genes. Each of the promoters (2,3,4) contain TATAA (5,6), CCAAT (7,8,9,10,11,12), and CACCC motifs (2,3,8,13) as well as binding sites for tissue (14,15,16,17) and possibly stage specific (18,19,20) factors. The chicken A beta promoter has been shown to interact with a downstream enhancer, located equidistant from the embryonic epsilon promoter. This enhancer has been shown to mediate a 50-100 fold increase in transcription from the A beta promoter in primary erythroid cells (21,22). Most of the enhancing activity can be localized to two binding sites for the erythroid-specific factor GATA-1 (23), formerly called, Eryfl (14,15), globin factor-l (GF-1) (16), or nuclear factor-erythroid 1 (NF-E1) (17), that also binds to sites in the promoter. In addition to its effect on transcription, this enhancer is believed to control the switch between epsilon and beta globin synthesis by competitive interaction during development with the promoter of one or the other gene. This interaction may be mediated by an erythroid specific factor NF-E4 and the 'stage selector element' ('SSE'; 19,24). At least four regions with enhancer activity have been identified within the human beta-like gene locus. The strongest activity coincides with a DNase I superhypersensitive site 10.9 Kb upstream from the epsilon gene originally identified by Tuan (25) within the locus activating (LAR) (26) or dominant control region (DCR) (27), now called the Locus Control Region or LCR (23). This enhancer consists of two tandem API binding sites and has the property of increasing gamma promoter function during hemin induced maturation of erythroleukemia cells (28). The beta gene has two enhancers, one within the third exon (29,30) and the other 550 bp downstream of the gene (17,29,31,32). The downstream enhancer encodes four binding sites for GATA-1 and is capable of increasing beta promoter expression 10-fold in transient assays (16,30). The fourth known enhancer is associated with the gamma genes and maps 3' to the A gamma gene (33). The human gamma enhancer was first identified in a screen of 22 kb of DNA surrounding the duplicated gamma genes. It was localized to a 750 bp EcoRI-HindIll fragment located 400
* To whom correspondence should be addressed at National Institutes of Health, 9000 Rockville Pike, USA
Building 10,
Room
7C-103, Bethesda, MD 20892,
7408 Nucleic Acids Research, Vol. 18, No. 24 bp downstream of the A gamma gene polyA site. This enhancer increased transcriptional expression 6-23 fold from a linked gamma promoter-reporter gene construct and from other promoters in erythroid and nonerythroid cells (33). We have demonstrated binding sites for both erythroid specific and ubiquitous proteins within this enhancer and identified a protein(s) that interacts with both the gamma promoter and enhancer. Enhancer activity was shown to be distributed over the 750 bp fragment and associated with binding sites for GATA-1.
MATERIALS AND METHODS Oligonucleotides Oligonucleotides were synthesized on an Applied Biosystems DNA Synthesizer Model 3808 using phosphoramidite chemistry. The oligonucleotides were purified on OPC Cartridges (Applied Biosystems), by HPLC, or by electrophoresis in denaturing acrylamide gels. Oligonucleotides based on sequences in the Agamma enhancer were subcloned in a derivative of a pUC plasmid (28) for subsequent use. Oligonucleotides were numbered according to the convention used in Figure 3: I: nt 1-70 flanked by EcoRI (5') and BglII (3') sites II: nt 119-147 flanked by XhoI (5') and HindIll (3') sites III: nt 213 flanked by Sall sites (5' and 3') IV: nt 297 -356 flanked by Sall (5') and XhoI (3') sites V: nt 440-466 flanked by Apal (5') and Sall (3') sites VI: nt 471 -521 flanked by XhoI (5') and SalI (3') sites VII: nt 525-550 flanked by XhoI (5') and Sall (3') sites VIII: nt 581-620 flanked by XhoI (5') and Sall (3') sites The following additional oligonucleotides were utilized: Gamma Promoter: wt-bp -260 to -200. Mutants 1-10: -260 to -200 with 6 bp substitutions (34). AP2: 5' 6AACTGACCGCCCGCGGCCCGTG 3' (35). CCAAT: Sequence from the gamma promoter between - 130 to -54 (7,36). CAC: Sequence from the gamma promoter between - 163 to -128 (8). Spi: 5' CCCCGCCCCG 3' (37). Beta Enhancer: 5' GTCTGCTGGCTCCCTTATCATGTCCC 3' (17). -175: Sequence from the gamma promoter between -199 to -163 (8,16). The G-free cassette is a 400 bp DNA fragment which lacks cytidine residues on the sense strand and hence would generate a transcript with no guanosine residues (38). It was used as a 'neutral' control in transient expression assays.
create a gamma promoter-luciferase reporter construct. This 3066 bp reporter gene was excised using BamH 1 sites and cloned into a pUC9 or pUC007 vector containing a single enhancer or oligonucleotide fragment. In each case, the relative orientations of the gamma promoter-luciferase reporter gene and the enhancer fragment were determined using asymmetric restriction enzymes sites or by direct sequencing within the polylinker. Only those clones which preserved the genomic orientation of the two regulatory regions were analyzed further.
