Appl Microbiol Biotechnol (1990) 33:418-423

Applied Micmbiology Biotechnology ' © Springer-Verlag 1990

The D-galactose dehydrogenase gene from Pseudomonas fluorescens: characterization of mutations leading to increased expression in Escherichia coli Stefan Fiedler* and Peter Buckel Department of Genetics, Boehringer Mannheim GmbH, Nonnenwald 2, D-8122 Penzberg, Federal Republic of Germany Received 10 January 1990/Accepted 28 February 1990

Summary. The gene encoding D-galactose dehydrogenase (gld; E.C. 1.1.1.48) from Pseudomonasfluorescens is poorly expressed when cloned into Escherichia coli. Mutagenesis o f the wild-type construct leads to a strong expression o f gld in the heterologous host. To investigate the mutational events directing the increase in expression we constructed a gld-lacZ translational fusion which facilitated the isolation of mutants by colony screening. From several independent mutants three point mutations could be identified. They were distinguished by the sequence position of their respective single base-pair substitutions in the 5'-untranslated region o f the g/d gene and the degree of enhancement of enzyme activity of the gene product. The influence o f these mutations on gld gene expression was analysed by S 1 protection analysis which revealed that their effect was at the level of transcription.

Introduction Genes from P s e u d o m o n a s are in general weakly expressed in E. coli, even when cloned on multi-copy plasmids (Nakazawa et al. 1983; Inouye et al. 1984; Schell 1985; Buckel and Zehelein 1981; Gray et al. 1984; Minton and Clarke 1985; Jeenes et al. 1986; Schumacher et al. 1989). However, high level expression of P s e u d o m o n a s genes in E. coli can readily be achieved by placing the genes under the control o f E. coli promoters (Buckel and Zehelein 1981; Gray et al. 1984; Minton and Clarke 1985; Jeenes et al. 1986; Schumacher et al. 1989). At least for these genes the limiting factor of weak heterologous expression is inefficient transcription under the control of the Pseudom o n a s promoter in an E. coli host and not poor translation. * Present address: lnstitut for Genetik und Mikrobiologie, Universit,it Miinchen, Maria-Ward-Strasse l a, D-8000 Miinchen 19, Federal Republic of Germany Offprint requests to: P. Buckel

Expression o f the gene (gld) encoding D-galactose dehydrogenase (gal-dh) (Lessie and Phibbs 1984) from P s e u d o m o n a s f l u o r e s c e n s is efficient in the natural host but is inefficient in E. coli under the control of Pseudomonas DNA, reaching only about 5% of the enzyme level of the natural host. However, the gene is readily Table 1. Bacterial strains, phages and plasmids used Strain

Genotype

Escherichia coli 54-2 A (lac, pro) recA, rpsL, [F', pro +, lacI q ZAM15] JM103 A (lac, pro) end A1 thi 1, str A, sbc B15, hsd R4, supE [F'tra D36, pro AB, lacI q ZAM 15] MutD F-, mutD5, rpsl, azi, galU95 MutH F', leu-57, trp-76, his-204, argA76, mutH34, ilv-677, thi1, lacZ332, xyI-7, mtl-2, malA1, rpsL135, XR, 9~Pseudornonas putida mr-2 KT2440 r-, m + Bacteriophages Characteristics M13mpll Polylinker: HindlII, PstI, SalI/AccI, HincII, XbaI, BarnH1, SmaI/XmaI, SstI, E¢oRI Plasmids pBT40

pSF6

pUK217

mp r, contains wild-type Pseudomonas DNA (gM structural gene and 2.4 kb DNA upstream of ATG) Ap r, contains the gene for gld-lacZ fusion protein and wild-type DNA upstream of ATG Ap r, contains the whole lac operon

Reference B. Gronenborn, Kfln Messing et al. (1981) Cox and Hornet (1982) Hoess and Herman (1975)

