Developmental and Comparative Immunology 45 (2014) 291–299

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

The immunomodulation of a novel tumor necrosis factor (CgTNF-1) in oyster Crassostrea gigas Ying Sun a,b, Zhi Zhou a, Lingling Wang a,⇑, Chuanyan Yang a, Shuai Jianga a, Linsheng Song a,⇑ a b

Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China University of Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e

i n f o

Article history: Received 23 January 2014 Revised 11 March 2014 Accepted 12 March 2014 Available online 29 March 2014 Keywords: Tumor necrosis factor Immunomodulation Apoptosis Phagocytosis Oyster

a b s t r a c t Tumor necrosis factor (TNF) is one of the most important cytokines involved in many processes in both vertebrate and invertebrate. In the present study, a new tumor necrosis factor with a typical TNF domain was identified in oyster Crassostrea gigas (designated CgTNF-1). CgTNF-1 shared low sequence identity and similarity with the TNF superfamily members from other vertebrate and invertebrate. After LPS stimulation, the mRNA expression of CgTNF-1 in haemocytes increased significantly and peaked at 12 h (1.39 ± 0.12, P < 0.05) post treatment, and the expression of CgTNF-1 protein in haemolymph also increased obviously during 6–12 h. When the oyster haemocytes were incubated with rCgTNF-1, its apoptosis and phagocytosis rate were both effectively induced and peaked at 12 h post the treatment of rCgTNF-1 with the concentration of 100 ng mL1 (23.3 ± 3%, P < 0.01), 50 ng mL1 (5.3 ± 0.6%, P < 0.05) and 10 ng mL1 (6.7 ± 1.2%, P < 0.05), respectively. After the co-stimulation of LPS and rCgTNF-1, the apoptosis and phagocytosis rate of oyster haemocytes, and the activities of PO and lysozyme in the haemolymph all increased significantly, and reached the peak at 12 h (apoptosis rate 26.7 ± 1.5%, P < 0.01), 12 h (phagocytosis rate 8.3 ± 0.6%, P < 0.01), 6 h (PO 1.11 ± 0.01 U mg prot1, P < 0.01) and 12 h (lysozyme 168.9 ± 8.3 U mg prot1, P < 0.05), respectively, which were significantly higher than that in the LPS group. Furthermore, the antibacteria activity in the LPS + TNF group was significantly higher than that in the LPS group during 6– 12 h. All the results collectively indicated that CgTNF-1 was involved in the oyster immunity and played a crucial role in the modulation of immune response including apoptosis and phagocytosis of haemocytes, and regulation of anti-bacterial activity as well as the activation of immune relevant enzymes. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Tumor necrosis factor (TNF) belongs to a large family of structurally related proteins named the ‘‘TNF superfamily’’. It refers to a group of cytokines of type II transmembrane protein with a conserved homotrimeric C-terminal TNF homology domain (termed the TNF homology domain), which can bind to the cysteine-rich domain of their cognate receptors (MacEwan, 2002). The tumor regression activity of TNF was first reported in 1962 in mice treated with Serratia marcescens polysaccharide and resulted in tumor (sarcoma 37) regression (Carswell et al., 1975; Omalley et al., 1962). So far, a large number of TNF superfamily members have been identified in vertebrate (Locksley et al., 2001), and there are ⇑ Corresponding authors. Address: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Rd., Qingdao 266071, China. Tel.: +86 532 82898552; fax: +86 532 82880645 (L. Song). E-mail address: [email protected] (L. Song). http://dx.doi.org/10.1016/j.dci.2014.03.007 0145-305X/Ó 2014 Elsevier Ltd. All rights reserved.

19 different members of TNF superfamily in mammals (Mekata et al., 2010). TNF in mammal especially in human is considered to be pleiotropic and multifunctional, and all the TNF members exhibit proinflammatory effects. There are several TNF members exhibiting proliferative activity on hematopoietic cells, or playing essential roles in morphogenetic change and differentiation, and there are some other members which are involved in apoptosis (Aggarwal et al., 2012). The members of TNF have also been reported to activate some signal pathways to modulate important immune processes after they bond to the receptors, contributing to pathogen elimination and adaption maintenance in infectious diseases. For example, as the first identified factor, TNF-a produced by some types of immunocytes displays antitumor activity and elicits a particularly broad spectrum of humoral and cellular immune responses (Aggarwal, 2003; Deroose et al., 2011, 2012; Gruenhagen et al., 2009; Xiao et al., 2007). Furthermore, TNF-a can regulate some crucial cellular immune processes such as

292

Y. Sun et al. / Developmental and Comparative Immunology 45 (2014) 291–299

phagocytosis, apoptosis, cell differentiation and proliferation (Goetz et al., 2004; Kriegler et al., 1988; Locksley et al., 2001). TNF-a can also interact directly with certain pathogenic bacteria and parasites through a region responsible for the lectin-like activity for N,N0 -diacetylchitobiose (Beschin et al., 2001; Lucas et al., 1994). Compared with those in vertebrate, the study on TNF superfamily in invertebrate is still at the beginning. The first TNF superfamily member in invertebrate can be traced back to Eiger in 2002 which is expressed in the nervous system and induces cell death and complete eye loss by a well defined pathway in Drosophila (Moreno et al., 2002; Narasimamurthy et al., 2009). It was also reported that the TNF superfamily member could be involved in gonad development in the ascidian Ciona savignyi (CsTL) (Zhang et al., 2008). A total of four TNF superfamily members are present in the genome of the purple sea urchin, Strongylocentrotus purpuratus, and they are identified as potential gene orthologues of TNFSF14 (LIGHT), TNFSF15 (TL1A), and two separate genes resembling EDA (Hibino et al., 2006). Furthermore, TNF superfamily members in arthropod and mollusc have also been found to be implicated in the immune response. A TNF superfamily member from kuruma shrimp Marsupenaeus japonicas (MjTNF) was considered to be implicated indirectly in immune function (Mekata et al., 2010). There were two TNF superfamily members identified in the disk abalone, Haliotis discus, and both of them are involved in immune response (De Zoysa et al., 2009a,b). Though there is accumulating reports on TNF superfamily members in invertebrate in recent years, the classification and modulatory function of TNF in invertebrate remains largely elusive, and its function in the immune response of invertebrate needs to be explored. The oyster Crassostrea gigas is one of the most important maricultural bivalves, and the release of its genome provides valuable information to recognize the immune system of this marine organism. The investigations of TNF superfamily members in oyster is necessary to understand the function and classification of invertebrate TNFs. In the present study, a new TNF superfamily member (designated CgTNF-1) with typical TNF domain was identified from oyster C. gigas. After LPS stimulation, the mRNA and protein expression of CgTNF-1 in haemocytes, the apoptosis and phagocytosis rates of haemocytes, and the activities of phenoloxidase (PO), lysozyme, and the anti-bacterial activity in the haemolymph supernatant were determined to explore the immune regulation of CgTNF-1 in oysters.

