Developmental and Comparative Immunology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

The immunomodulation of inducible hydrogen sulfide in Pacific oyster Crassostrea gigas Zhibin Sun a, Lingling Wang a,⇑, Tao Zhang a,b, Zhi Zhou a, Qiufen Jiang a,b, Qilin Yi a,b, Chuanyan Yang a, Limei Qiu a, Linsheng Song a,⇑ a b

Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China University of Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e

i n f o

Article history: Received 7 January 2014 Revised 19 March 2014 Accepted 19 March 2014 Available online xxxx Keywords: Crassostrea gigas Hydrogen sulfide (H2S) Cystathionine c lyase (CSE) Immunity LPS Propargylglycine (PAG)

a b s t r a c t Hydrogen sulfide (H2S) is an important gasotransmitter, which plays indispensable roles in cardiovascular, nervous and immune systems of vertebrates. However, the information about the immunomodulation of H2S in invertebrates is still very limited. In the present study, the temporal expression profile of cystathionine c lyase in oyster Crassostrea gigas (CgCSE) was investigated after the oysters were stimulated by lipopolysaccharide. The expression levels of CgCSE mRNA transcripts in hemocytes increased significantly at 12 h (1.31-fold of the PBS group, P < 0.05) after LPS stimulation. The immunomodulation of inducible H2S in oyster was examined by monitoring the alterations of both cellular and humoral immune parameters in response to the stimulations of LPS, LPS + Na2S and LPS + propargylglycine (PAG). The total hemocyte counts (THC) and hemolymph PO activity increased significantly after LPS stimulation, and the increase could be further enhanced by adding PAG, while inhibited by appending Na2S. The phagocytosis activity of hemocytes was also increased firstly after LPS treatment, and the increase was enhanced by adding Na2S but inhibited after appending PAG. The anti-bacterial activity in hemolymph increased at 3 h post LPS treatment, and then decreased after adding PAG. The total SOD activity of hemolymph was also elevated at 6 h post LPS treatment, and the elevated activity was depressed by adding Na2S. These results collectively indicated that H2S might play crucial roles in the immune response of oyster via modulating the turnover and phagocytosis of hemocytes, and regulating the anti-bacterial activity and proPO activation in the hemolymph. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Hydrogen sulfide (H2S) has been known as an important gasotransmitter, which could modulate cardiovascular, nervous and immunity systems in vertebrates (Li et al., 2011). H2S is produced from L-cysteine through the catalysis of cystathionine b synthetase (CBS, EC 4.2.1.22) and cystathionine c lyase (CSE, EC 4.4.1.1) with pyridoxal 50 -phosphate (PPP) as a cofactor (Li et al., 2011). CBS is continuously produced at an especially high level in the neural and cardiac systems in humans (Quere et al., 1999), while CSE is an inducible H2S synthase that is mainly expressed in vascular system (Zhu et al., 2013). The mRNA expression of CSE can be regulated when the host suffered from some diseases, such as chronic kidney disease (Aminzadeh and Vaziri, 2012), or stimulated by some hormone (Zhu et al., 2013), or cytokines (Sen et al., 2012). ⇑ Corresponding authors. Tel.: +86 532 82898552; fax: +86 532 82880645 (L. Song). E-mail address: [email protected] (L. Song).

And the activity of CSE could be irreversibly inhibited by propargylglycine (PAG) via competitively interacting with the PPP active sites of CSE (Washtien and Abeles, 1977). In vertebrates, H2S is involved in the modulation of immune system, and plays a key role in inflammation. During the immune response, cytokines, such as tumor necrosis factor alpha (TNF-a), could induce the expression of CSE, and subsequently result in producing massive H2S (Sen et al., 2012). H2S can regulate the immune response in mice through the S-sulfhydration modification of many enzymes, ion channel proteins and signal pathway key elements (Li et al., 2011), and it also plays pro- or anti-inflammatory roles depending on the alternation of its concentration and generation rate. The high concentration of H2S in humans can provoke the activation of monocytes (Zhi et al., 2007), and enhance the survival of granulocytes and the bactericidal activity of neutrophils (Rinaldi et al., 2006), as well as the adhesion and migration capability of leukocytes (Zhang et al., 2007) to promote inflammatory reaction. Conversely, with the low concentration and slow generation rate, H2S inhibits LPS-induced release of pro-inflammatory

http://dx.doi.org/10.1016/j.dci.2014.03.011 0145-305X/Ó 2014 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Sun, Z., et al. The immunomodulation of inducible hydrogen sulfide in Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. (2014), http://dx.doi.org/10.1016/j.dci.2014.03.011

