Mitochondrial DNA The Journal of DNA Mapping, Sequencing, and Analysis
ISSN: 1940-1736 (Print) 1940-1744 (Online) Journal homepage: http://www.tandfonline.com/loi/imdn20
The complete mitochondrial genome of Parnassius imperator (Lepidoptera: Papilionidae: Parnassiinae) Yunliang Wang, Yanhong Chen, Chenchen Xia, Xueqin Xia, Xiao Chen & Jiasheng Hao To cite this article: Yunliang Wang, Yanhong Chen, Chenchen Xia, Xueqin Xia, Xiao Chen & Jiasheng Hao (2014): The complete mitochondrial genome of Parnassius imperator (Lepidoptera: Papilionidae: Parnassiinae), Mitochondrial DNA To link to this article: http://dx.doi.org/10.3109/19401736.2014.971277
Published online: 20 Oct 2014.
Submit your article to this journal
Article views: 17
View related articles
View Crossmark data
Citing articles: 1 View citing articles
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=imdn20 Download by: [Texas A & M International University]
Date: 05 November 2015, At: 16:48
http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–2 ! 2014 Informa UK Ltd. DOI: 10.3109/19401736.2014.971277
MITOGENOME ANNOUNCEMENT
The complete mitochondrial genome of Parnassius imperator (Lepidoptera: Papilionidae: Parnassiinae) Yunliang Wang, Yanhong Chen, Chenchen Xia, Xueqin Xia, Xiao Chen, and Jiasheng Hao
Downloaded by [Texas A & M International University] at 16:48 05 November 2015
Laboratory of Molecular Evolution and Biodiversity, College of Life Sciences, Anhui Normal University, Wuhu, People’s Republic of China
Abstract
Keywords
The complete mitochondrial genome (mitogenome) of Parnassius imperator (Lepidoptera: Parnassiinae) is a circular molecule of 15,424 bp in length, containing 37 typical insect mitochondrial genes and one non-coding A + T-rich region. Its gene order and arrangement are identical to the common type found in most lepidopteran mitogenomes. All protein-coding genes (PCGs) start with a typical ATN initiation codon, except for the cox1, which is initiated by the CGA codon as observed in other lepidopteran species. Some PCGs use standard TAA, while others use TAG (nad1) or incomplete codon T (cox1 and cox2), as their termination codons. 15 intergenic spacers (175 bp in total) and 10 overlapping sequences (29 bp in total) are dispersed throughout the whole genome. The 491 bp long A+ T-rich region contains some conserved structures similar to those found in other lepidopteran mitogenomes, such as the motif ATAGA followed by an 18-bp poly-T stretch, a microsatellite-like (AT)6 element preceded by the ATTTA motif. In addition, a 36 bp sequence stretch potential to form stem-loop structures is also found in the A+ T-rich region.
Complete mitochondrial genome, Papilionidae, Parnassius imperator, Parnassiinae
The Parnassius butterflies include about 50 species, mostly distributed in high mountains or alpine habitats. Due to the morphological characteristics among Parnassius species is not obvious, the utilization of molecular techniques to study their phylogeny and systematics is clearly necessary (Condamine et al., 2013). Up to date, only three Parnassius complete mitochondrial genomes have been reported (Chen et al., 2014; Dong et al., 2014; Kim et al., 2009). Here, we presented the complete mitogenome sequence of Parnassius imperator, one representative species of the genus, with the aim of providing more molecular data for the Parnassiinae taxonomic and phylogenetic studies. The complete P. imperator mitogenome was 15,424 bp in length, containing 13 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs), 2 ribosomal RNA genes (rrnL and rrnS) and one non-coding A+ T-rich region. The order and orientation of these genes were identical to those in other lepidopteran insects. The nucleotide composition of the genome is significantly A+ T biased (81.1%). Besides the A+ T-rich region, 15 intergenic spacers ranging from 1 to 69 bp (175 bp in total) and 10 overlapping sequences from 1 to 8 bp (29 bp in total) are dispersed throughout the whole genome (Table 1). All PCGs were initiated by a typical ATN codon, except for the cox1, which used CGA as its start codon. Eleven PCGs used TAA or TAG as their stop codons, while the cox1 and cox2 ended with