2. Materials and methods 2.1. Oysters Healthy oysters C. gigas (average shell length of 13.0 cm) were collected from a local farm in Qingdao, Shandong Province, China in April and cultured in the aerated seawater at 15–25 °C for 10 days before processing.

2.2. RNA isolation and cDNA synthesis Total RNA was isolated from oyster haemocytes using Trizol reagent (Invitrogen) following its manual. The first strand cDNA synthesis was carried out based on Promega M-MLV RT Usage information using the DNase I (Promega)-treated total RNA as template and oligo (dT)-adaptor as primer P1 (Table 1). The reaction was performed at 42 °C for 1 h, terminated by heating at 95 °C for 5 min. The cDNA mix was diluted to 1:100 and stored at 80 °C for subsequent gene cloning and SYBR Green fluorescent quantitative real-time RT-PCR.

Table 1 Primers used in this study. Primer name Clone primers P1(oligo (dT)-adaptor) P2(forward) P3(reverse) Sequence primers P4 (M13-47) P5 (RV-M) RT primers P6 (CgTNF-RTF) P7 (CgTNF-RTR) P8 (EF-RTF) P9 (EF-RTR) Recombination primers P10(forward) P11(reverse)

Sequence(50 –30 ) GGCCACGCGTCGACTAGTACT17 ATGAATCTACCACCGATCGAAGG TCACAGCTTGAAGACGCCAAAA CGCCAGGGTTTTCCCAGTCACGAC GAGCGGATAACAATTTCACACAGG CTTCTCGTCTGCGGCTTCTTT CAGGGCTGCGGTCTTTCC AGTCACCAAGGCTGCACAGAAAG TCCGACGTATTTCTTTGCGATGT AACGGGATCCGTCCGGTTGTCAGACAACGATA AAGAATGCGGCCGCTCACAGCTTGAAGACGCC-AA

2.3. The cloning and sequence analysis of full-length cDNA Sequence information of CgTNF-1 (JH818057, EKC35158.1) was retrieved from the National Center for Biotechnology Information (http://www.ncbi.nlm.gov). A pair of gene specific primers P2 and P3 (Table 1) was designed to clone the full cDNA sequence of CgTNF-1. The PCR product was gel-purified and cloned into the pMD 18-T simple vector (TaKaRa) and sequenced with primers P4 and P5 (Table 1). The resulting sequences were verified and subjected to cluster analysis. The homology searches of the cDNA and amino acid sequences of CgTNF-1 were conducted with BLAST algorithm at the National Center for Biotechnology Information (http://www.ncbi.nlm.gov/ blast). The protein domains were predicted with the simple modular architecture research tool (SMART) version 7.0 (http:// www.smart.embl-heidelberg.de/). Multiple alignment of CgTNF-1 and some TNF superfamily members were performed with the ClustalW multiple alignment program (http://www.ebi.ac.uk/ clustalw/). 2.4. Recombinant expression of CgTNF-1 and preparation of polyclonal antibody The cDNA fragment encoding the functional domain (not containing transmembrane domain) of CgTNF-1 was amplified with the primers P10 and P11 (Table 1). BamH I and Not I site sequences were added to the 50 end of primer P10 and P11, respectively. The PCR fragment was digested with restriction enzymes BamH I and Not I (NEB), and ligated into predigested expression vector pET30a (Novagen). The recombinant plasmid (pET-30a-CgTNF-1) was transformed into Escherichia coli transetta (DE3) (TransGen). After inducible expression by low temperature, the bacterial culture was ultrasonicated and centrifuged to get the supernatant which contain soluble target protein. rCgTNF-1 was purified with a Ni2+ chelating Sepharose column and dialyzed out of imidazole for 12 h. The resultant protein was separated by reducing 15% SDS– polyacrylamide gel electrophoresis (SDS–PAGE), and visualized with Coomassie Bright Blue R250. The concentration of purified rCgTNF-1 was quantified by BCA method (Smith et al., 1985). The soluble target protein after dialysis was immuned to 6 weeks old rats to acquire polyclonal antibody as described previously (Cheng et al., 2006). 2.5. LPS and rCgTNF-1 stimulation and haemolymph collection In order to confirm the lowest biological concentration of CgTNF1, one hundred oysters were divided into five groups including low

