J Comp Physiol B DOI 10.1007/s00360-014-0810-7
Original Paper
Transcript levels of class I GLUTs within individual tissues and the direct relationship between GLUT1 expression and glucose metabolism in Atlantic cod (Gadus morhua) Jennifer R. Hall · Kathy A. Clow · Connie E. Short · William R. Driedzic
Received: 25 October 2013 / Revised: 15 January 2014 / Accepted: 24 January 2014 © Springer-Verlag Berlin Heidelberg 2014
Abstract GLUTs 1–4 are sodium-independent facilitated glucose transporters and are considered to play a major role in glucose trafficking. The relative transcript levels of GLUTs 1–4 were determined in tissues of Atlantic cod (Gadus morhua). The distribution profile of GLUTs normalized to RNA is similar to mammals and with a few exceptions other fish. GLUT1 is ubiquitous, GLUT2 is relatively abundant in tissues that release glucose, GLUT3 expression is relatively strong in brain, and GLUT4 is relatively high in heart and muscle. The functionally significant level of transcript is presumably the level in the cell. Normalization of relative GLUT levels to tissue mass reveals there are extremely high levels of GLUT1 transcript in gas gland consistent with the high lactate production rates, GLUT3 is dominant in gill and head kidney as well as brain, and GLUT4 expression in gill is elevated relative to other tissues. Consideration of GLUTs within tissues reveals that GLUT1 is the dominant transcript in a group of tissues including gas gland, heart, white muscle, and RBCs. Brain, gill, and spleen display a co-dominance of GLUTs 1 and 3. There are relatively low levels of GLUT4 in most tissues, the highest being found in white muscle where GLUT4 accounts for only 12 % of the total transcript level. The apparent low level of GLUT4 transcript may reflect
Communicated by I. D. Hume. J. R. Hall Aquatic Research Cluster, CREAIT Network, Memorial University of Newfoundland, St. John’s, NL A1C 5S7, Canada K. A. Clow · C. E. Short · W. R. Driedzic (*) Department of Ocean Sciences, Ocean Sciences Centre, Memorial University of Newfoundland, St. John’s, NL A1C 5S7, Canada e-mail: [email protected]
two tissues that were not included in the current study, red muscle and adipose tissue, due to their low abundance in Atlantic cod. The rate of glucose metabolism in isolated cells prepared from gas gland, heart, and RBCs was determined by tracking the rate of 3H2O production from [2-3H]glucose. The steady-state rate of basal glycolysis in these three tissues correlates with relative transcript levels of GLUT1. Keywords Atlantic cod · Glucose transporters · GLUT · Gas gland · Heart · RBC · Glucose metabolism · Lactate production
Introduction Glucose movement across cell membranes is considered to occur through facilitated transport mechanisms involving specific transmembrane proteins (GLUTs). The class I sodium-independent GLUTs 1, 2, 3, and 4 are well recognized in mammals and play a major role in glucose trafficking (Wood and Trayhurn 2003; Uldry and Thorens 2004). GLUT transcripts similar to those in mammals have been identified in fish. An understanding of glucose uptake and exit mechanisms is essential to the overall picture of glucose utilization. Although glucose metabolism in fish has received considerable attention (Polakof et al. 2011, 2012), the role of glucose transporters remains open to investigation. The tissue distribution of transcript levels for GLUTs 1–4 normalized to RNA or β-actin has been described for Atlantic cod, salmonids, and to a lesser extent in a few other fish species. An overview of a collection of diverse studies suggests that GLUT 1 is ubiquitous; GLUT 2 occurs in liver, intestine, kidney and brain; GLUT 3 is
13
most abundant in kidney; and GLUT 4 is expressed primarily in heart followed by muscle (Castillo et al. 2009; Hall et al. 2005, 2006; Panserat et al. 2001; Planas et al. 2000; Teerijoki et al. 2000; Terova et al. 2009; Zhang et al. 2003). The above summary, based on a collection of reports, is extended here with a comprehensive and selfcontained experiment focused on Atlantic cod (Gadus morhua). The existing information with respect to the distribution of GLUTs, and especially the older studies are often qualitative and based on the normalization of transcript levels to RNA or β-actin; whereas, the functionally significant measure of transcript level is presumably the amount that is present in the cell. Given that total RNA levels vary amongst tissues, normalization of transcript level to RNA does not reveal the abundance of a specific transcript in different tissues. In the first part of the current experiment, we address these issues by determining quantitative transcript levels normalized to tissue mass in Atlantic cod. Furthermore, while all of the earlier work provides information with respect to the level of a specific transcript in different tissues, these reports provide no insight into the level of various transcripts within a given tissue. For instance, what is the most abundant GLUT transcript in heart or brain? The second part of this study presents novel information on this front and allows an immediate visualization of the most/least dominant of the GLUT transcripts in any given tissue. Finally, a number of papers imply an association between transcript expression levels and rates of glucose metabolism. For instance, the expression of various fish GLUTs in Xenopus laevis oocytes results in an increase in glucose uptake (Teerijoki et al. 2001; Castillo et al. 2009; Capilla et al. 2004). In addition, levels of GLUT transcripts in a variety of fish follow the same direction as presumptive increases in glucose metabolism in response to hypoxia, changes in insulin levels, or changes in energy demand associated with ion/osmo regulation (Capilla et al. 2002, 2004; Hall et al. 2005, 2009; Díaz et al. 2007, 2009; Terova et al. 2009; Tseng et al. 2009; Zhang et al. 2003). Our initial tissue distribution study revealed that three tissues, namely, gas gland, heart, and RBCs (red blood cells) expressed almost exclusively GLUT1 mRNA. This finding was capitalized upon in a third experiment to directly assess, for the first time, the relationship between GLUT1 transcript levels and rates of glucose metabolism. Overall, the current studies show that in Atlantic cod (1) GLUT1 is the most abundant transcript of the class I sodium-independent GLUTs in most tissue types (liver and kidney being the exceptions), (2) the gas gland has exceptionally high GLUT1 transcript levels, and (3) GLUT1 transcript levels correlate with rates of glucose metabolism in three tissue types.