History Received 14 September 2014 Accepted 26 September 2014 Published online 20 October 2014
a single T (Table 1). This case is also frequently found in most lepidopteran mitogenomes sequenced to date (Hao et al., 2013, Kim et al., 2011; Shi et al., 2012; Wu et al., 2010; Xia et al., 2011). All tRNAs could be folded into the typical cloverleaf secondary structures except for trnS1(AGN), whose dihydrouridine (DHU) arm was replaced by a simple loop, as seen in all other determined butterfly species (Hao et al., 2013; Hong et al., 2009; Park et al., 2012). The rrnL and rrnS genes were 350 bp and 777 bp, with the A+ T contents of 84.1% and 85.2%, respectively. The 491 bp AT-rich region was located between the rrnS gene and the trnM gene, with the highest of A+ T content (95.5%) in the whole genome. Several structures characteristic of lepidopterans were also detected in the A+ T-rich region, such as the motif ATAGA followed by an 18-bp poly-T stretch, and a microsatellite-like (AT)6 preceded by the ATTTA motif. Moreover, one 36 bp sequence stretches (TATAAAATATTTAA TATTAATTATTAAATATTGAAT), which has a potential to form stem-loop structure was also detected in the region. The stemloop structure possesses ‘‘TATA’’ consensus sequences at the 50 end and ‘‘G(A)nT’’ consensus sequences at the 30 end (Schultheis et al., 2002; Wang et al., 2013), and has been suggested as the initiation site of the secondary strand replication (Zhang & Hewitt, 1997).
Correspondence: Jia-sheng Hao, Laboratory of Molecular Evolution and Biodiversity, College of Life Sciences, Anhui Normal University, Wuhu 241000, People’s Republic of China. Tel: +86 553 3818721. E-mail: [email protected]
2
Y. Wang et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Organization of the complete mitochondrial genome in P. imperator.
Downloaded by [Texas A & M International University] at 16:48 05 November 2015
Gene trnM trnI trnQ nad2 trnW trnC trnY cox1 trnL2(UUR) cox2 trnK trnD atp8 atp6 cox3 trnG nad3 trnA trnR trnN trnS1(AGN) trnE trnF nad5 trnH nad4 nad4L trnT trnP nad6 cob trnS2(UCN) nad1 trnL1(CUN) rrnL trnV rrnS A+ T-rich region
Direction
Location
F F R F F R R F F F F F F F F F F F F F F F R R R R R F R F F F R R R R R
1–69 70–133 131–199 241–1254 1255–1321 1314–1380 1385–1448 1451–2981 2982–3048 3049–3730 3731–3801 3801–3867 3868–4032 4026–4703 4703–5491 5495–5561 5559–5915 5915–5980 5989–6054 6057–6122 6126–6186 6256–6323 6322–6385 6387–8123 8121–8184 8184–9524 9525–9815 9821–9887 9888–9952 9955–10,485 10,503–11,648 11,650–11,716 11,733–12,671 12,673–12,741 12,742–14,091 14,092–14,156 14,157–14,933 14,934–15,424
Intergenic Start Stop Size(bp) length codon codon 69 64 69 1014 67 67 64 1531 67 682 71 67 165 678 789 67 357 66 66 66 61 68 64 1737 64 1341 291 67 64 531 1146 67 939 69 1350 65 777 491
0 –2 41 0 –8 4 2 0 0 0 –1 0 –7 –1 3 –3 –1 8 2 3 69 –2 1 –3 –1 0 5 0 2 17 1 16 1 0 0 0 0 –
– – – ATT – – – CGA – ATG – – ATT ATG ATG – ATA – – – – – – ATT – ATG ATG – – ATT ATG – ATG – – – – –
– – – TAA – – – T – T – – TAA TAA TAA – TAA – – – – – – TAA – TAA TAA – – TAA TAA – TAG – – – – –
In the column intergenic length, the positive number indicates interval base pairs between genes, while the negative number indicates the overlapping base pairs between genes.