Y. Sun et al. / Developmental and Comparative Immunology 45 (2014) 291–299

concentration group (10 ng mL1), medium concentration group (50 ng mL1), high concentration group (100 ng mL1), PBS control group and blank group. One hundred microliter of rCgTNF-1 solution was injected into adductor of each oyster in three rCgTNF-1 stimulation groups, and each oyster in PBS control group received an injection of 100 lL PBS (9.5 mmol L1 NaH2PO32H2O, 42.4 mmol L1 Na2HPO312H2O, 300 mmol L1 NaCl, pH 7.4). These treated oysters were returned to water tanks, and six individuals were sampled randomly at 6 and 12 h post-injection. The untreated oysters were employed as blank group, and sampled randomly at 0 h. Haemolymph were collected within precooled anticoagulant (0.5% EDTA in PBS) and then immediately centrifuges at 800g, 4 °C for 10 min to harvest haemocytes. The haemocytes were kept on ice for phagocytosis and apoptosis assay. In LPS and rCgTNF-1 stimulation experiment, one hundred and sixty oysters were divided into four groups including rCgTNF-1 stimulation group, LPS (Sigma Aldrich) stimulation group, PBS control group and blank group. One hundred microliter of the mixture of rCgTNF-1 (10 ng mL1) and LPS (0.5 mg mL1 in PBS) was injected into adductor of each oyster in rCgTNF-1 stimulation group, while each oyster in LPS and PBS control group received an injection of 100 lL LPS (0.5 mg mL1 in PBS) and PBS, respectively. The untreated oysters were employed as blank group and sampled randomly at 0 h. Six oysters were sampled randomly in each treatment group at 3, 6, 12 and 24 h after stimulation. Haemolymph was collected within precooled anticoagulant and centrifuged to harvest haemocytes for phagocytosis and apoptosis assay, while the haemolymph extracted without anticoagulant was centrifuged to obtain haemolymph supernatant for subsequent anti-bacterial and enzymes activity assay. 2.6. The examination of CgTNF-1 mRNA expression by Real-time PCR The CgTNF-1 mRNA transcripts in oyster haemocytes were measured by fluorescent quantitative real-time RT-PCR, which was carried out in an ABI PRISM 7300 Sequence Detection System. Two CgTNF-1 specific primers, sense primer P6 and reverse primer P7 (Table 1), were used to amplify a corresponding product of 135 bp. The oyster EF (Elongation Factor) fragment, amplified with primers P8 and P9 (Table 1), was chosen as reference gene for internal standardization. The PCR amplifications were conducted in triplicate in a 25 lL reaction volume. After the PCR program, dissociation curve analysis of amplification products was performed by using the SDS 2.0 software (Applied Biosystems) to confirm that only one PCR product was amplified specifically. The comparative average cycle threshold method was used to analyze the expression level of CgTNF-1 mRNA, and the value stood for an n-fold difference relative to the calibrator (Zhang et al., 2010). 2.7. Western blotting of CgTNF-1 protein expression The protein concentration of haemolymph supernatants collected from oysters after PBS and LPS stimulation was quantified by BCA method and adjusted to 650 mg mL1. After SDS–PAGE, the protein was electrophoretically transferred on to a 0.45 mm pore nitrocellulose membrane at 30 mA (the current was determined by the area of the gel) for 50 min using ECL Semi-dry Blotters (Amersham Biosciences). After blocking with confining liquid (5% skimmed milk, 20 mmol L1 Tris–HCL, 150 mmol L1 NaCl) at 4 °C overnight, the membrane was incubated with CgTNF-1 polyclonal antibodies diluted to 1:1000 in TBS (20 mmol L1 Tris– HCL, 150 mmol L1 NaCl) at room temperature for 3 h. The membrane was washed three times with TBST (TBS containing 0.05% Tween-20) and then incubated with goat-anti-rat IgG (Beyotime) diluted to 1:4000 in TBS at room temperature for 1.5 h. After washed with TBST three times, each for 15 min, the membrane

293

was incubated in Western lighting-ECL substrate system (Perkin Elmer) before exposure to X-OMAT AR X-ray film (Eastman Kodak, Rochester, NY). Rats’ pre-immune serum was used as negative control. 2.8. The detection of haemocyte apoptosis The apoptosis of oyster haemocytes was determined by the manual of Annexin V-FITC Apoptosis Detection Kit (KeyGEN, China). Briefly, the collected haemocytes were washed twice with sterile seawater, resuspended by Annexin V-FITC binding buffer, and then incubated with Annexin V-FITC in dark at room temperature for 10 min. After centrifuging at 1000g for 5 min, the pellet was resuspended by Annexin V-FITC buffer, and stained with propidium iodide in dark for 15 min. The apoptosis index (AI) was measured under a fluorescence microscope by enumerating 100 apoptotic cells per slide and each group with three slides. The AI was calculated by the ratio between apoptotic cells and total cells. 2.9. The detection of haemocyte phagocytic capability The bacteria Vibrio splendidus was treated with formalin (10%) for 10 min and washed with 0.1 mol L1 NaHCO3 (pH 9.0) for three times. The rinsed bacteria were incubated in 0.1 mol L1 NaHCO3 containing 1 mg mL1 FITC (sigma) at room temperature with gentle stirring for 1 h. The final concentration of the rinsed bacteria was adjusted to be 108 cell mL1. The rinsed haemocytes (1  106 cell mL1) was mixed with FITC-labeled bacteria in volume proportion of 1:1, and the mixture was incubated shielding from light at room temperature for 30 min. Fifty microliter of the mixture was smeared onto the slide, following by the incubation to settlement for 30 min. After fixed with formalin (10%) for 10 min, the cells were dyed by 0.01% Evan’s Blue (100 mg mL1) for 10 min, and then 2 mg mL1 (the final concentration) Trypan Blue was added into the mixture. After washed twice by sterile seawater, 10 lL glycerol was added to the slides and the phagocytosis rate (PR) was assessed by using a fluorescence microscope (Olympus, Japan). At least 100 haemocytes on each slide were counted under a microscope, and the PR representing the phagocytic ability was calculated as follow: PR = (Number of phagocytic haemocytes)/(total haemocytes)  100%. 2.10. PO activity in haemolymph supernatant The PO activity was measured according to the oxidation reaction of L-dopa by haemolymph supernatant following the procedure of Asokan et al. (1997) with slight modifications. L-dopa was used as diphenolase substrate, and the formation of o-quinones was recorded spectrophotometrically. Briefly, 100 lL haemolymph supernatant and the same volume of L-dopa (4 mg mL1) were added into the 96-well plate for each sample, and the absorbance values were recorded at 490 nm using Multiskan microplate reader (BioTek, USA) immediately. The elevation of 0.001 absorbance value at 490 nm in 1 min was defined as one PO unit. The final result was determined by the relative PO activity which was expressed as unit activity of per mg of protein in the sample (U mg prot1, N = 6). 2.11. The measurement of lysozyme activity The lysozyme activity was measured according to the manual of a lysozyme assay kit (Jiancheng, Nanjing, China). Briefly, the haemolymph supernatant and bacterial suspension (0.25 mg mL1 in the bacterial buffer supplied by the kit) in proportion of 1:5 were added into the 96-well plates, respectively. The mixtures were incubated at 37 °C for 15 min, bathed on ice for 3 min immediately.