2

Z. Sun et al. / Developmental and Comparative Immunology xxx (2014) xxx–xxx

mediators and increases the synthesis of the anti-inflammatory chemokine (Whiteman et al., 2010). As a novel type of gasotransmitter, the current studies of H2S in invertebrates are mainly focused on the activities of related synthetases and its basic biology functions. For example, H2S was detected in the tissue homogenates from Manila clam (Julian et al., 2002) and gill from hard clam (Gainey and Greenberg, 2005), and the production of H2S could be inhibited by an inhibitor of CBS, aminooxyacetic acid (AOAA). Furthermore, H2S also plays important roles in muscle contraction of invertebrates, and it has been reported to act as a seasonal modulator of branchial muscle contraction in hard clam (Gainey and Greenberg, 2005), and stimulate the contraction of body wall muscle of echiuran worm (Julian et al., 2005). In addition, exogenous H2S could increase the thermotolerance and lifespan of Caenorhabditis elegans (Miller and Roth, 2007). However, the immunomodulation function of H2S has never been reported in invertebrates. Pacific oyster Crassostrea gigas is an important economic mariculture Mollusca in the world (Zhang et al., 2012). As sessile marine animal, oysters live in estuarine and intertidal regions and have strong adaptations to stressful environment. Sulfate reduction is the prevailing microbial process in anoxic sediments and leads to the formation of H2S (Jorgensen, 1982), which could inevitably affect the survival of oysters. In the present study, the modulation functions of H2S on immune response in C. gigas were investigated with the aims (1) to record the temporal response of CSE to LPS stimulation, (2) to examine the effects of inducible H2S on hemocytes concentration and phagocytosis, and (3) to recognize the influences of inducible H2S on anti-bacterial, phenoloxidase (PO) and superoxide dismutase (SOD) activity in the hemolymph. 2. Materials and methods 2.1. Oysters Pacific oysters, Crassostrea gigas, about two years old, were obtained from National Oceanographic Center, Qingdao, China, and acclimated in a fiberglass tank at salinity 30 ± 0.1‰, temperature 15–18 °C, dissolved oxygen above 6.0 mg L1 and pH from 7.7 to 8.2. The seawater was changed daily to ensure high water quality. The oysters were fed twice daily with Isochrysis galbana (Parke) (20.0–30.0  104 cells mL1) in the whole experiment process. 2.2. Stimulation experiments After two weeks of acclimation, 560 oysters were selected for the stimulation experiments. For the LPS stimulation experiment, 80 oysters were divided into 2 groups averagely and randomly. One group received an injection of 50 lL sterilized phosphate buffered saline (PBS, 136.89 mmol L1 NaCl, 2.68 mmol L1 KCl, 8.10 mmol L1 Na2HPO4, 1.47 mmol L1 KH2PO4, pH 7.4), and the second group received 0.5 mg mL1 LPS (Escherichia coli 0111: B4, Sigma Aldrich, in sterilized PBS). Six oysters were randomly sampled at 0, 3, 6, 12, 24 and 48 h post injection from the treated groups, respectively. Five hundred microliters hemolymph of each oyster was with-

drawn from the posterior adductor muscle sinus using a syringe, and centrifuged at 800g, 4 °C for 10 min to collect the hemocytes for RNA extraction. For the Na2S and PAG stimulation experiments, 480 oysters were divided into 4 groups averagely and randomly, with three replicate tanks for each group. Oysters in these four groups received an injection of 50 lL sterilized PBS, 0.5 mg mL1 LPS (Sigma Aldrich, in sterilized PBS), 0.5 mg mL1 LPS (Sigma Aldrich, in sterilized PBS) and 0.5 mg mL1 Na2S (Sigma Aldrich, in sterilized PBS), 0.5 mg mL1 LPS (Sigma Aldrich, in sterilized PBS) and 10 mg mL1 PAG (Sigma Aldrich, in sterilized PBS), respectively. These four groups were designated as PBS, LPS, LPS + Na2S and LPS + PAG groups. Six oysters were randomly sampled from each tank at 0, 3, 6, 12, 24 and 48 h post injection, respectively. Five hundred microliters hemolymph of each oyster was aseptically withdrawn and mixed with 1 mL anti-aggregant solution (0.5 % g mL1 EDTA in PBS), immediately. Then 9 mL hemolymph mixture from six oysters were pooled as one sample (3 samples were employed for every time point) and stored individually in 10 mL tubes held on ice to minimize cell clumping for total hemocyte counting and phagocytosis assay. The rest of hemolymph from each oyster were extracted and immediately centrifuged at 800g, 4 °C for 10 min to separate hemocytes and supernatant. The supernatant was filter sterilized (0.22 lm) to create a sterile supernatant for the following detection of anti-bacterial activity and immune enzymes activity. 2.3. Gene expression analysis Total RNA was immediately extracted using Trizol reagent according to the manufacture’s protocol (Invitrogen, USA). The cDNA first-strand synthesis was carried out based on Promega M-MLV RT Usage information (Promega, America) using the DNase I (Promega)-treated total RNA as template and oligo (dT)-adaptor primer (Table 1). The reaction was performed at 42 °C for 1 h, terminated by heating at 95 °C for 5 min. cDNA mix was diluted 1:50 and stored at 80 °C for the subsequent fluorescent real-time PCR. Two CgCSE gene-specific primers, P1 and P2 (Table 1), were used to amplify a product of 151 bp from cDNA template, and the PCR products were sequenced to verify the specificity of RTPCR. A 200 bp fragment was amplified using two primers (P3 and P4, Table 1) of oyster EF-1a, to calibrate the cDNA template as an internal control. The SYBR Green real-time PCR assay was carried out in an ABI PRISM 7300 Sequence Detection System (Applied Biosystems) according to the manual. The relative expression of genes was analyzed with the 2DDCT method (Livak and Schmittgen, 2001). All the data were given in terms of relative mRNA expressed as mean ± SE (N = 6). 2.4. Total hemocyte counts (THC) Three hundred microlitres of the hemolymph was fixed with 100 lL absolute formaldehyde, and 10 lL mixture was placed in a hemocytometer to measure the THC using a microscope (Olympus BX51, Tokyo, Japan) (N = 3).

Table 1 Primers used in this study. Primer

Sequence (50 –30 )

Sequence information

P1 (forward) P2 (reverse) P3 (forward) P4 (reverse) Oligo(dT)-adaptor

GTTAGAGACACCCACCAACCCGAC GTCAGCTCCAAAGTCCAGAGGACG AGTCACCAAGGCTGCACAGAAAG TCCGACGTATTTCTTTGCGATGT GGCCACGCGTCGACTAGTACT17

Real-time CgCSE primer Real-time CgCSE primer Real-time CgEF 1 primer Real-time CgEF 1 primer Clone primer

Gene abbreviations: CSE, cystathionine c lyase; EF, Elongation Factor.