Nucleotide sequence accession number The complete genome sequence of Parnassius imperator has been assigned GenBank accession number KM507326.
Declaration of interest This work was supported by the National Science Foundation of China (Grant No. 41172004, 41472028). The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the article.
References Chen YH, Huang DY, Wang YL, Zhu CD, Hao JS. (2014). The complete mitochondrial genome of the endangered Apollo butterfly, Parnassius apollo (Lepidoptera: Papilionidae) and its comparison to other Papilionidae species. J Asia-Pac Entomol 17:663–71. Condamine FL, Sperling FAH, Kergoat GJ. (2013). Global biogeographical pattern of swallowtail diversification demonstrates alternative colonization routes in the Northern and Southern hemispheres. J Biogeogr 40:9–23. Dong WW, Jiang GF. (2014). Characterization of the mitochondrial genome of the threatened alpine butterfly, Parnassius nomion (Lepidoptera: Papilionidae). Mitochondr DNA doi: 10.3109/ 19401736.2014.933322. Hao JS, Sun ME, Sun XY, Shao LL, Yang Q. (2013). Complete mitogenomes of Euploea mulciber (Nymphalidae: Danainae) and Libythea celtis (Nymphalidae: Libytheinae) and their phylogenetic implications. ISRN Genomics 491636:1–14. Hong MY, Jeong HC, Kim MJ, Jeong HU, Lee SH, Kim I. (2009). Complete mitogenome sequence of the jewel beetle, Chrysochroa fulgidissima (Coleoptera: Buprestidae). Mitochondr DNA 20:46–60. Kim MI, Baek JY, Kim MJ, Jeong HC, Kim KG, Bae CH, Han YS, et al. (2009). Complete nucleotide sequence and organization of the mitogenome of the red–spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and comparison with other lepidopteran insects. Mol Cells 28:347–63. Kim MJ, Kang AR, Jeong HC, Kim I. (2011). Reconstructing intraordinal relationships in Lepidoptera using mitochondrial genome data with the description of two newly sequenced lycaenids, Spindasis takanonis and Protantigius superans (Lepidoptera: Lycaenidae). Mol Phylogenet Evol 61:436–45. Park JS, Cho Y, Kim MJ, Nam SH, Kim I. (2012). Description of complete mitochondrial genome of the black-veined white, Aporia crataegi (Lepidoptera: Papilionoidea), and comparison to papilionoid species. J Asia-Pac Entomol 15:331–41. Schultheis AS, Weigt LA, Hendricks AC. (2002). Arrangement and structural conservation of the mitochondrial control region of two species of Plecoptera: Utility of tandem repeat-containing regions in studies of population genetics and evolutionary history. Insect Mol Biol 11:605–10. Shi QH, Xia J, Sun XY, Hao JS, Yang Q. (2012). Complete mitogenome of the Painted Jezebel, Delias hyparete Linnaeus (Lepidoptera: Pieridae) and its comparison with other butterfly species. Zool Res 33:111–20. Wang W, Meng ZQ, Shi FX, Li FB. (2013). Advances in comparative mitogenomic studies of Lepidoptera (Arthropoda: Insecta) (in Chinese). Chinese Sci Bull 58:3017–29. Wu LW, Lees DC, Yen SH, Hsu YF. (2010). The Complete mitochondrial genome of the near–threatened swallowtail, Agehana maraho (Lepidoptera: Papilionidae): Evaluating sequence variability and suitable markers for conservation genetic studies. Entomol News 121:267–80. Xia J, Hu J, Zhu GP, Zhu CD, Hao JS. (2011). Sequence and analysis of the complete mitochondrial genome of Calinaga dabidis Oberthu00 r (Lepidoptera: Nymphalidae). Acta Entomol Sin 54:555–65. Zhang DX, Hewitt FM. (1997). Insect mitochondrial control region: A review of its structure, evolution and usefulness in evolutionary studies. Biochem Syst Ecol 25:99–120.