294

Y. Sun et al. / Developmental and Comparative Immunology 45 (2014) 291–299

The lysozyme activity was determined by the reduction of the absorbance at 530 nm measured at room temperature. Lysozyme activity was expressed as unit activity per mg of protein in the sample (U mg prot1, N = 6).

similarity (21.2%) with TNF-a from C. savignyi, while lower identity (9.4%) and similarity (18.2%) with eiger in Drosophila. According to multiple sequences alignment, the conserved sequence was only observed in the TNF characteristic domain among these organisms (Fig. 1).

2.12. The detection of anti-bacterial ability The anti-bacterial ability of haemolymph supernatant was detected according to the following procedures. The haemolymph supernatant was sterilized by the filter (0.22 lm). One hundred microliter sterilized haemolymph supernatant and 2 lL of V. splendidus solution (1.0  108 CFU mL1 suspended with sterilized seawater) were incubated in a 96-well flat-bottomed microtiter plate at 28 °C for 3 h, and 100 lL sterilized seawater with 2 lL of V. splendidus solution was used as control. After the incubation, 100 lL of the mixture was added to 100 lL medium and examined the absorbance at 600 nm. The OD value of the mixture was continually read using a microtiter plate reader (BioTek, USA) for 12 h every 30 min. The value of T50 was defined as half of the time point when the control reach the maximum OD value at the 600 nm absorbance, and it was used to determine the anti-bacterial ability following the instruction of Pope et al. (2011). The differences were acquired according to the result of comparison of T50 among groups.

3.2. The recombinant protein of CgTNF-1 (rCgTNF-1) and the specificity of its antibody The cDNA fragment encoding the functional domain of CgTNF-1 was amplified and ligated to the recombinant plasmid (pET-30aCgTNF-1). After IPTG induction, the supernatant of the whole cell lysate of E. coli transetta (DE3) with pET-30a-CgTNF-1 was collected, and the purified rCgTNF-1 protein was analyzed by SDS– PAGE. A distinct band with molecular weight of 32.6 kDa was revealed, which was consistent with the predicted molecular mass (Fig. 2, Lanes 1–4). The purified rCgTNF-1 protein was used to prepare antibody and stimulation experiment. Western blotting was carried out to identify the specificity of CgTNF-1 antibody. There was a clear band of CgTNF-1 with high specificity observed, and few non-specific bands were visible (Fig. 2, lane 5). As negative control, no obvious band was detected in group of rats’ pre-immune serum (data not shown). 3.3. The temporal expression of CgTNF-1 mRNA in haemocytes after LPS stimulation

2.13. Data analysis All the data was expressed as mean ± S.D. (N = 3 or 6). The significant differences among groups were subjected to one-way analysis of variance (one-way ANOVA) and multiple comparisons. Statistically significant difference was designated at P < 0.05 and extremely significant at P < 0.01. 3. Result

The expression level of CgTNF-1 mRNA was investigated from 3 to 48 h after LPS stimulation. The mRNA expression level of CgTNF1 increased significantly at 12 h (1.39 ± 0.12, P < 0.05) after LPS stimulation compared to that in the PBS control group, and then it decreased to the initial level at 24 h. Furthermore, there was no significant alteration in the expression level of CgTNF-1 mRNA between blank group and PBS control group during the whole experimental process (Fig. 3).

3.1. Molecular characteristics and homologous analysis of CgTNF-1 According to the sequence retrieved from NCBI (GenBank Accession No. JH818057), a pair of gene specific primers, P2 and P3, were designed and a PCR product of 1014 bp was amplified from cDNA library of oyster. Its sequence was consistent with that of previous submission, and its open reading frame (ORF) encodes a polypeptide of 337 amino acids with a predicted molecular weight of 38.01 kDa and theoretical isoelectric point (pI) of 8.25. There were a characteristic transmembrane domain at the 74–96 amino acid and a typical TNF domain ranging from 184 to 337 amino acid. Sequences of TNFs from some other animals were downloaded and used for identity and similarity analysis (Table 2). The sequence of CgTNF-1 shared the most identity (10.9%) and

Table 2 The percentage identities and similarities of CgTNF and other TNFSF in organisms. Accession number

Organism

I%

S%

EU216599 AJ277604 AB040448 EU863217 NM_206069 NM_013693 A25451 Z15026

sea squirts rainbow trout flounder disk abalone drosophila mouse rabbit human

10.9 10.5 9.9 9.6 9.4 9.4 8.5 7.9

21.2 19.5 17.6 18.4 18.2 17.9 17.3 17.3

I%: identity, calculated as the percentage of identical amino acids per position in alignments; S%: similarity, calculated as the percentage of identical plus similar residues. I% and S% were analyzed using the Ident and Sim Analysis provided on http://www.bioinformatics.org/sms/. doi:10.1371/journal.pone.0032012.t002.

3.4. The concentration alteration of CgTNF-1 protein in haemolymph after LPS stimulation The oyster haemolymph supernatant was collected at 3, 6, 12 and 24 h after LPS stimulation, and the concentration of total protein was adjusted to be 650 lg mL1. In western blotting analysis, the grey level of the band represented the concentration of CgTNF1 protein in the haemolymph after stimulation. The concentration of CgTNF-1 at 6 and 12 h after LPS stimulation was significantly higher than that in the PBS group (Fig. 4). 3.5. The change of haemocyte apoptosis and phagocytosis rate after the treatment with different concentration of rCgTNF-1 The apoptosis rate and phagocytosis rate of oyster haemocytes increased significantly in all three rCgTNF-1 stimulation groups compared to the PBS group. In the 100 ng mL1 stimulation group, both of the apoptosis rate and phagocytosis rate reached the highest level at 12 h, which were 23.3 ± 3% (P < 0.01, Fig. 5A) and 19.4 ± 0.8% (P < 0.01, Fig. 5B), respectively. There was also significant increase of apoptosis and phagocytosis rate of oyster haemocytes in 50 ng mL1 and 10 ng mL1 group. The most significant increase of apoptosis rate was at 12 h in 50 ng mL1 group (5.3 ± 0.6%, P < 0.05), and the phagocytosis rate was at 6 h (6.6 ± 1.3%, P < 0.01). In 10 ng mL1 group, the most significant increase of apoptosis rate was at 12 h (6.7 ± 1.2%, P < 0.05) and of phagocytosis rate was at 6 h (6.4 ± 1.6%, P < 0.05). But there was no obvious difference between the 50 ng mL1 and 10 ng mL1 CgTNF-1 stimulation group.