Franklin et al. (1981) Messing and Vieira (1982)

Buckel and Zehelein (1981) This work

Ruether et al. (1981)

419

in Pseudomonas (Jeenes et al. 1986; Martin et al. 1986). The nucleotide sequence of the complete 91d gene including 446 bp preceding the coding region has recently been established (Sperka et al. 1989). Here we describe an initial characterization of this 5' untranslated region by analysis of point mutations which

expressed in E. coli when placed under the control of the E. coli lac promoter. High expression of gld could also be achieved by mutational alterations in the 5' untranslated region of the gld gene. These mutated D N A regions also lead to an increased expression in Pseudomonas fluorescens (Buckel and Zehelein 1981), consistent with E. coli promoters being functionally efficient

Sall--~

Pseudomonas/~ .~.~

pBR322

~

F.I~R|

Bam HI Klenow + dNTP Dra I

Eco RI ~ Klenow+ dNTP J','i7'2 kb fragment I

Ligase

[-3.1kb fragment I J

Sail I 7,9kb fragment I FLig ase P~uII N,u~// BglI\ / /

•r,~kb

"C

~'T"''~

" X

~/~uII 1

Clal E~/RV

--

~acl

Fig. 1. Construction of the galactose dehydrogenase/fl-galactosidase (fl-gal) fusion plasmid (tTld-lacZ). The plasmid pBT40 was restricted with EcoRI and after filling in the protruding ends the 600-bp EcoRI fragment was exchanged with the 3.l-kb B a m H I / D r a I fragment from pUK217. After removal of a 2.6-kb SatI fragment, pSF6 was obtained (in plasmids pBT40 and pUK217 only restriction sites used for construction of pSF6 are indicated)

420 s t r o n g l y i n f l u e n c e t h e e x p r e s s i o n o f t h e gld g e n e in E. coll. •

Materials and methods

• •

Strains, phages and plasmids. The strains, phages and plasmids used are listed in Table 1.

•

•

A

g

•

•

Assay of fl-galactosidase (fl-gal) activity. E. coli cells were grown in 40 ml Luria-Bertani (LB) medium (Maniatis et al. 1982) to an optical density at 550 nm (OD550) of 1.0. After centrifugation, the cells were washed once in 20 ml of 0.1 M K-phosphate buffer (pH 6.5), and after a further centrifugation step resnspended in 1 ml of the same buffer. The bacteria were sonicated and the cell-free supernatant was prepared for the enzyme assay according to Bergmeyer (1983).

m

QO o

Recombinant DNA techniques. Recombinant DNA techniques

•

were carried out as described by Maniatis et al. (1982).

i

-500

Truncation of double-stranded DNA. Plasmid DNA was truncated

(Hoess and Herman 1975) and with nitrosoguanidine (NG) treatment (Talmadge and Gilbert 1980).

DNA sequencing. DNA fragments were subcloned into MI3phage m p l l and propagated in E. coli JM103. The sequencing reactions were performed using the dideoxynucleotide chain termination method (Sanger et al. 1977). Determination of the 5' ends of transeript~ by S1 protection analysis. The total RNA of the cells was estimated according to Summers (1970) and $1 protection analysis was carried out as described by Weaver and Weissmann (1979).