ISSN: 1940-1736 (Print) 1940-1744 (Online) Journal homepage: http://www.tandfonline.com/loi/imdn20
The complete mitochondrial genome of Parnassius imperator (Lepidoptera: Papilionidae: Parnassiinae) Yunliang Wang, Yanhong Chen, Chenchen Xia, Xueqin Xia, Xiao Chen & Jiasheng Hao To cite this article: Yunliang Wang, Yanhong Chen, Chenchen Xia, Xueqin Xia, Xiao Chen & Jiasheng Hao (2014): The complete mitochondrial genome of Parnassius imperator (Lepidoptera: Papilionidae: Parnassiinae), Mitochondrial DNA To link to this article: http://dx.doi.org/10.3109/19401736.2014.971277
Published online: 20 Oct 2014.
Submit your article to this journal
Article views: 17
View related articles
View Crossmark data
Citing articles: 1 View citing articles
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=imdn20 Download by: [Texas A & M International University]
Date: 05 November 2015, At: 16:48
http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–2 ! 2014 Informa UK Ltd. DOI: 10.3109/19401736.2014.971277
MITOGENOME ANNOUNCEMENT
The complete mitochondrial genome of Parnassius imperator (Lepidoptera: Papilionidae: Parnassiinae) Yunliang Wang, Yanhong Chen, Chenchen Xia, Xueqin Xia, Xiao Chen, and Jiasheng Hao
Downloaded by [Texas A & M International University] at 16:48 05 November 2015
Laboratory of Molecular Evolution and Biodiversity, College of Life Sciences, Anhui Normal University, Wuhu, People’s Republic of China
Abstract
Keywords
The complete mitochondrial genome (mitogenome) of Parnassius imperator (Lepidoptera: Parnassiinae) is a circular molecule of 15,424 bp in length, containing 37 typical insect mitochondrial genes and one non-coding A + T-rich region. Its gene order and arrangement are identical to the common type found in most lepidopteran mitogenomes. All protein-coding genes (PCGs) start with a typical ATN initiation codon, except for the cox1, which is initiated by the CGA codon as observed in other lepidopteran species. Some PCGs use standard TAA, while others use TAG (nad1) or incomplete codon T (cox1 and cox2), as their termination codons. 15 intergenic spacers (175 bp in total) and 10 overlapping sequences (29 bp in total) are dispersed throughout the whole genome. The 491 bp long A+ T-rich region contains some conserved structures similar to those found in other lepidopteran mitogenomes, such as the motif ATAGA followed by an 18-bp poly-T stretch, a microsatellite-like (AT)6 element preceded by the ATTTA motif. In addition, a 36 bp sequence stretch potential to form stem-loop structures is also found in the A+ T-rich region.
Complete mitochondrial genome, Papilionidae, Parnassius imperator, Parnassiinae
The Parnassius butterflies include about 50 species, mostly distributed in high mountains or alpine habitats. Due to the morphological characteristics among Parnassius species is not obvious, the utilization of molecular techniques to study their phylogeny and systematics is clearly necessary (Condamine et al., 2013). Up to date, only three Parnassius complete mitochondrial genomes have been reported (Chen et al., 2014; Dong et al., 2014; Kim et al., 2009). Here, we presented the complete mitogenome sequence of Parnassius imperator, one representative species of the genus, with the aim of providing more molecular data for the Parnassiinae taxonomic and phylogenetic studies. The complete P. imperator mitogenome was 15,424 bp in length, containing 13 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs), 2 ribosomal RNA genes (rrnL and rrnS) and one non-coding A+ T-rich region. The order and orientation of these genes were identical to those in other lepidopteran insects. The nucleotide composition of the genome is significantly A+ T biased (81.1%). Besides the A+ T-rich region, 15 intergenic spacers ranging from 1 to 69 bp (175 bp in total) and 10 overlapping sequences from 1 to 8 bp (29 bp in total) are dispersed throughout the whole genome (Table 1). All PCGs were initiated by a typical ATN codon, except for the cox1, which used CGA as its start codon. Eleven PCGs used TAA or TAG as their stop codons, while the cox1 and cox2 ended with