Y. Sun et al. / Developmental and Comparative Immunology 45 (2014) 291–299

295

Fig. 1. Comparison of the amino acid sequence of the TNF superfamily members in both vertebrate and invertebrate. Typical TNF domains are boxed. human: Z15026; rabbit: A25451; mouse: NM_013693; flounder: AB040448; rainbow trout: AJ277604; fruit fly: NM_206069; disk abalone: EU863217; oyster: JH818057; sea squirt: EU216599.

the PBS group. It was gradually increased from 3 h and attained the peak at 12 h (8.3 ± 0.6%, P < 0.01) and then decreased at 24 h (3.3 ± 0.6%, P < 0.05). In addition, the phagocytosis rates in the LPS + TNF group were significantly higher than that in the LPS group at 6 and 12 h after the treatment. There was also significant increase of phagocytosis rates observed in haemocytes of oysters at 6 h (3.3 ± 0.6%, P < 0.05) and 12 h (3.5 ± 0.5%, P < 0.05) in LPS stimulation group, in comparison with those in PBS groups (Fig. 7A). 3.7. The enzyme activities of haemolymph supernatant after the stimulation of LPS and rCgTNF-1

Fig. 2. SDS–PAGE and Western-blot analysis of CgTNF-1. Lane M: protein molecular standard; lane 1: negative control for CgTNF-1 (without induction); lane 2: induced CgTNF-1 (the whole cell lysate); lane 3: induced CgTNF-1 (the supernatant); lane 4: purified protein; lane 5: Western blot based on the sample of lane 4.

3.6. The temporal change of apoptosis and phagocytosis rate of oyster haemocytes after the stimulation of LPS and rCgTNF-1 The apoptosis rate and phagocytosis rate of oyster haemocytes were both induced significantly after LPS and LPS + TNF stimulation, compared to that in the PBS group. The apoptosis rate of oyster haemocytes peaked at 12 h in both LPS group (23.7 ± 1.5%, P < 0.01) and LPS + TNF group (26.7 ± 1.5%, P < 0.01), which was significantly higher than that in the PBS group. Furthermore, the apoptosis rates of oyster haemocytes in the LPS + TNF group were significantly higher than that in the LPS group during 3–12 h after the treatment (Fig. 6A). The phagocytosis rate of oyster haemocytes in the LPS + TNF group displayed significant increase during 6–24 h compared to

The activities of PO and lysozyme in haemolymph supernatant were examined to explore the immunomodulation of CgTNF-1. After LPS and LPS + TNF stimulation, PO activity in the supernatant of oyster haemolymph increased significantly in comparison with that in control group. In the LPS + TNF group, PO activity raised significantly at 3 h (0.65 ± 0.02 U mg prot1, P < 0.01) and reached the peak at 6 h (1.11 ± 0.01 U mg prot1, P < 0.01), which were both significantly higher than that in the LPS group (Fig. 8A). In the LPS group, there were also significant increases at 3 h (0.52 ± 0.01 U mg prot1, P < 0.05), 6 h (0.73 ± 0.01 U mg prot1, P < 0.01) and 24 h (0.68 ± 0.01 U mg prot1, P < 0.01) compared to that in the PBS group. The lysozyme activity did not change significantly after LPS stimulation in all the three groups (PBS, LPS, LPS + TNF). However, it increased significantly to 164.5 ± 9.5 U mg prot1 at 6 h (P < 0.05) and reached the highest level at 12 h (168. 9 ± 8.3 U mg prot1, P < 0.05) in LPS + TNF group, compared to that in the LPS and PBS group, and then decreased to 150.2 ± 11.0 U mg prot1 at 24 h, which was both higher than that in control group and LPS groups (P < 0.05) (Fig. 8B).

296

Y. Sun et al. / Developmental and Comparative Immunology 45 (2014) 291–299

Fig. 3. Temporal expression of CgTNF-1 mRNA detected by real-time PCR in oyster haemocytes after in vivo LPS injection at 3, 6, 12, 24 and 48 h. EF (Elongation Factor) gene was used as an internal control to calibrate the cDNA template for all the samples. Each value is shown as mean ± S.D. (N = 6). The significant differences among the control and treated groups were subjected to one-way analysis of variance (one-way ANOVA).

anti-bacterial activity significantly increased at 6 h (1.99 ± 0.06, P < 0.05) and reached the peak at 12 h (2.32 ± 0.03, P < 0.05) compared to that in the PBS group. Significant difference of anti-bacterial activity was observed during 6–12 h between LPS + TNF group and LPS group. There was no significant difference in the anti-bacterial activity of the haemolymph supernatant between LPS and PBS group during the whole process (Fig. 8C). Fig. 4. The distant band of target protein (CgTNF-1) in Western blotting of collected oyster haemocytes supernatant. 0 h: haemocytes supernatant without any treatment; PBS: haemocytes supernatant after in vivo PBS injection at 3, 6, 12 and 24 h; LPS: haemocytes supernatant after in vivo LPS stimulation at 3, 6, 12 and 24 h; M: protein molecular standard.

3.8. Anti-bacterial activity of haemolymph supernatant The anti-bacterial activity of haemolymph supernatant was elevated during 3–12 h and decreased at 24 h in all from the groups of PBS, LPS and LPS + TNF. In LPS + TNF group, the

4. Discussion Cytokines are vital mediators of inter- and intracellular communications, which contribute to the regulation of many physiologic activity such as development, tissue repair, haemopoiesis, inflammation and immune responses (Dinarello, 2000; Haddad et al., 2000; Holloway et al., 2002; Pope et al., 2011; Safieh-Garabedian et al., 1997a,b). TNF is a pleiotropic cytokine and elicits a wide range of cellular responses, and it plays a major important roles

Fig. 5. The change of oyster haemocyte apoptosis and phagocytosis rate after in vivo stimulation of different concentration of rCgTNF-1 (10, 50 and 100 ng mL1) at 6 and 12 h. Each value is shown as mean ± S.D. (N = 3). The significant differences among the control and treated groups were subjected to one-way analysis of variance (one-way ANOVA). (A) Apoptosis rate of oyster haemocytes. (B) Phagocytosis rate oyster haemocytes.