Results

Construction o f a protein fusion between the amino-terminus o f gld and fl-gal To f a c i l i t a t e s c r e e n i n g a n d m o n i t o r i n g o f m u t a t i o n a l alt e r a t i o n s i n f l u e n c i n g t h e e x p r e s s i o n o f t h e gld gene in E. coli we c o n s t r u c t e d a t r a n s l a t i o n a l f u s i o n b e t w e e n t h e 5' r e g i o n o f t h e gld g e n e a n d t h e fl-gal g e n e (lacZ). P l a s m i d p S F 6 (Fig. 1) c o d e s f o r a f u s i o n p r o t e i n c o m p o s e d o f t h e first 214 a m i n o a c i d s o f g a l - d h a n d o f t h e c o d i n g s e q u e n c e o f fl-gal l a c k i n g t h e 5 a m i n o - t e r m i n a l a m i n o acids. T h e 5' f l a n k i n g r e g i o n o f t h e gld g e n e (446 b p ) c o n t a i n i n g p o s s i b l e r e g u l a t o r y r e g i o n s is also i n c l u d e d . W h e n E. co6 s t r a i n 54-2 was t r a n s f o r m e d w i t h p S F 6 , t h e c o l o n i s o n X - g a l a g a r - p l a t e s w e r e light b l u e in c o n t r a s t to t h e w h i t e c o l o n i e s o f E. coli 54-2 w i t h o u t t h e p l a s m i d ( d a t a n o t s h o w n ) . This i n d i c a t e d t h a t t h e fl-gal p o r t i o n o f t h e f u s i o n p r o t e i n w a s active a n d t h e s y n t h e s i s o f t h e f u s i o n p r o t e i n w a s l o w ; specific activity in t h e fl-gal a s s a y was 4 millinnits).

Identification o f the DNA regions essential for expression o f the 91d 9ene in E. coli T h e l o w fl-gal a c t i v i t y o f E. coli 54-2 cells c a r r y i n g p S F 6 indicates a weak expression of the gene fusion under t h e c o n t r o l o f the n a t u r a l Pseudomonas p r o m o t e r . T o

I

-300

-200

5'

with nuclease Bal31 as described by Maniatis et al. (1982).

Mutagenesis ofplasmid-DNA. Plasmids were mutagenized in E. coli mutator-strains MutD (Cox and Horner 1982) and MutH

-400

i

i

-100

•

i

ATG

(bp)

+100 3'

Fig. 2. Deletion mapping of the 5' region of the fusion plasmid. The plasmid pSF6 was cleaved with SalI and treated with Ba131 for different times. The DNAs were digested with NruI and ligated to a HindlII linker. The reduction of the length of the PstIHindIII fragment indicates the extent of the deletion. The numbering of the X-axis is relative to the A of the translational initiation codon of gld which is taken as + 1. The deletion size was correlated with fl-gal activity, shown in milliunits (mU). When independent measures from the same E. coli 54-2 carrying the respective deletion construct were carried out, the activity values varied up to 25%. The indicated values are the mean of three measurements determine the minimum DNA sequence necessary for e x p r e s s i o n o f t h e gld g e n e t h e D N A 5' to t h e i n i t i a t i o n c o d o n was t r u n c a t e d s u c c e s s i v e l y w i t h n u c l e a s e Bal31. As s h o w n in Fig. 2 a r e g i o n o f a b o u t 200 b p u p s t r e a m o f A T G is n e c e s s a r y f o r l o w - l e v e l e x p r e s s i o n o f t h e fus i o n p r o t e i n . This also d e m o n s t r a t e s t h a t gld t r a n s c r i p t i o n f r o m this p l a s m i d initiates w i t h i n t h e Pseudomonas D N A a n d t h a t t h e r e is n o r e a d - t h r o u g h f r o m a p l a s m i d promoter. Table 2. Yield of mutants after mutagen treatment Type of mutagenesis Without treatment MutD15 b MutD21 MutH16 MutH18 MutH21 NG10 c NG50

Colonies (%) White

Light blue"

Blue

0 1 10 1 0 1 8 31

100 98 75 99 100 98 88 68

0 1 15 0 0 1 4 1

Light-blue colonies on 5-Bromo-4-chloro-3-indolyl-l~-D-galactopyranoside agar plates. This represents the expression of the gene fusion under control of the wild-type Pseudomonas promoter in E. coli b Mutation in E. coliMutD for 15 doubling times c Mutation after treatment with 10 ixg/ml nitrosoguanidine (NG) a