History Received 14 September 2014 Accepted 26 September 2014 Published online 20 October 2014
a single T (Table 1). This case is also frequently found in most lepidopteran mitogenomes sequenced to date (Hao et al., 2013, Kim et al., 2011; Shi et al., 2012; Wu et al., 2010; Xia et al., 2011). All tRNAs could be folded into the typical cloverleaf secondary structures except for trnS1(AGN), whose dihydrouridine (DHU) arm was replaced by a simple loop, as seen in all other determined butterfly species (Hao et al., 2013; Hong et al., 2009; Park et al., 2012). The rrnL and rrnS genes were 350 bp and 777 bp, with the A+ T contents of 84.1% and 85.2%, respectively. The 491 bp AT-rich region was located between the rrnS gene and the trnM gene, with the highest of A+ T content (95.5%) in the whole genome. Several structures characteristic of lepidopterans were also detected in the A+ T-rich region, such as the motif ATAGA followed by an 18-bp poly-T stretch, and a microsatellite-like (AT)6 preceded by the ATTTA motif. Moreover, one 36 bp sequence stretches (TATAAAATATTTAA TATTAATTATTAAATATTGAAT), which has a potential to form stem-loop structure was also detected in the region. The stemloop structure possesses ‘‘TATA’’ consensus sequences at the 50 end and ‘‘G(A)nT’’ consensus sequences at the 30 end (Schultheis et al., 2002; Wang et al., 2013), and has been suggested as the initiation site of the secondary strand replication (Zhang & Hewitt, 1997).
Correspondence: Jia-sheng Hao, Laboratory of Molecular Evolution and Biodiversity, College of Life Sciences, Anhui Normal University, Wuhu 241000, People’s Republic of China. Tel: +86 553 3818721. E-mail: [email protected]
2
Y. Wang et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Organization of the complete mitochondrial genome in P. imperator.
Downloaded by [Texas A & M International University] at 16:48 05 November 2015
Gene trnM trnI trnQ nad2 trnW trnC trnY cox1 trnL2(UUR) cox2 trnK trnD atp8 atp6 cox3 trnG nad3 trnA trnR trnN trnS1(AGN) trnE trnF nad5 trnH nad4 nad4L trnT trnP nad6 cob trnS2(UCN) nad1 trnL1(CUN) rrnL trnV rrnS A+ T-rich region
Direction
Location
F F R F F R R F F F F F F F F F F F F F F F R R R R R F R F F F R R R R R
1–69 70–133 131–199 241–1254 1255–1321 1314–1380 1385–1448 1451–2981 2982–3048 3049–3730 3731–3801 3801–3867 3868–4032 4026–4703 4703–5491 5495–5561 5559–5915 5915–5980 5989–6054 6057–6122 6126–6186 6256–6323 6322–6385 6387–8123 8121–8184 8184–9524 9525–9815 9821–9887 9888–9952 9955–10,485 10,503–11,648 11,650–11,716 11,733–12,671 12,673–12,741 12,742–14,091 14,092–14,156 14,157–14,933 14,934–15,424
Intergenic Start Stop Size(bp) length codon codon 69 64 69 1014 67 67 64 1531 67 682 71 67 165 678 789 67 357 66 66 66 61 68 64 1737 64 1341 291 67 64 531 1146 67 939 69 1350 65 777 491
0 –2 41 0 –8 4 2 0 0 0 –1 0 –7 –1 3 –3 –1 8 2 3 69 –2 1 –3 –1 0 5 0 2 17 1 16 1 0 0 0 0 –
– – – ATT – – – CGA – ATG – – ATT ATG ATG – ATA – – – – – – ATT – ATG ATG – – ATT ATG – ATG – – – – –
– – – TAA – – – T – T – – TAA TAA TAA – TAA – – – – – – TAA – TAA TAA – – TAA TAA – TAG – – – – –
In the column intergenic length, the positive number indicates interval base pairs between genes, while the negative number indicates the overlapping base pairs between genes.