Y. Sun et al. / Developmental and Comparative Immunology 45 (2014) 291–299

297

Fig. 6. Effect of in vivo stimulation of C. gigas with LPS or plus TNF (10 ng mL1) on haemocytes apoptosis. Data presented as mean ± S.D. (N = 3) of percent of apoptosis rate. The significant differences among the control and treated groups were subjected to one-way analysis of variance (one-way ANOVA). (A) Apoptosis rate of oyster haemocytes. (B) Immunocytes of C. gigas after 12 h following treatment with PBS, LPS and LPS + TNF. a and d: haemocytes from oysters injected with PBS; b and e: haemocytes from oysters stimulated with LPS; c and f: haemocytes from oysters treated with LPS and TNF (a–c were under visible light microscope; d–f were under fluorescent microscope). Apoptotic cells were exhibited green under fluorescent microscope.

Fig. 7. Effect of in vivo stimulation of C. gigas with LPS or plus TNF(10 ng mL1) on haemocytes phagocytosis. Data presented as mean ± S.D. (N = 3) of percent of phagocytosis rate. The significant differences among the control and treated groups were subjected to one-way analysis of variance (one-way ANOVA). (A) Phagocytosis rate of oyster haemocytes. (B) Immunocytes of C. gigas following treatment with LPS + TNF after 12 and 6 h. Phagocytic cells were exhibited green under fluorescent microscope.

in the host defence against bacterial, viral and parasitic infections (Waters et al., 2013). Recently, several TNF superfamily members were discovered and preliminarily characterized in invertebrate (Wiens and Glenney, 2011). In the present study, the genome of the oyster C. gigas was screened, and the ORF corresponding to CgTNF-1 was identified. The cDNA of CgTNF-1 was of 1014 bp encoding a polypeptide of 337 amino acids with a typical TNF domain. The amino acid sequence of CgTNF-1 shared relatively higher sequence similarity with two invertebrate TNFs from C. savignyi and Haliotis discus, while lower identity and similarity with that from other invertebrate and vertebrate including human TNF-a. The conserved sequence was only observed in the TNF characteristic domain among these organisms, suggesting that the high sequence divergence existed between CgTNF-1 and other TNF superfamily members. As available information about invertebrate TNF is limited, the diversity of its structure and function is not clear, and the classification is still remain vague. The information about the temporal expression of mRNA in haemocytes and protein in haemolymph was meaningful to understand the relevant function of CgTNF-1. After LPS treatment, the mRNA expression of CgTNF-1 increased significantly at 12 h, and the expression of CgTNF-1 protein also increased during 6–12 h. The consistent rise of the CgTNF-1 mRNA and protein indicated that CgTNF-1 was probably involved in the innate immune

response of oyster. The up-regulation of CgTNF-1 mRNA after LPS stimulation was similar to the inducible expression of LPS-induced TNF factors (LITAF), a transcriptional factor to regulate TNF-a expression by binding to its promoter (Myokai, 1999), in scallop Chlamys farreri and oyster C. gigas after LPS stimulation (Yu et al., 2007) or challenge with a mixture of pathogenic Vibrio species (Park et al., 2008). The inducible transcription and protein level of CgTNF-1 after LPS stimulation indicated that CgTNF-1 could respond to immune stimulation and function as important molecules modulating the immune reaction in oyster. Vertebrates TNF-a can regulate some crucial cellular immune processes such as phagocytosis, apoptosis, cell differentiation and proliferation (Goetz et al., 2004; Kriegler et al., 1988; Locksley et al., 2001). In the present study, the haemocyte apoptosis and phagocytosis rates were surveyed to understand the inducible cellular activities of CgTNF-1 protein at three concentrations. The apoptosis and phagocytosis rate in three stimulation groups all increased significantly during 6–12 h with a dose-depend effect. These results indicated that CgTNF-1 could participate in the physiological regulation and potential immune response. The apoptosis and phagocytosis rate of oyster haemocytes in vivo was further assayed after the oysters were treated with LPS/LPS + TNF. Haemocyte apoptosis increased significantly during 3–24 h after LPS or LPS + TNF stimulation compared to that in the

298

Y. Sun et al. / Developmental and Comparative Immunology 45 (2014) 291–299

Fig. 8. Effect of in vivo stimulation of C. gigas with LPS or plus TNF (10 ng mL1) on the humoral immunity. The significant differences among the control and treated groups were subjected to one-way analysis of variance (one-way ANOVA). (A) PO activity of C. gigas haemolymph supernatant. (B) Lysozyme activity of C. gigas haemolymph supernatant. (C) Anti-bacterial ability of C. gigas haemolymph supernatant.

PBS group, and the apoptosis rate in the LPS + TNF group was significantly higher than that in the LPS group during 3–12 h. The haemocyte phagocytosis in the LPS + TNF group was also increased significantly from 6 to 24 h after stimulation. These results demonstrated that CgTNF-1 could induce the apoptosis and phagocytosis of the oyster haemocytes during the immune process. TNF superfamily members in vertebrate are multifunctional soluble cytokines that can regulate many cellular processes such as cell differentiation, proliferation and cell phagocytosis (Goetz et al., 2004) and be involved in activating the apoptosis during the immune process (Idriss and Naismith, 2000; Locksley et al., 2001; MacEwan, 2002). Apoptosis have a prime role for the adequate clearance of infected, damaged and exhausted cells, espe-