Please cite this article in press as: Sun, Z., et al. The immunomodulation of inducible hydrogen sulfide in Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. (2014), http://dx.doi.org/10.1016/j.dci.2014.03.011

Z. Sun et al. / Developmental and Comparative Immunology xxx (2014) xxx–xxx

2.5. The phagocytosis assay TOP10 E. coli were cultured overnight with constant agitation, and then harvested by centrifugation. After the treatment with absolute formaldehyde for 10 min, the E. coli cells were washed with NaHCO3 (0.1 mol L1, pH 9.0), and then incubated with NaHCO3 containing FITC (1 mg mL1, Sigma Aldrich) at room temperature with gentle stirring overnight. The FITC-labeled E. coli cells were rinsed with PBS until the supernatant was free of visible FITC (1 mL contained 2  108), and stored at 4 °C for later use. The phagocytosis assay was performed according to the method described by Wu et al. (2007). In brief, oyster hemocytes were diluted in filter-sterilized (0.22 lm pore size) sea water (FSSW) to the concentration of 2  106 cells mL1 and incubated with same volume of the labeled E. coli cells at room temperature for 30 min. A 50 lL cell suspension was smeared onto a glass slide treated with poly-L-lysine (Polysine Adhesion slides, Thermo Scientific) and the slides were incubated in a wet chamber to allow the hemocytes to adhere for 30 min at 25 °C. The hemocytes on slides were washed subsequently three times in FSSW and fixed in formalin (10%) for 10 min. Evan’s blue (0.01%) counterstained hemocytes for 10 min and the fluorescence of non-phagocytized E. coli cells was quenched with the trypan blue solution (2 mg mL1, Sigma Aldrich) for 30 min. The slides were counterstained with DAPI (1 mg mL1 in 0.1 mol L1 PBS, Beyotime, China), and washed three times with FSSW. The slides were then covered by microscope cover glasses with glycerin (50%) and examined under a fluorescence microscope (Zeiss, Germany). The phagocytic rate (PR) was calculated by the number of phagocytic hemocytes with engulfed E. coli cells per 100 hemocytes. The phagocytic index (PI), which determined the average number of E. coli cells per phagocyte, was counted according to the formula (Pope et al., 2011): Phagocytic Index for E. coli = (total E. coli cells phagocytosed)/(cells phagocytic for E. coli). All assays were repeated three times. 2.6. Detection of anti-bacterial activity The anti-bacterial activity of hemolymph was examined according to the method described by Jiang et al. with slight modification (Jiang et al., 2013). One hundred microliters of sterile hemolymph supernatant (protein concentration was adjusted to 1.5 mg mL1) was mixed with 100 ll of E. coli (with pMD18-T simple vector, TaKaRa) resuspension (1.0  107 CFU mL1). The mixture of 100 ll FSSW and 100 ll of E. coli resuspension was used as bacteria-only control. After incubation for 30 min at room temperature, 100 ll of the mixture was aspirated to 100 ll LB medium containing 50 lg mL1 ampicillin in a 96-well flat-bottomed microtiter plate. The absorbance at 600 nm was recorded continually for 12 h using a microtiter plate reader (BioTek, USA) every 30 min. The time point, which is half the time of the control to reach maximum OD600 absorbance, was taken as T50. The T50 values of the samples and control were used to determine the anti-bacterial activity of hemolymph supernatant (N = 6). The relative anti-bacterial activity was calculated as below:

3

was defined as the enzyme amount causing 50% inhibition in 1 mL reaction solution. The concentration of total protein in the supernatant was quantified by BCA method (Smith et al., 1985). The relative activity of SOD in supernatant sample was the ratio of total enzyme activity unit to the total protein (U mg1 protein, N = 6). PO activity in hemolymph supernatant was assessed following the procedure of Asokan et al. (1997). One unit of PO activity was defined as the absorbance change of 0.001 at 490 nm in 1 min in the oxidation reactions of L-DOPA by hemolymph supernatant. Results were expressed as unit activity per mg of protein in the sample (U mg1 protein, N = 6). 2.8. Statistical analysis The data was subjected to one-way analysis of variance (oneway ANOVA) with Student–Newman–Keuls (SNK) test and the P values less than 0.05 were considered statistically significant. 3. Results 3.1. The temporal expression of CgCSE transcripts in hemocytes after LPS stimulation Quantitative real-time PCR was employed to investigate the variation of CgCSE (CGI_10008531) expression level in hemocytes after LPS stimulation with CgEF-1a as internal control (Fig. 1). The mRNA expression of CgCSE was significantly up regulated at 12 h post injection of LPS (1.31-fold compared with PBS group, P < 0.05), and then declined at 24 h. There was no significant difference at 3, 6, 24 and 48 h in comparison with PBS group (Fig. 1). 3.2. The alteration of total hemocyte counts after the production of H2S was controlled The concentration of hemocytes was measured to determine the effect of H2S on hemocytes turnover (Fig. 2). In LPS group, the hemocyte concentration increased significantly at 6 h (1.88fold, P < 0.05) compared to that in PBS group. In LPS + Na2S group, the hemocyte concentration decreased significantly at

Antibacterial activity ð%Þ ¼ ð1  sample OD600T50  OD600T0 =control OD600T50  OD600T0 Þ  100%

2.7. Measurement of immune enzymes activity SOD activity in the hemolymph supernatant was measured with SOD Detection Kit (A001-1, Nanjing Jiancheng, China) according to the operation instruction. The activity of SOD was determined by the hydroxylamine method (Kono, 1978). One SOD activity unit

Fig. 1. CgCSE mRNA expression analysis measured by real-time PCR. CgCSE mRNA temporal expression profile in hemocytes after LPS stimulation. CgEF 1a gene was used as an internal control to calibrate the cDNA template for all the samples. Each value were shown as mean ± SE (N = 6). The data was subjected to one-way analysis of variance (one-way ANOVA) followed by a multiple comparison (SeNeK). Significant differences were indicated with different letters at P < 0.05.