Transient assays K562 cells (43) were grown in 3 liter rotary Wheaton Magnaflex flasks using RPMI media (Biofluids) supplemented with 5 % fetal bovine serum, glutamine, penicillin, and streptomycin. Cells were harvested in midlog phase, washed once using HBSS without calcium or magnesium (Biofluids), and resuspended in this same buffer to a total concentration of approximately 1.3 x 108 cells/ml. Aliquots containing 3.2 x 107 cells and 324g of supercoiled plasmid DNA in a total volume of 320Au were transferred to a 0.4cm electrode Gene Pulser Cuvette (Biorad) and electroporated as described by Potter (44) using a Biorad Gene Pulser set at .25 kV and 960 mliF. Supercoiled DNA consisted of 24Ag test plasmid and 8,gg pUC9 carrier DNA. All transfections were performed in triplicate. Following electroporation, cells were allowed to recover in supplemented RPMI media for exactly 48 hours. The cells were harvested, lysed by three cycles of freeze-thaw, and the protein concentration of the cleared lysate was determined using the Biorad protein assay reagent according to manufacturer's instructions (Biorad). Seventy-five jig protein from each transfection was analyzed for luciferase activity as described by deWet (42) using a Monolight 2001 luminometer (Analytical Luminescence Labortories). Nuclear Extracts Nuclear extracts were prepared from a total of 109 cells as described by Dignam (45) except that the protease inhibiters
L
30 I XY
40
50
LL
.
60 9Kb y promoter
Relaative Actitivity
1
2
1
Rsal 1 2
EcoRI
2 I
Plasmid Constructions The 750 nt EcoRI-HindiH minimal enhancer described by Bodine and Ley (33) was cleaved into overlapping and nonoverlapping fragments (Fig. 1,2). Fragments were next blunt-ended using mung bean nuclease under standard conditions (39) and cloned into the SmaI site of pUC9 (40). In the case of the oligonucleotides II, V, and VII (Fig. 4), fragments were cloned into the polylinker of pUC007 (28) and oligo sequences were verified via sequencing using the dideoxy chain termination method (41). The Agamrma promoter segment (-384 to -26 relative to the CAP site) (33) was inserted between the BglII and HindIll sites of the luciferase expression vector pSV232ALA delta S (42) to
20
10 e
1
3
750 bp
Hind III
SstI
±71
264±67 3
1
480±51
523±98 2
513±86 3
Enhancer
fragments
480±114
-G-free casette"
100:17
y promoter alone
100%
Figure 1. Schematic representation of the human Beta gene cluster showing the location of the 3' A gamma enhancer. The 750 bp EcoRI-HindlIl fragment containing enhancer activity (33) and several subfragments were cloned into the luciferase vector (42) shown at the right. Plasmid DNA was electroporated into K562 cells and transient expression assays were performed. The activity of each subclone relative to the vector without an enhancer is shown. The error values shown are the 95 percent confidence intervals (49).
..: 3_J=:B*w.
Nucleic Acids Research, Vol. 18, No. 24 7409
leupeptin (25 .tg/ml), aprotinin (50 Atg/ml), and pepstatin (1 Ag/ml) were added to the nuclear lysis buffer. The protein concentration was usually 10mg/ml with a total yield of approximately 20mg of protein from 109 cells.
Assays of DNA-protein interactions DNase I footprinting studies were carried out as described by Wall (17) using a total of 3000cpm labeled probe and 10pg K562 nuclear extract. Sequencing reactions yielding purine-specific DNA cleavages were prepared as described by Maxam and Gilbert (46) and were utilized as standards on all analytical gels. Electrophoresis was carried out through 6% denaturing polyacrylamide gels under standard conditions (39). Gel mobility shift assays were performed exacdly as described by Yoshida (47) except that probes were prepared from synthetic oligonucleotides
A.
3' end labeled using 32PdNTP's and Klenow fragment under standard conditions (39) and binding reactions were carried out at 0.8 mM MgCl. Copper phenanthroline cleavage of DNAprotein complexes was carried out as described (48). Products were analyzed on 8% denaturing polyacrlyamide gels.
RESULTS
Enhancer Activity is Distributed Throughout the 750 Base Pair Fragment A survey of the gamma and beta globin gene region has previously identified enhancer activity within a 750 bp EcoRIHindHI fragment 3' to the A gamma globin gene (Figure 1; 33). Our initial experiments were directed toward localizing and determining the structural basis for the enhancer activity within B.
SENSE
ANTISENSE
ExtJant
o _
0 - 45 - 65 - 130 - 140 -
-
182 195
"
(1)
"
(I1
(11}
SENSE
393
-
*-
-
1-
*
Z:
-
750
447
- 330
.