421 Table 3. fl-Galactosidase (fl-gal) activity of wild-type and mutants Name of plasmid

Mutation experiment

fl-Gal activity (milliunits)

Type of mutationa

pSF6 pSF6-1 pSF5 pSF6-2 pSF6-5 pSF6-8 pSF6-9 pSF6-10 pSF6-11 pSF6-12 pSF6-3 pSF6-4 pSF6-6 pSF6-7

-NG10-2 b HA~ NG10-3 NG10-6 NG10-6 NG10-5 MutH21 d MutD21 ~ MutD21 NG10-4 NG10-5 NG10-5 NG10-6

4 15 320 300 370 330 165 190 350 200 60 60 54 54

-I II II II II II II II II III III III III

a

b ° d ~

See Fig. 4 From mutation with 10 ~tg/ml NG number 2 From mutation with hydroxylamine (Buckel and Zehelein 1981) From mutation with E. coli MutH over 21 doubling times From mutation with E. coli MutD over 21 doubling times

E. coli M u t D and in E. coli M u t H all generated mutation type II. The expression rate was elevated by about 40-90-fold. Mutation type I I I was obtained in three independent N G mutation experiments increasing the expression by about 13-15 times. The nature of each mutation was determined by sequencing the 5' upstream regions of all mutant constructs. In each mutant only a single base-pair substitution could be found. All type I mutants had a transition G - + A at position - 159 (i.e. 159 b p upstream of the gld initiation codon). Also type I I and type I I I mutations were transitions ( C ~ T at position - 7 0 and - 5 1 , respectively; see Fig. 4).

Influence o f mutations on transcriptional start sites

To correlate the mutant loci with possible p r o m o t e r regions an Sl-protection experiment was performed using the S a l I / X m a I fragments as labelled D N A (Fig. 3). In all three mutant types and in the wild-type signals were visible at positions 162-166 indicating that in all constructs transcription was initiated at the same site. The b a n d at position 165 was much stronger than the

Influence o f mutations on expression

For further characterization of D N A sequences influencing the level of expression we introduced mutations in the 5' region of the gld gene. This was done by p r o p a g a t i o n of plasmid pSF6 either in E. coli M u t D for about 15 or 21 generations or in E. coli M u t H for 16, 18 or 21 generations. After isolation and transformation of the mutated D N A into E. coli 54-2, approximately 500 colonies from each mutagenesis experiment were screened for fl-gal activity. The percentage of mutants obtained is shown in Table 2. We also p e r f o r m e d six mutagenesis experiments with 10 ~tg/ml N G and a further six experiments with 50 ~tg/ml (Table 2). The plasmids of several E. coli clones showing higher fl-gal activity after mutagenesis were isolated. To exclude all mutations which lay outside the 450 bp of D N A upstream of the A T G (e.g. mutations in the ori region leading to higher copy-number), the 2 kb SalI-ClaI fragment o f the mutated plasraids was isolated and introduced into the original plasmid pSF6. The same fragment of pBT40, which was treated with hydroxylamine and led to a 90-100-fold increased expression of gld in E. cob (Buckel and Zehelein 1981), was also isolated and inserted into pSF6. As a result, fragments from eight independent mutagenesis experiments could be transferred into pSF6, generating plasmids with a higher expression rate in E. coli 54-2 than pSF6 before treatment. C o m p a r i n g the fl-gal activities of all independently created mutants, three classes could be detected (Table 3). Type I was obtained by mutagenesis with 10 Ixg/ml N G ( N G mutagenesis) and led to an increase in expression o f a b o u t fourfold to 15 milliunits Hydroxylamine treatment (Buckel and Zehelein 1981), three independent N G mutagenesis experiments, and replication in