Please cite this article in press as: Sun, Z., et al. The immunomodulation of inducible hydrogen sulfide in Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. (2014), http://dx.doi.org/10.1016/j.dci.2014.03.011

4

Z. Sun et al. / Developmental and Comparative Immunology xxx (2014) xxx–xxx

Fig. 2. Total hemocyte counts (THC) of C. gigas. Hemocytes were collected at 0, 3, 6, 12, 24 and 48 h post injection. Vertical bars represented the mean ± SE (N = 3). The data was subjected to one-way analysis of variance (one-way ANOVA) followed by a multiple comparison (SeNeK). Significant differences were indicated with different letters at P < 0.05.

12 h (0.56-fold, P < 0.05), which was significantly lower than that in PBS group. The hemocyte concentration in LPS + PAG group was higher than that of all the other groups during 3–24 h (P < 0.05), with the highest level at 24 h (4.16-fold of the PBS group, P < 0.01). 3.3. The alternation of hemocyte phagocytic activity The number of hemocytes with engulfed E. coli cells was counted to evaluate the phagocytic capability of hemocytes regulated by H2S. The phagocytic activity of hemocyte increased after LPS stimulation, and the increase was further enhanced by appending Na2S, while it was suppressed by adding PAG (Fig. 3). After LPS treatment, the hemocyte phagocytic activity was significantly up regulated, especially at 12 h (1.79-fold, P < 0.05) and 24 h (1.52fold, P < 0.05) post treatment, compared to that in PBS group. The hemocyte phagocytic activity in LPS + Na2S group was significantly higher than that in PBS group during 3–24 h (P < 0.05) post stimulation. There was no significant difference (P > 0.05) in the hemocyte phagocytosis rate between the LPS + PAG and PBS groups in the whole experiment process. The phagocytic indexes in PBS, LPS, LPS + Na2S and LPS + PAG groups were almost same during 6–24 h post stimulation. However, at 3 h post stimulation, the phagocytic index in PBS group was higher than that of LPS (1.79-fold, P < 0.05), LPS + Na2S (1.75fold, P < 0.05) and LPS + PAG (1.83-fold, P < 0.05) groups. At 48 h post treatment, the phagocytic index in PBS group was higher (1.43-fold, P < 0.05) than that in LPS + PAG group, while similar (P > 0.05) to that in LPS + Na2S group, and significantly lower (0.68-fold, P < 0.05) than that in LPS group.

Fig. 3. Hemocyte phagocytic activity of C. gigas. (A) Hemocyte phagocytic activity (B) Hemocyte phagocytic index. Hemocytes were collected at 0, 3, 6, 12, 24 and 48 h post injection. Vertical bars represented the mean ± SE (N = 3). The data was subjected to one-way analysis of variance (one-way ANOVA) followed by a multiple comparison (SeNeK). Significant differences were indicated with different letters at P < 0.05.

3.4. Anti-bacterial activity of hemolymph supernatant The inhibition effect of hemolymph supernatant on the growth of E. coli was examined to determine its antimicrobial activity (Fig. 4). An up-down-steady change trend of the antimicrobial activity was found in all PBS, LPS, LPS + Na2S and LPS + PAG groups. After 10 h incubation, the OD600 absorbance of the control reached the maximum, and 5 h was defined as T50. In LPS group, the antimicrobial activity of hemolymph was significantly up-regulated (1.06-fold, P < 0.05) at 3 h post treatment, but it did not change significantly in LPS + Na2S group (0.99-fold, P > 0.05), and

Fig. 4. Anti-bacterial activity of hemolymph supernatant. Hemolymph supernatants were collected at 0, 3, 6, 12, 24 and 48 h post injection. Vertical bars represented the mean ± SE (N = 3). The data was subjected to one-way analysis of variance (one-way ANOVA) followed by a multiple comparison (SeNeK). Significant differences were indicated with different letters at P < 0.05.

Please cite this article in press as: Sun, Z., et al. The immunomodulation of inducible hydrogen sulfide in Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. (2014), http://dx.doi.org/10.1016/j.dci.2014.03.011

Z. Sun et al. / Developmental and Comparative Immunology xxx (2014) xxx–xxx

significantly inhibited in LPS + PAG group (0.75-fold, P < 0.05), compared to PBS stimulation, respectively. 3.5. PO and SOD activity of hemolymph supernatant To examine the possible role of H2S in prophenoloxidase (PO) activation and SOD activity regulation, the activities of PO and SOD were examined. There were two peaks of PO activity in the LPS + PAG group during the experiment, while no significant changes in other groups (Fig. 5A). An approximate down-up-down change trend of the SOD activity was observed in PBS, LPS, LPS + Na2S and LPS + PAG groups (Fig. 5B). There were no significant differences in the PO activity between the groups of LPS + Na2S and LPS, LPS and PBS during the whole process. But in LPS + PAG group, the PO activity increased quickly and reached the peak level at 3 h (11.28-fold, P < 0.01), then declined at 6 h (2.85-fold, P < 0.05) and 12 h (1.05-fold, P < 0.05), and finally increased to the second peak at 24 h (5.04-fold, P < 0.01), compared with that in PBS group. The level of SOD activity increased significantly at 6 h (1.14fold, P < 0.05) post LPS treatment, and then decreased at 12 h

Fig. 5. Immune enzymes activity of hemolymph supernatant. (A) PO activity of hemolymph supernatant (B) SOD activity of hemolymph supernatant. Hemolymph supernatants were collected at 0, 3, 6, 12, 24 and 48 h post injection. Vertical bars represented the mean ± SE (N = 3). The data was subjected to one-way analysis of variance (one-way ANOVA) followed by a multiple comparison (SeNeK). Significant differences were indicated with different letters at P < 0.05.