cially when the hosts suffer from infection or dissemination (Benedict et al., 2002). Phagocytosis also occupies an important position in eliminating apoptotic cells and invading pathogens in response to pathogens. In the present study, the elevation of apoptosis and phagocytosis might contribute to the protective functions of CgTNF-1 that help organisms eliminate the pathogen and restore homeostasis rapidly. The present results indicated that CgTNF-1 might devote to promoting the apoptosis and phagocytosis of the haemocytes and regulate cellular response of oysters against infection. As invertebrates, oysters rely exclusively on innate immune reactions to defense against pathogenic microorganisms (Loker et al., 2004), and its immune response is mediated by both cellular and humoral components. In the present study, the activities of PO and lysozyme, and the anti-bacteria activity were chosen to investigate the immune regulation of CgTNF-1 on humoral response in oyster. The PO activity in the LPS + TNF group was significantly higher than that in LPS and PBS groups during 3–12 h after stimulation. The lysozyme and anti-bacteria activity in the haemolymph supernatant displayed obvious increase in the LPS + TNF group compared to that in the LPS and PBS groups. PO converts phenols to quinone and initiates melanogenic pathway during early phase of immune process, which is considered as one of vital regulation enzyme in humoral immune process (Cammarata et al., 1997). L-dopa was used as diphenolase substrate, and the formation of o-quinones was reflected the level of melanization and the activity of PO (Aladaileh et al., 2007). Lysozyme activity is an important index of innate immunity and is ubiquitous in its distribution among living organisms besides its antibacterial function. The antimicrobial capability largely depends on oxidative toxicity derived from oxygen or nitrogen metabolites (Fang, 2004) and the anti-microbe peptides or enzyme. The enhanced anti-bacteria ability of the haemocytes supernatant in oysters induced by CgTNF-1 suggested that it could trigger the humoral immune process of oysters through activating the PO and lysozyme system, along with increasing the anti-bacteria capability of the haemocytes supernatant. In conclusion, CgTNF-1, a new tumor necrosis factor in oysters C. gigas with a typical TNF domain was identified in this paper. Though showing low similarity compared with the TNF superfamily member in vertebrate, CgTNF-1 also could be defined as a new TNF molecule, since the differences of identity and function of TNF superfamily member between invertebrate and vertebrate. CgTNF1 could respond to LPS stimulation, and it also partook in the immunity process of oyster C. gigas after LPS stimulation, including the cellular responses through promoting apoptosis and phagocytosis of the oyster haemocytes and the humoral responses by increasing the activity of PO and lysozyme, as well as the anti-bacteria capability in the haemocytes supernatant. However, exact immunomodulation mechanism of CgTNF-1 on oyster immunity and concrete pathways were still far from well defined. Acknowledgements We are grateful to all the laboratory members for continuous technical advice and beneficial discussions. This research was supported by High Technology Project (863 Program, No. 2014AA093501, 2012AA10A401) from the Chinese Ministry of Science and Technology, and a Grant (41276169) from National Science Foundation of China. References Aggarwal, B.B., 2003. Signalling pathways of the TNF superfamily: a double-edged sword. Nat. Rev. Immunol. 3, 745–756. Aggarwal, B.B., Gupta, S.C., Kim, J.H., 2012. Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood 119, 651–665.

Y. Sun et al. / Developmental and Comparative Immunology 45 (2014) 291–299 Aladaileh, S., Rodney, P., Nair, S.V., Raftos, D.A., 2007. Characterization of phenoloxidase activity in Sydney rock oysters (Saccostrea glomerata). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 148, 470–480. Asokan, R., Arumugam, M., Mullainadhan, P., 1997. Activation of prophenoloxidase in the plasma and haemocytes of the marine mussel Perna viridis Linnaeus. Dev. Comp. Immunol. 21, 1–12. Benedict, C.A., Norris, P.S., Ware, C.F., 2002. To kill or be killed: viral evasion of apoptosis. Nat. Immunol. 3, 1013–1018. Beschin, A., Bilej, M., Torreele, E., De Baetselier, P., 2001. On the existence of cytokines in invertebrates. Cell. Mol. Life Sci. 58, 801–814. Cammarata, M., Arizza, V., Parrinello, N., Candore, G., Caruso, C., 1997. Phenoloxidase-dependent cytotoxic mechanism in ascidian (Styela plicata) hemocytes active against erythrocytes and K562 tumor cells. Eur. J. Cell Biol. 74, 302–307. Carswell, E.A., Old, L.J., Kassel, R.L., Green, S., Fiore, N., Williamson, B., 1975. Endotoxin-induced serum factor that causes necrosis of tumors. Proc. Natl. Acad. Sci. USA 72, 3666–3670. Cheng, S., Zhan, W., Xing, J., Sheng, X., 2006. Development and characterization of monoclonal antibody to the lymphocystis disease virus of Japanese flounder Paralichthys olivaceus isolated from China. J. Virol. Methods 135, 173–180. De Zoysa, M., Jung, S., Lee, J., 2009a. First molluscan TNF-alpha homologue of the TNF superfamily in disk abalone: molecular characterization and expression analysis. Fish Shellfish Immunol. 26, 625–631. De Zoysa, M., Nikapitiya, C., Moon, D.O., Whang, I., Kim, G.Y., Lee, J., 2009b. A novel Fas ligand in mollusk abalone: molecular characterization, immune responses and biological activity of the recombinant protein. Fish Shellfish Immunol. 27, 423–432. Deroose, J.P., Eggermont, A.M., van Geel, A.N., Burger, J.W., den Bakker, M.A., de Wilt, J.H., Verhoef, C., 2011. Long-term results of tumor necrosis factor alpha- and melphalan-based isolated limb perfusion in locally advanced extremity soft tissue sarcomas. J. Clin. Oncol. 29, 4036–4044. Deroose, J.P., Eggermont, A.M., van Geel, A.N., de Wilt, J.H., Burger, J.W., Verhoef, C., 2012. 20 years experience of TNF-based isolated limb perfusion for in-transit melanoma metastases: TNF dose matters. Ann. Surg. Oncol. 19, 627–635. Dinarello, C.A., 2000. Proinflammatory cytokines. Chest 118, 503–508. Fang, F.C., 2004. Antimicrobial reactive oxygen and nitrogen species: concepts and controversies. Nat. Rev. Microbiol. 2, 820–832. Goetz, F.W., Planas, J.V., MacKenzie, S., 2004. Tumor necrosis factors. Dev. Comp. Immunol. 28, 487–497. Gruenhagen, D.J., de Wilt, J.H.W., Van Geel, A.N., Verhoef, C., Eggermont, A.M.M., 2009. Isolated limb perfusion with TNF-alpha and melphalan in locally advanced soft tissue sarcomas of the extremities. Recent Results Cancer Res 179, 257–270. Haddad, J.J., Olver, R.E., Land, S.C., 2000. Antioxidant/pro-oxidant equilibrium regulates HIF-1 alpha and NF-kappa B redox sensitivity – evidence for inhibition by glutathione oxidation in alveolar epithelial cells. J. Biol. Chem. 275, 21130– 21139. Hibino, T., Loza-Coll, M., Messier, C., Majeske, A.J., Cohen, A.H., Terwilliger, D.P., Buckley, K.M., Brockton, V., Nair, S.V., Berney, K., Fugmann, S.D., Anderson, M.K., Pancer, Z., Cameron, R.A., Smith, L.C., Rast, J.P., 2006. The immune gene repertoire encoded in the purple sea urchin genome. Dev. Biol. 300, 349–365. Holloway, A.F., Rao, S., Shannon, M.F., 2002. Regulation of cytokine gene transcription in the immune system. Mol. Immunol. 38, 567–580. Idriss, H.T., Naismith, J.H., 2000. TNF alpha and the TNF receptor superfamily: structure–function relationship(s). Microsc. Res. Tech. 50, 184–195. Kriegler, M., Perez, C., Defay, K., Albert, I., Lu, S.D., 1988. A novel form of TNF/ cachectin is a cell-surface cyto-toxic transmembrane protein – ramifications for the complex physiology of TNF. Cell 53, 45–53. Locksley, R.M., Killeen, N., Lenardo, M.J., 2001. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104, 487–501.