Fig. 3 a, b. Determination of transcription start sites in E. coli. a Exposure for 2 days. b Exposure for 14 days. The fragment sizes of the length markers are indicated: L1 = pBR322 digested by AluI; L2 = a DNA fragment 165 bp long. S = Sequence ladder of known sequence to bridge the space between the bands of the size markers. The (S1)-protection experiments were done with RNA isolated from E. coli 54-2 carrying plasmids of the following types: 1 and 2 = wild-type; 3 = mutation type I; 4-7 = mutation type II; 8 = mutation type III. The signals marked with an asterisks represent the protected DNA-DNA hybrids

422 > type II mRNA transcripts: type I

mutants:

A (type I)

T (type II)

•.. ATGGGAACATCCTCAATCGGT~GGTCGTG'ITGCCA~-rC'rTGCTG~rCT.,.. TGCG~

[~

type III

D

wildtype, type I

T (type Ill)

GACGCCCGCGG T G T I - r G C C [ ~ - ~ CTGCCGACTCGCTGACTAAAACAAGATAAAAAC[ ~ ' ~

SD

TCATTG[ ~

CAA

pSF6 (wildtype)

position: (bp upstream from ATG):

-159

B-gal activity of mutants: (wildtype =pSF6:4 mU)

15 mU

,

/t t

--70

51

165-370 mU

54--60 mU

;

--1

Fig. 4. The 5'-regulatory region of the 91d gene of wild-type and mutant plasmids. The sequence of the wild-type DNA is compared with the three mutation types obtained. The kind of base substitution, the location of the exchange, and the influence on expression of the fusion plasmid are shown. The asterisks indicate transcription initiation sites

other signals and therefore we assume that the transcription start site lies 6 bp downstream of a GTTAAT sequence (boxed, see Fig. 4) at a position 38 bp upstream of the g/d initiation codon. In all three types of mutants the amount of specific RNA was increased significantly in comparison to the wild-type (Fig. 3). In type II and III mutants transcription initiated at the same position as the wild-type while with mutant type I initiation also occurred at new start sites 107 and 110 bp upstream of the wild-type transcription start site (Fig. 4). In Fig. 4 the transcription start sites are indicated by asterisks and the size of the arrows gives an approximate representation of the relative cellular amounts of the specific mRNA.

Discussion

Construction of a plasmid-encoded translational fusion between gld and lacZ enabled monitoring of the heterologous expression of gld from P. fluorescens in E. coli. With this system in hand it was possible to analyse the 5' upstream region of the gld gene for potential regulatory sequences and to easily screen for mutants affecting the gld gene expression in E. coli. We found that for the constitutive low level expression of the wild-type gld gene in E. coli at least 160200 bp upstream of the translational start codon were necessary. Successive deletion of this region led to a constant decrease in expression indicating the importance of the whole region (Fig. 2). This experiment also demonstrated that the heterologous expression of gld was dependent on the 5' region of the gld gene. A computer search for canonical promoter sequences of E. coli (Rosenberg and Court 1979) or Pseudomonas (Merrood et al. 1984; Frantz and Chakrabarty 1987) revealed a perfect E. coli-35 consensus sequence lying at an optimal distance from the transcription start of the gld

gene. The potential - 1 0 sequence (Fig. 4, see boxed sequences) is situated relatively close to the initiation site such that the spacing between the consensus boxes is 19 bp. Such a spacing has been shown for E. coli to reduce expression (Hawley and McClure 1983; O'Neill 1989) and may be a contributing factor to the poor expression of 91d in E. coli. To further characterize the transcriptional influence of this region, a series of plasmids were isolated which carried point mutations which led to different levels of enhancement of expression of the old gene in E. coli. Three types of mutants were found. Mutants of types II and IlI showed the same transcriptional start site as found for the wild-type gene in E. coli (Fig. 4) and in Pseudomonas (data not shown). However, the mutation led to a higher steady-state level of m R N A and to a 40-90-fold (type II) or 13-15-fold (type III) increase of expression of 9ld-lacZ. Both types of mutations were single base-pair changes either at position - 1 3 (Type III) or at position - 3 2 (type II) with respect to the transcriptional start site. Interestingly it is possible to deduce from both mqtations a new, less optimal, - 3 5 position (TAGACG = Type II) with respect to a new - 10 (TG_TCGT = Type III) box (the nucleotide being generated by mutation is underlined) but each leading to a spacing that is closer to the optimal spacing of highly expressed genes in E. coli (Hawley and McClure 1983; O'Neill 1989). If this is the real basis of enhancement of expression in these mutants, it would be another example of the importance of the right spacing between the - 3 5 consensus box and the - 1 0 consensus box for promoter strength in E. eoli. Mutant type I is located some 100 bp upstream of the wild-type promoter site, leading to a new transcription start site. Only one such mutant was found. This mutant produces a high level of m R N A but shows only a moderate increase (fourfold) of enzyme expression. This indicates an inefficient translation of this elon-