5

(0.86-fold, P < 0.05) and 48 h (0.92-fold, P < 0.05), in comparison with that in PBS group (Fig. 5B). The SOD activity at 3 h (0.77-fold, P < 0.05), 6 h (0.87-fold, P < 0.05) and 48 h (0.74-fold, P < 0.05) post LPS + Na2S stimulation was all significantly lower than that in PBS group. In LPS + PAG group, the SOD activity underwent two peaks at 6 h (1.1218-fold, P < 0.05) and 24 h (1.22-fold, P < 0.05), respectively, and then declined significantly at 48 h (0.66-fold, P < 0.05), compared to that in PBS group.

4. Discussion H2S has been recently verified as an important signal molecule playing indispensable regulation roles in inflammation of vertebrates (Hegde and Bhatia, 2011; Li et al., 2011; Whiteman and Winyard, 2011). CSE is an inducible H2S synthase, and CSE plays a crucial role in vertebrate immune system (Sen et al., 2012). LPS is a major component of the outer membrane of Gram-negative bacteria, and E. coli LPS has been approved to activate the immune response in many Mollusca, including scallop (Jiang et al., 2013; Wang et al., 2012, 2011), oyster (Lelong et al., 2007; Zhang et al., 2013), clam (Lee et al., 2013; Tafalla et al., 2003), and so on. In the present study, LPS stimulation significantly induced the expression of CgCSE in oyster hemocytes. The phagocytosis of hemocytes and the antibacterial activity of hemolymph changed significantly after the production of H2S was controlled. It clearly indicated that H2S played an important regulation role in the immune competency of oyster. The transcription regulation and immune related roles of CSE had been well illustrated in vertebrates, and its mRNA expression and production of H2S could be induced by LPS stimulation (Collin et al., 2005; Li et al., 2005). TNF a-treatment could induce the transcription of CSE and triple the H2S generation via stimulating the binding of SP1 to the CSE promoter (Sen et al., 2012). In the present study, the increase of the expression of CgCSE after LPS stimulation is not very high, but there is significant difference compared to PBS treatment (Fig. 1, P < 0.05). It is reported that the upregulation of CSE expression is positively correlated with the increase of H2S production (Sen et al., 2012; Zhu et al., 2013), and H2S exerts a negative feedback effect on CSE activity (Kredich et al., 1973) and the mRNA expression of CSE (Yan et al., 2004). And we suspect that there might also be a feedback mechanism to control the expression level of CgCSE to restrict the production of a large amount of H2S, which might lead to the lower up-regulation of CgCSE expression in the present study. It has been reported that H2S could modify cysteines in a large number of proteins by S-sulfhydration, such as NF-jB (Sen et al., 2012) and STAT3 (Li et al., 2009), to modulate the immune response in vertebrates (Li et al., 2011). Recently H2S-dependent S-sulfhydration has been suggested to be an abundant modification with potential for global physiological importance in vertebrates (Lu et al., 2013). As invertebrates, oysters rely exclusively on innate immune reactions to defend against pathogen invasion (Gueguen et al., 2003; Zhang et al., 2013). Invertebrate immune system is composed of both cellular and humoral immunity, and cellular immune responses are generally immediate behaviors to an invasion of pathogen, including nodulation, encapsulation, melanization and phagocytosis (Rosales, 2011). To understand the role of H2S in the immune response of oyster, several parameters of both cellular and humoral immunity were determined after LPS combined Na2S or PAG stimulations. After LPS stimulation, THC increased significantly and peaked at 12 h. The THC increase triggered by LPS was inhibited significantly by adding Na2S at 6 and 12 h, while PAG could enhance the THC significantly all the time during the experiment (Fig. 2). In mammals, H2S could sulfhydrate p65 subunit of NF-jB at cysteine-38 (Sen et al., 2012), or inhibit caspase-3

Please cite this article in press as: Sun, Z., et al. The immunomodulation of inducible hydrogen sulfide in Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. (2014), http://dx.doi.org/10.1016/j.dci.2014.03.011