299

Loker, E.S., Adema, C.M., Zhang, S.M., Kepler, T.B., 2004. Invertebrate immune systems – not homogeneous, not simple, not well understood. Immunol. Rev. 198, 10–24. Lucas, R., Magez, S., De Leys, R., Fransen, L., Scheerlinck, J.P., Rampelberg, M., Sablon, E., De Baetselier, P., 1994. Mapping the lectin-like activity of tumor necrosis factor. Science 263, 814–817. MacEwan, D.J., 2002. TNF ligands and receptors – a matter of life and death. Br. J. Pharmacol. 135, 855–875. Mekata, T., Sudhakaran, R., Okugawa, S., Inada, M., Kono, T., Sakai, M., Itami, T., 2010. A novel gene of tumor necrosis factor ligand superfamily from kuruma shrimp (Marsupenaeus japonicus). Fish Shellfish Immunol. 28, 571–578. Moreno, E., Yan, M.H., Basler, K., 2002. Evolution of TNF signaling mechanisms: JNKdependent apoptosis triggered by Eiger, the Drosophila homolog of the TNF superfamily. Curr. Biol. 12, 1263–1268. Myokai, F., 1999. A novel lipopolysaccharide-induced transcription factor regulating tumor necrosis factor alpha gene expression: molecular cloning, sequencing, characterization, and chromosomal assignment. Proc. Natl. Acad. Sci. 96, 4518– 4523. Narasimamurthy, R., Geuking, P., Ingold, K., Willen, L., Schneider, P., Basler, K., 2009. Structure–function analysis of Eiger, the Drosophila TNF homolog. Cell Res. 19, 392–394. Omalley, W.E., Achinstein, B., Shear, M.J., 1962. Action of bacterial polysaccharide on tumors.2. Damage of sarcoma 37 by serum of mice treated with serratia marcescens polysaccharide, and induced tolerance. J. Natl. Cancer Inst. 29, 1169–1175. Park, E.M., Kim, Y.O., Nam, B.H., Kong, H.J., Kim, W.J., Lee, S.J., Kong, I.S., Choi, T.J., 2008. Cloning, characterization and expression analysis of the gene for a putative lipopolysaccharide-induced TNF-alpha factor of the Pacific oyster (Crassostrea gigas). Fish Shellfish Immunol. 24, 11–17. Pope, E.C., Powell, A., Roberts, E.C., Shields, R.J., Wardle, R., Rowley, A.F., 2011. Enhanced cellular immunity in shrimp (Litopenaeus vannamei) after ‘vaccination’. PloS One 6, e20960. SafiehGarabedian, B., Kanaan, S.A., Jalakhian, R.H., Poole, S., Jabbur, S.J., Saade, N.E., 1997a. Hyperalgesia induced by low doses of thymulin injections: possible involvement of prostaglandin E(2). J. Neuroimmunol. 73, 162–168. Safieh-Garabedian, B., Kanaan, S.A., Haddad, J.J., Jaoude, P.A., Jabbur, S.J., Saade, N.E., 1997b. Involvement of interleukin-1 beta, nerve growth factor and prostaglandin E2 in endotoxin-induced localized inflammatory hyperalgesia. Br. J. Pharmacol. 121, 1619–1626. Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J., Klenk, D.C., 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76–85. Waters, J.P., Pober, J.S., Bradley, J.R., 2013. Tumour necrosis factor in infectious disease. J. Pathol. 230, 132–147. Wiens, G.D., Glenney, G.W., 2011. Origin and evolution of TNF and TNF receptor superfamilies. Dev. Comp. Immunol. 35, 1324–1335. Xiao, J., Zhou, Z.C., Chen, C., Huo, W.L., Yin, Z.X., Weng, S.P., Chan, S.M., Yu, X.Q., He, J.G., 2007. Tumor necrosis factor-alpha gene from mandarin fish, Siniperca chuatsi: molecular cloning, cytotoxicity analysis and expression profile. Mol. Immunol. 44, 3615–3622. Yu, Y., Qiu, L., Song, L., Zhao, J., Ni, D., Zhang, Y., Xu, W., 2007. Molecular cloning and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) gene homologue from Zhikong scallop (Chlamys farreri). Fish Shellfish Immunol. 23, 419–429. Zhang, H., Kong, P., Wang, L., Zhou, Z., Yang, J., Zhang, Y., Qiu, L., Song, L., 2010. Cflec5, a pattern recognition receptor in scallop Chlamys farreri agglutinating yeast Pichia pastoris. Fish Shellfish Immunol. 29, 149–156. Zhang, X., Luan, W., Jin, S., Xiang, J., 2008. A novel tumor necrosis factor ligand superfamily member (CsTL) from Ciona savignyi: molecular identification and expression analysis. Dev. Comp. Immunol. 32, 1362–1373.