423 g a t e d m R N A . T h e single b a s e - p a i r s u b s t i t u t i o n o f this mutation could possibly create a new -10 box (TACCAT) already representing a moderate promoter. A l t o g e t h e r , f r o m t h e d a t a p r e s e n t e d it is n o t p o s s i b l e to c o n c l u d e s u f f i c i e n t l y b y w h i c h m e c h a n i s m ( s ) t h e m u t a t i o n s i n c r e a s e t h e e x p r e s s i o n in E. coli. H e r e w e h a v e t r i e d to d e f i n e the 9ld p r o m o t e r o n t h e b a s i s o f a c o n s e n s u s s e q u e n c e as h a s b e e n s h o w n for E. coli p r o m o t e r s ( R o s e n b e r g a n d C o u r t 1979). A P s e u d o m o n a s c o n s e n s u s s e q u e n c e , as p o s t u l a t e d for t o l u e n e d e g r a d a t i o n g e n e s ( M e r m o d et al. 1984), s o m e o t h e r c o o r d i n a t i v e l y r e g u l a t e d p r o m o t e r s in P s e u d o m o n a s ( I n o u y e et al. 1986) o r a p o s i t i v e l y r e g u l a t e d c o n s e n s u s s e q u e n c e , as p o s t u l a t e d f o r t h e p r o m o t e r r e g i o n s o f b i o d e g r a d a tive genes o f P s e u d o m o n a s ( F r a n t z a n d C h a k r a b a r t y 1987), c o u l d n o t be d e t e c t e d in t h e 9 M 5' r e g i o n . F u r t h e r e x p e r i m e n t s will h a v e to e l u c i d a t e t h e role o f t h e r e g i o n u p s t r e a m o f t h e w i l d - t y p e p r o m o t e r t h a t are nece s s a r y for the e x p r e s s i o n o f t h e 91d g e n e in E. coli. Acknowledgements. We are very indebted to Dr. Gary Sawers for many helpful suggestions concerning the manuscript and to Anna Steibli for editorial work.

References Bergmeyer HU (1983) Methods of enzymatic analysis. Verlag Chemic, Weinheim Buckel P, Zehelein E (1981) Expression of Pseudomonasfluorescens D-galactose dehydrogenase in E. coli. Gene 16:146-159 Cox EC, Horner DL (1982) Dominant mutators in E. coli. Genetics 100:7-18 Franklin FCH, Bagdasarian M, Timmis KN (1981) Manipulation of degradative genes of soil bacterial. FEMS Symp 12:109130 Frantz B, Chakrabarty AM (1987) Organization and nucleotide sequence determination of a gene cluster involved in 3-chlorocatechol degradation. Proc Natl Acad Sci USA 84:4460-4464 Gray G, Smith DH, Baldridge JS, Harkins RN, Vasil ML, Chen EJ, Heyneker HL (1984) Cloning nucleotide sequence and expression in E. coli of exotin A structural gene ofp. aeruginosa. Proc Natl Acad Sci USA 81:2645-2649 Hawley DK, McClure WR (1983) Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res 11:2237-2255 Hoess RH, Herman RK (1975) Isolation and characterization of mutator strains of Escherichia coli K12. J Bacteriol 122:474484 Inouye S, Nakazawa A, Nakazawa T (1984) Nucleotide sequence of the promoter region of the xyICDEGF operon on TOL plasmid of Pseudomonas putida. Gene 29:323-330 Inouye S, Asai Y, Nakazawa A, Nakazawa T (1986) Nucleotide sequence of a DNA segment promoting transcription in Pseudomonas putida. J Bacteriol 166:739-745 Jeenes D J, Soldati L, Baur H, Watson JM, Mencenier A, Reinmann C, Leisinger T, Haas D (1986) Expression of biosyn-