6

Z. Sun et al. / Developmental and Comparative Immunology xxx (2014) xxx–xxx

cleavage and p38 MAP kinase phosphorylation (Rinaldi et al., 2006), to promote the survival of different cells. Due to the comparative limited information about the turnover process of hemocytes in oysters, the particular role of H2S in hemocytes turnover of oysters needs further investigation. Moreover, phagocytic activity of hemocyte also increased after LPS treatment, and this increase was significantly enhanced after the addition of Na2S, whereas suspended by adding PAG (Fig. 3A), indicating that H2S could enhance the phagocytosis capability of hemocytes. Thus, the present results suggested that the inducible H2S could affect the turnover of hemocytes and enhanced the phagocytosis of hemocytes. The antibacterial capability is one of the key immunity functions of hemolymph in invertebrates, which is mediated by phenoloxidase system, antioxidant enzymes, antimicrobial peptides, lysozymes etc. (Anju et al., 2013; Luna-Acosta et al., 2011b; Song et al., 2010). In the present study, an increased antibacterial activity was observed in hemolymph supernatant of LPS group, while the elevated activity was reduced by adding PAG at 3 h after treatment. The activity of PO was up-regulated by LPS stimulation, that was significantly enhanced after the incubation of PAG, while was weakened by adding Na2S. POs play a key role in melanin production. PO activity has been detected in different tissues and developmental stages of oyster, and POs are involved in oyster immune defense response (Hellio et al., 2007; Luna-Acosta et al., 2010, 2011a,b; Renault et al., 2011; Thomas-Guyon et al., 2009). The activation of proPO is catalyzed by proPO-activating enzyme, which may exist as a protein complex composed of two disulfide-linked polypeptide chains (Jiang et al., 1998). H2S has been reported to effect the formation of intra-/inter-molecular disulfide bond in some signal transduction processes (Hourihan et al., 2013; Tao et al., 2013). Thus, H2S was suspected to act as a negative regulator of the activation of PO system during the immune response in oyster. SODs are a class of antioxidant enzymes that catalyze the dismutation of superoxide into oxygen and hydrogen peroxide to cleanup of ROS (Aguirre et al., 2005). The previous reports have indicated the importance of SODs to the immune response as well as the role in protecting cells against various stressors (Bao et al., 2008). The activity of SOD could be rapidly elevated by some biotic or abiotic challenges, such as microbe infection (Estrada et al., 2007; Xing et al., 2008) and heavy metals expose (Cong et al., 2012). In the present study, the total activity of SOD was elevated at 6 h post LPS treatment, and this increase was decreased by adding Na2S. However, there was no significant difference between LPS and LPS + PAG groups. Because of the reductive capability of S2/ HS, exogenous Na2S might eliminate the ROS caused by LPS stimulation, and the up-regulation of SOD activity caused by LPS stimulation was restored by appending Na2S. Therefore, the exogenous H2S could serve as a reductive agent to substitute SOD during immune response in oyster. In conclusion, H2S participated in the immune competency of oyster C. gigas by modulating the turnover of hemocytes, enhancing the phagocytic activity of hemocytes and the anti-bacterial activity of hemolymph, and inhibiting the activation of PO system. However, the exact mechanism of inducible H2S on the modulation of oyster immunity is still not well understood, and further assessment of related molecules involved in the signal transduction network of H2S system are needed to have a more comprehensive understanding of the modulating mechanism of H2S in immune defense. Acknowledgments The authors are grateful to all the laboratory members for continuous technical advice and helpful discussions. This research was supported by National Basic Research Program of China (973

Program, No. 2010CB126404) from the Chinese Ministry of Science and Technology, Grants from Shandong Provincial Natural Science Foundation (No. JQ201110), and Shandong Province Postdoctoral Innovation Fundation, China (No. 201201010).

References Aguirre, J., Ríos-Momberg, M., Hewitt, D., Hansberg, W., 2005. Reactive oxygen species and development in microbial eukaryotes. Trends Microbiol. 13, 111– 118. Aminzadeh, M.A., Vaziri, N.D., 2012. Downregulation of the renal and hepatic hydrogen sulfide (H2S)-producing enzymes and capacity in chronic kidney disease. Nephrol. Dial. Transplant. 27, 498–504. Anju, A., Jeswin, J., Thomas, P.C., Paulton, M.P., Vijayan, K.K., 2013. Molecular cloning, characterization and expression analysis of cytoplasmic Cu/Znsuperoxide dismutase (SOD) from pearl oyster Pinctada fucata. Fish Shellfish Immunol. 34, 946–950. Asokan, R., Arumugam, M., Mullainadhan, P., 1997. Activation of prophenoloxidase in the plasma and haemocytes of the marine mussel Perna viridis Linnaeus. Dev. Comp. Immunol. 21, 1–12. Bao, Y., Li, L., Zhang, G., 2008. The manganese superoxide dismutase gene in bay scallop Argopecten irradians: cloning, 3D modelling and mRNA expression. Fish Shellfish Immunol. 25, 425–432. Collin, M., Anuar, F.B., Murch, O., Bhatia, M., Moore, P.K., Thiemermann, C., 2005. Inhibition of endogenous hydrogen sulfide formation reduces the organ injury caused by endotoxemia. Br. J. Pharmacol. 146, 498–505. Cong, M., Wu, H., Liu, X., Zhao, J., Wang, X., Lv, J., Hou, L., 2012. Effects of heavy metals on the expression of a zinc-inducible metallothionein-III gene and antioxidant enzyme activities in Crassostrea gigas. Ecotoxicology 21, 1928– 1936. Estrada, N., de Jesús Romero, M., Campa-Córdova, A., Luna, A., Ascencio, F., 2007. Effects of the toxic dinoflagellate, Gymnodinium catenatum on hydrolytic and antioxidant enzymes, in tissues of the giant lions-paw scallop Nodipecten subnodosus. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 146, 502–510. Gainey Jr., L.F., Greenberg, M.J., 2005. Hydrogen sulfide is synthesized in the gills of the clam Mercenaria mercenaria and acts seasonally to modulate branchial muscle contraction. Biol. Bull. 209, 11–20. Gueguen, Y., Cadoret, J.-P., Flament, D., Barreau-Roumiguière, C., Girardot, A.-L., Garnier, J., Hoareau, A., Bachère, E., Escoubas, J.-M., 2003. Immune gene discovery by expressed sequence tags generated from hemocytes of the bacteria-challenged oyster, Crassostrea gigas. Gene 303, 139–145. Hegde, A., Bhatia, M., 2011. Hydrogen sulfide in inflammation: friend or foe? Inflamm. Allergy Drug Targets 10, 118–122. Hellio, C., Bado-Nilles, A., Gagnaire, B., Renault, T., Thomas-Guyon, H., 2007. Demonstration of a true phenoloxidase activity and activation of a ProPO cascade in Pacific oyster, Crassostrea gigas (Thunberg) in vitro. Fish Shellfish Immunol. 22, 433–440. Hourihan, J.M., Kenna, J.G., Hayes, J.D., 2013. The gasotransmitter hydrogen sulfide induces Nrf2-target genes by inactivating the Keap1 ubiquitin ligase substrate adaptor through formation of a disulfide bond between Cys-226 and Cys-613. Antioxid. Redox Signal. 19, 465–481. Jiang, H., Wang, Y., Kanost, M.R., 1998. Pro-phenol oxidase activating proteinase from an insect, Manduca sexta: a bacteria-inducible protein similar to Drosophila easter. Proc. Nat. Acad. Sci. USA 95, 12220–12225. Jiang, Q., Zhou, Z., Wang, L., Shi, X., Wang, J., Yue, F., Yi, Q., Yang, C., Song, L., 2013. The immunomodulation of inducible nitric oxide in scallop Chlamys farreri. Fish Shellfish Immunol. 34, 100–108. Jorgensen, B.B., 1982. Mineralization of organic matter in the sea bed[mdash]the role of sulphate reduction. Nature 296, 643–645. Julian, D., Statile, J.L., Wohlgemuth, S.E., Arp, A.J., 2002. Enzymatic hydrogen sulfide production in marine invertebrate tissues. Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 133, 105–115. Julian, D., Statile, J., Roepke, T.A., Arp, A.J., 2005. Sodium nitroprusside potentiates hydrogen-sulfide-induced contractions in body wall muscle from a marine worm. Biol. Bull. 209, 6–10. Kono, Y., 1978. Generation of superoxide radical during autoxidation of hydroxylamine and an assay for superoxide dismutase. Arch. Biochem. Biophys. 186, 189–195. Kredich, N.M., Foote, L.J., Keenan, B.S., 1973. The stoichiometry and kinetics of the inducible cysteine desulfhydrase from Salmonella typhimurium. J. Biol. Chem. 248, 6187–6196. Lee, Y., Wickamarachchi, W., Whang, I., Oh, M., Umasuthan, N., Zoysa, M., Oh, C., Kang, D.-H., Lee, J., 2013. Immune response-related gene expression profile of a novel molluscan IjB protein member from Manila clam (Ruditapes philippinarum). Mol. Biol. Rep. 40, 1519–1527. Lelong, C., Badariotti, F., Le Quéré, H., Rodet, F., Dubos, M.P., Favrel, P., 2007. Cg-TGFb, a TGF-b/activin homologue in the Pacific Oyster Crassostrea gigas, is involved in immunity against Gram-negative microbial infection. Dev. Comp. Immunol. 31, 30–38. Li, L., Bhatia, M., Zhu, Y.Z., Zhu, Y.C., Ramnath, R.D., Wang, Z.J., Anuar, F.B., Whiteman, M., Salto-Tellez, M., Moore, P.K., 2005. Hydrogen sulfide is a novel mediator of lipopolysaccharide-induced inflammation in the mouse. FASEB J. 19, 1196–1198.