_
-457 r - 476 1 -500A - 522 ' -545 i
V
_
s.... F
* _
..
-
-140
592 1
-615
=130
i
^ ....
w .w
-512 -592
l SIIl
^ jj.
::
w E X. .,F. E. w.
-
-
-193 - 179
i i
- s: s
;~
ANTISENSE
Extract 393
VIII
^ =
?X
?'
'::
.::^}.
- 545
-.
11
- 511
^
* .wO
s*,.. .*....
=: w
- 490
1
-410
i
-462
-]
s
U
** '* s B¢.S,@
*
::a
s
- 304
s
_Ki ORG
- ..:...
..
4*:..:. Z.w.:..ii
I
...w.
i_
s .. SF
I-
-
*:
330
-66
..w.
s ,g...... g ...i
4..
::.
:::.
w :
, .. ....
sf
.,^.
- 448
-
, W.::
^
rD
:::
...:
r?.e.
V
...i
::
..
z
z
y
-32
44
Z-
393
393
353
0 Eco RI
Sense Antisense -3
A.
393
Ava II 3 15 5
B.
750 Hirndi lII 3
13
Figure 2. DNase I footprint analysis of the 750 bp enhancer. On each panel the first lane contains a Maxam and Gilbert (46) sequencing ladder. Lanes labeled (-) indicate DNase I digestion without added extract and (+) indicate digestion following the addition of 10 ug of K562 nuclear extract. In each case a titration of increasing DNase I was performed and lanes selected that exhibited equivalent digestion. The titration is shown for the antisense strand in Panel A. The enhancer was cleaved at the unique central AvaIl site and two fragments, A and B, were analyzed separately. The data for each are shown in the corresponding panel of the figure. Numbers indicate the position of the footprint or nucleotide relative to the 5' end of the enhancer. A: Sense and antisense strands of fragment A demonstrate the presence of four footprinted regions. The first 6 lanes contain the same probe run for 3 hours (first three lanes) or 1.5 hours (second three lanes) to visualize different ends of the fragment. The series of lanes labeled antisense demonstrate DNaseI (U.S. Biochemicals) titration using 0.1, 0.2, 0.3, 1.0, 2.0, or 3.0x 10-2 units of DNase I per digestion for one minute at room temperature (46). B: Sense and antisense strands of subclone B demonstrate the presence of four additional footprinted regions.
7410 Nucleic Acids Research, Vol. 18, No. 24 this fragment. The intact fragment and five overlapping or discrete subfragments were subcloned into a reporter plasmid containing the gamma promoter linked to the luciferase gene. An initial series of experiments were done using as an internal control a chloramphenicol acetyl transferase (CAT) reporter gene linked to the B19 or RSV promoter. However, the level of expression from the luciferase reporter construct was influenced by the presence and amount of the internal control plasmid suggesting competition for shared factors (data not shown). Similarly, reducing the amount of control plasmid relative to the test plasmid resulted in an influence on the control activity by the test plasmid (H.Lin and A.W.Nienhuis, unpublished observations). Subsequent experiments were performed without an internal control but in replicate and on multiple occasions to verify reproducibility. Shown in Figure 1 are the enhancer activities of the entire fragment and the various subfragments. The data displayed are the mean and 95 percent confidence interval (49) of 5 to 8 determinations with each construct done in two or three separate experiments with two different plasmid preparations. Each of the individual determinations represented a separate electroporation. Before calculation of the relative activity of the various constructs, the luciferase activity obtained with a plasmid lacking the gamma promoter was subtracted; this value averaged 3-4 percent of the activity of the construct containing both promoter and intact enhancer. We have previously established that the gamma promoter gives predominantly correctly initiated transcripts in K562 cells (28,33).
encompassing footprint V was subjected to copper phenanthroline footprint analysis demonstrating protection of the consensus GATA-1 sequence (Figure 4C). Additional retarded bands identified with 2 of the 3 probes (II and VII) represent interaction with proteins present in erythroid and non-erythroid cells. The slowly migrating band generated with the site II probe co-migrated with a band generated with a gamma promoter probe encompassing nucleotides - 130 to -50. The promoter band has previously been indentified as CBP-1 (7,36). Cross-competition for binding of this protein was also demonstrated between the two probes (data not shown). A binding sequence for CBP- 1 (CCAAT) is present within site II, overlapping the GATA- 1 binding site. These data are supportive of a CBP-1 binding site within footprint II. The synthetic oligonucleotides corresponding to footprints II, V, and VII were subcloned in the enhancer position of the reporter plasmid (Figure 1). In replicate assays, each gave a 4-5 fold augmentation of activity compared to that observed with the reporter plasmid lacking an enhancer fragment (Figure 4D). The contribution of CBP-1 binding to the activity of footprint II has not been resolved.
~~~~~~~~~~~~~~~~~~~~~~~~~