thetic genes from Pseudomonas aeruginosa and Eseheriehia coli in the heterologous host. Mol Gen Genet 203:421-429 Lessie TG, Phibbs RV (1984) Alternative pathways of carbohydrate utilization in Pseudomonas. Ann Rev Microbiol 38:359387 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Martin C, Cami B, Borne F, Jeenes DJ, Haas D, Patte JC (1986) Heterologous expression and regulation of the lysA genes of Pseudomonas aeruginosa and Escheriehia coll. Mol Gen Genet 203: 430-434 Mermod N, Lehrbach PR, Reineke W, Timmis KN (1984) Transcription of the TOL plasmid toluate catabolic pathway operon of Pseudomonas putida is determined by a pair of co-ordinately and positively regulated overlapping promoters. EMBO J 3:2461-2466 Messing J, Vieira J (1982) A new pair of M13 vectors for selecting either DNA strand of double-digest restriction fragment. Gene 19:264-276 Messing J, Crea R, Seeburg PH (1981) A system for shotgun DNA sequencing. Nucleic Acids Res 9:309-321 Minton NP, Clarke LE (1985) Identification of the promoter of the Pseudomonas gene coding for carboxypeptide G2. J Mol Appl Genet 3:26-35 Nakazawa T, Inouye S, Ebina Y, Nakazawa A (1983) Complete nucleotide sequence of the metapyroeatechase gene on the TOL plasmid of Pseudomonas putida rot-2. J Biol Chem 258:2923-2928 O'Neill MC (1989) Escherichia eoli promoters I. Consensus as it relates to spacing class, specificity, repeat substructure and three-dimensional organization. J Biol Chem 264:5522-5530 Rosenberg M, Court D (1979) Regulatory sequences involved in the promotion and termination of RNA transcription. Ann Rev Genet 13:319-353 Ruether U, Koenen M, Otto K~ Mfiller-Hill B (1981) pUR222, a vector for cloning and rapid chemical sequencing of DNA. Nucleic Adds Res 9:4087-4098 Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5467 Schell MA (1985) Transcriptional control of the nah and sal hydrocarbon-degradation operons by nahR gene product. Gene 36:301-309 Schumacher G, Hilscher W, M6llering H, Siedel J, Buckel P (1989) Enzymatische Analyse in der klinischen Diagnostik. Biotech Forum 1 : 14-18 Sperka S, Zehelein E, Fiedler S, Fischer S, Sommer R, Buckel P (1989) Complete nucleotide sequence of Pseudomonasfluorescens D-galactose dehydrogenase gene. Nucleic Acids Res 17: 5402 Summers WC (1970) A simple method for extraction of RNA from E. coli utilizing diethyl pyrocarbonate. Anal Biochem 33:459-465 Talmadge K, Gilbert W (1980) Construction of plasmid vectors with unique PstI cloning sites in a signal sequence coding region. Gene 12:235-241 Weaver R, Weissmann C (1979) Mapping of RNA by a modification of the Beck-Sharp procedure: the 5' termini of 15S fl-globin mRNA precursor and mature 10S fl-globin mRNA have identical map coordinates. Nucleic Acids Res 7:1175-1193