Please cite this article in press as: Sun, Z., et al. The immunomodulation of inducible hydrogen sulfide in Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. (2014), http://dx.doi.org/10.1016/j.dci.2014.03.011

Z. Sun et al. / Developmental and Comparative Immunology xxx (2014) xxx–xxx Li, L., Salto-Tellez, M., Tan, C.-H., Whiteman, M., Moore, P.K., 2009. GYY4137, a novel hydrogen sulfide-releasing molecule, protects against endotoxic shock in the rat. Free Radical Biol. Med. 47, 103–113. Li, L., Rose, P., Moore, P.K., 2011. Hydrogen sulfide and cell signaling. Annu. Rev. Pharmacol. Toxicol. 51, 169–187. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 25, 402–408. Lu, C., Kavalier, A., Lukyanov, E., Gross, S.S., 2013. S-sulfhydration/desulfhydration and S-nitrosylation/denitrosylation: a common paradigm for gasotransmitter signaling by H2S and NO. Methods 62, 177–181. Luna-Acosta, A., Rosenfeld, E., Amari, M., Fruitier-Arnaudin, I., Bustamante, P., Thomas-Guyon, H., 2010. First evidence of laccase activity in the Pacific oyster Crassostrea gigas. Fish Shellfish Immunol. 28, 719–726. Luna-Acosta, A., Saulnier, D., Pommier, M., Haffner, P., De Decker, S., Renault, T., Thomas-Guyon, H., 2011a. First evidence of a potential antibacterial activity involving a laccase-type enzyme of the phenoloxidase system in Pacific oyster Crassostrea gigas haemocytes. Fish Shellfish Immunol. 31, 795–800. Luna-Acosta, A., Thomas-Guyon, H., Amari, M., Rosenfeld, E., Bustamante, P., Fruitier-Arnaudin, I., 2011b. Differential tissue distribution and specificity of phenoloxidases from the Pacific oyster Crassostrea gigas. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 159, 220–226. Miller, D.L., Roth, M.B., 2007. Hydrogen sulfide increases thermotolerance and lifespan in Caenorhabditis elegans. Proc. Nat. Acad. Sci. USA 104, 20618–20622. Pope, E.C., Powell, A., Roberts, E.C., Shields, R.J., Wardle, R., Rowley, A.F., 2011. Enhanced cellular immunity in shrimp (Litopenaeus vannamei) after ‘vaccination’. PLoS ONE 6, e20960. Quere, I., Paul, V., Rouillac, C., Janbon, C., London, J., Demaille, J., Kamoun, P., Dufier, J.L., Abitbol, M., Chasse, J.F., 1999. Spatial and temporal expression of the cystathionine beta-synthase gene during early human development. Biochem. Biophys. Res. Commun. 254, 127–137. Renault, T., Faury, N., Barbosa-Solomieu, V., Moreau, K., 2011. Suppression substractive hybridisation (SSH) and real time PCR reveal differential gene expression in the Pacific cupped oyster, Crassostrea gigas, challenged with Ostreid herpesvirus 1. Dev. Comp. Immunol. 35, 725–735. Rinaldi, L., Gobbi, G., Pambianco, M., Micheloni, C., Mirandola, P., Vitale, M., 2006. Hydrogen sulfide prevents apoptosis of human PMN via inhibition of p38 and caspase 3. Lab. Invest. 86, 391–397. Rosales, C., 2011. Phagocytosis, a cellular immune response in insects. Invertebrate Surviv. J. 8, 109–131. Sen, N., Paul, B.D., Gadalla, M.M., Mustafa, A.K., Sen, T., Xu, R., Kim, S., Snyder, S.H., 2012. Hydrogen sulfide-linked sulfhydration of NF-kappaB mediates its antiapoptotic actions. Mol. Cell 45, 13–24. Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J., Klenk, D.C., 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76–85. Song, L., Wang, L., Qiu, L., Zhang, H., 2010. Bivalve Immunity, Invertebrate immunity. Springer, pp. 44–65. Tafalla, C., Gómez-León, J., Novoa, B., Figueras, A., 2003. Nitric oxide production by carpet shell clam (Ruditapes decussatus) hemocytes. Dev. Comp. Immunol. 27, 197–205.