Nucleotide sequence accession number The complete genome sequence of Parnassius imperator has been assigned GenBank accession number KM507326.
Declaration of interest This work was supported by the National Science Foundation of China (Grant No. 41172004, 41472028). The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the article.
References Chen YH, Huang DY, Wang YL, Zhu CD, Hao JS. (2014). The complete mitochondrial genome of the endangered Apollo butterfly, Parnassius apollo (Lepidoptera: Papilionidae) and its comparison to other Papilionidae species. J Asia-Pac Entomol 17:663–71. Condamine FL, Sperling FAH, Kergoat GJ. (2013). Global biogeographical pattern of swallowtail diversification demonstrates alternative colonization routes in the Northern and Southern hemispheres. J Biogeogr 40:9–23. Dong WW, Jiang GF. (2014). Characterization of the mitochondrial genome of the threatened alpine butterfly, Parnassius nomion (Lepidoptera: Papilionidae). Mitochondr DNA doi: 10.3109/ 19401736.2014.933322. Hao JS, Sun ME, Sun XY, Shao LL, Yang Q. (2013). Complete mitogenomes of Euploea mulciber (Nymphalidae: Danainae) and Libythea celtis (Nymphalidae: Libytheinae) and their phylogenetic implications. ISRN Genomics 491636:1–14. Hong MY, Jeong HC, Kim MJ, Jeong HU, Lee SH, Kim I. (2009). Complete mitogenome sequence of the jewel beetle, Chrysochroa fulgidissima (Coleoptera: Buprestidae). Mitochondr DNA 20:46–60. Kim MI, Baek JY, Kim MJ, Jeong HC, Kim KG, Bae CH, Han YS, et al. (2009). Complete nucleotide sequence and organization of the mitogenome of the red–spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and comparison with other lepidopteran insects. Mol Cells 28:347–63. Kim MJ, Kang AR, Jeong HC, Kim I. (2011). Reconstructing intraordinal relationships in Lepidoptera using mitochondrial genome data with the description of two newly sequenced lycaenids, Spindasis takanonis and Protantigius superans (Lepidoptera: Lycaenidae). Mol Phylogenet Evol 61:436–45. Park JS, Cho Y, Kim MJ, Nam SH, Kim I. (2012). Description of complete mitochondrial genome of the black-veined white, Aporia crataegi (Lepidoptera: Papilionoidea), and comparison to papilionoid species. J Asia-Pac Entomol 15:331–41. Schultheis AS, Weigt LA, Hendricks AC. (2002). Arrangement and structural conservation of the mitochondrial control region of two species of Plecoptera: Utility of tandem repeat-containing regions in studies of population genetics and evolutionary history. Insect Mol Biol 11:605–10. Shi QH, Xia J, Sun XY, Hao JS, Yang Q. (2012). Complete mitogenome of the Painted Jezebel, Delias hyparete Linnaeus (Lepidoptera: Pieridae) and its comparison with other butterfly species. Zool Res 33:111–20. Wang W, Meng ZQ, Shi FX, Li FB. (2013). Advances in comparative mitogenomic studies of Lepidoptera (Arthropoda: Insecta) (in Chinese). Chinese Sci Bull 58:3017–29. Wu LW, Lees DC, Yen SH, Hsu YF. (2010). The Complete mitochondrial genome of the near–threatened swallowtail, Agehana maraho (Lepidoptera: Papilionidae): Evaluating sequence variability and suitable markers for conservation genetic studies. Entomol News 121:267–80. Xia J, Hu J, Zhu GP, Zhu CD, Hao JS. (2011). Sequence and analysis of the complete mitochondrial genome of Calinaga dabidis Oberthu00 r (Lepidoptera: Nymphalidae). Acta Entomol Sin 54:555–65. Zhang DX, Hewitt FM. (1997). Insect mitochondrial control region: A review of its structure, evolution and usefulness in evolutionary studies. Biochem Syst Ecol 25:99–120.