7

Tao, B.B., Liu, S.Y., Zhang, C.C., Fu, W., Cai, W.J., Wang, Y., Shen, Q., Wang, M.J., Chen, Y., Zhang, L.J., Zhu, Y.Z., Zhu, Y.C., 2013. VEGFR2 functions as an H2S-targeting receptor protein kinase with its novel Cys 1045-Cys1024 disulfide bond serving as a specific molecular switch for hydrogen sulfide actions in vascular endothelial cells. Antioxid. Redox Signal. 19, 448–464. Thomas-Guyon, H., Gagnaire, B., Bado-Nilles, A., Bouilly, K., Lapègue, S., Renault, T., 2009. Detection of phenoloxidase activity in early stages of the Pacific oyster Crassostrea gigas (Thunberg). Dev. Comp. Immunol. 33, 653–659. Wang, M., Yang, J., Zhou, Z., Qiu, L., Wang, L., Zhang, H., Gao, Y., Wang, X., Zhang, L., Zhao, J., Song, L., 2011. A primitive Toll-like receptor signaling pathway in mollusk Zhikong scallop Chlamys farreri. Dev. Comp. Immunol. 35, 511–520. Wang, L., Wang, L., Zhang, H., Zhou, Z., Siva, V.S., Song, L., 2012. A C1q domain containing protein from scallop Chlamys farreri serving as pattern recognition receptor with heat-aggregated IgG binding activity. PLoS ONE 7, e43289. Washtien, W., Abeles, R.H., 1977. Mechanism of inactivation of c-cystathionase by the acetylenic substrate analog propargylglycine. Biochemistry 16, 2485–2491. Whiteman, M., Winyard, P.G., 2011. Hydrogen sulfide and inflammation: the good, the bad, the ugly and the promising. Exp. Rev. Clin. Pharmacol. 4, 13–32. Whiteman, M., Li, L., Rose, P., Tan, C.H., Parkinson, D.B., Moore, P.K., 2010. The effect of hydrogen sulfide donors on lipopolysaccharide-induced formation of inflammatory mediators in macrophages. Antioxid. Redox Signal. 12, 1147– 1154. Wu, W., Zong, R., Xu, J., Zhang, X., 2007. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicus. J. Proteome Res. 7, 424–431. Xing, J., Lin, T., Zhan, W., 2008. Variations of enzyme activities in the haemocytes of scallop Chlamys farreri after infection with the acute virus necrobiotic virus (AVNV). Fish Shellfish Immunol. 25, 847–852. Yan, H., Du, J., Tang, C., 2004. The possible role of hydrogen sulfide on the pathogenesis of spontaneous hypertension in rats. Biochem. Biophys. Res. Commun. 313, 22–27. Zhang, H., Zhi, L., Moochhala, S.M., Moore, P.K., Bhatia, M., 2007. Endogenous hydrogen sulfide regulates leukocyte trafficking in cecal ligation and punctureinduced sepsis. J. Leukoc. Biol. 82, 894–905. Zhang, G., Fang, X., Guo, X., Li, L., Luo, R., Xu, F., Yang, P., Zhang, L., Wang, X., Qi, H., 2012. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 490, 49–54. Zhang, Y., He, X., Yu, F., Xiang, Z., Li, J., Thorpe, K.L., Yu, Z., 2013. Characteristic and functional analysis of Toll-like receptors (TLRs) in the lophotrocozoan, Crassostrea gigas, reveals ancient origin of TLR-mediated innate immunity. PLoS ONE 8, e76464. Zhi, L., Ang, A.D., Zhang, H., Moore, P.K., Bhatia, M., 2007. Hydrogen sulfide induces the synthesis of proinflammatory cytokines in human monocyte cell line U937 via the ERK-NF-kappaB pathway. J. Leukoc. Biol. 81, 1322–1332. Zhu, X., Tang, Z., Cong, B., Du, J., Wang, C., Wang, L., Ni, X., Lu, J., 2013. Estrogens increase cystathionine-gamma-lyase expression and decrease inflammation and oxidative stress in the myocardium of ovariectomized rats. Menopause (New York, NY) 20, 1084–1091.

Please cite this article in press as: Sun, Z., et al. The immunomodulation of inducible hydrogen sulfide in Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. (2014), http://dx.doi.org/10.1016/j.dci.2014.03.011