13
J Comp Physiol B
Materials and methods Animal source and husbandry Atlantic cod (Gadus morhua) were randomly sampled from a population that had been reared from hatch in the Dr. Joe Brown Aquatic Research Building at the Ocean Sciences Centre, Memorial University of Newfoundland. Fish were held indoors in free-flowing seawater between 8 and 10 °C, and were exposed to a natural photoperiod with fluorescent lights set by an outdoor photocell. They were fed daily with a commercial diet (Shur-Gain, Truro, Nova Scotia: 45.0 % protein; 22.0 % fat; 4.0 % fiber; 1.6 % calcium; 1.2 % phosphorus; 0.7 % sodium; 10,000 IU kg−1 vitamin A; 4,000 IU kg−1 vitamin D; 250 IU kg−1 vitamin E). In the transcript analysis study, animals were killed by a sharp blow to the head, and the tissues removed quickly, flash frozen in liquid nitrogen and stored at −80 °C. In the metabolism study, 3 ml of blood was collected from the caudal vessel with a heparinized syringe and kept on ice until cell preparations were completed. Following a blow to the head, the heart was quickly excised for the isolation of myocytes. The gas gland was removed by sectioning the left body wall, making an anterior cut in the swim bladder and bluntly dissecting the gas gland from the swim bladder. Body mass was 120 ± 9 g. Animal protocols were approved by the Institutional Animal Care Committee, Memorial University of Newfoundland, St. John’s, NL, Canada. Transcript analysis RNA preparation For liver and white muscle samples, tissues were homogenized to a powder using a mortar and pestle that had been chilled with liquid nitrogen. Approximately 100-mg tissue was used in the RNA extraction. For tissues weighing between 200 and 300 mg, the tissue was divided into ~100 mg pieces, separate RNA extractions were performed and the RNA was pooled at the end of the procedure. For tissues weighing ~100 mg, the entire tissue was used in the RNA extraction. Total RNA was extracted using TRIzol Reagent (Life Technologies, Burlington, ON). Tissues were homogenized in TRIzol Reagent using a motorized Kontes RNase-Free Pellet Pestle Grinder (Kimble Chase, Vineland, NJ) and then further disrupted using QIAshredder spin columns (QIAGEN, Mississauga, ON). The remainder of the protocol was carried out following the manufacturer’s instructions. Total RNA was treated with TURBO DNAfree (Life Technologies) following the manufacturer’s instructions. RNA integrity was verified by 1 % agarose gel electrophoresis and purity was assessed by A260/280 and A260/230 UV NanoDrop spectrophotometry.
J Comp Physiol B
cDNA cloning Atlantic cod class I sodium-independent glucose transporters GLUT1 (GenBank accession number AY526497), GLUT2 (AY795481), GLUT3 (AY645944) and GLUT4 (DQ109810) were amplified using RT-PCR and subcloned into a TA cloning vector for use as template to generate standard curves for quantitative reverse transcription-polymerase chain reaction (QPCR) assays. The sequences of all primers used in cDNA cloning are presented in Table 1. The GLUT1 primers were designed to amplify the fulllength coding sequence (CDS) plus 45 nucleotides of the 5′ untranslated region to bring the amplicon size closer to that of the other GLUTs, whereas the primers for GLUTs 2–4 amplified the entire CDS only. DNaseI-treated total RNA (1 μg) extracted from posterior kidney (GLUT1 and 3), liver (GLUT2) and heart (GLUT4) was reverse-transcribed in a 20-μl reaction using random primers (250 ng) (Life Technologies) and M-MLV reverse transcriptase (200 U) (Life Technologies) with the manufacturer’s first-strand buffer (1× final concentration) and DTT (10 mM final concentration) at 37 °C for 50 min. PCR amplification was performed using DyNAzyme EXT (Thermo Fisher Scientific, Ottawa, ON). Briefly, 50-μl reactions were prepared containing 100 ng of cDNA (corresponding to 100 ng total RNA), DyNAzyme EXT DNA polymerase (1 U), the manufacturer’s Optimized DyNAzyme EXT Buffer (1× final concentration), 0.2 mM dNTPs and 0.2 μM each of forward and of reverse primer. Touchdown PCR was used with 40 cycles of 94 °C for 30 s, 65 °C↓0.3 °C per cycle (to 53.3 °C at cycle 40) for 30 s and 72 °C for 1.5 min. PCR products were electrophoresed on a 1 % agarose gel, excised and purified using the QIAquick Gel Extraction Kit (QIAGEN). They were then subcloned into pGEM-T Easy (Thermo Fisher Scientific) and transformations performed using subcloning efficiency DH5α competent cells (Life Technologies). Plasmid DNA was isolated from individual clones using the QIAprep Spin Miniprep Kit (QIAGEN) and clone restriction fragments Table 1 Sequences of oligonucleotides used in cDNA cloning cDNA Direction Nucleotide sequence (5′-3′)
Amplicon size (bp)
GLUT1 Forward Reverse GLUT2 Forward Reverse GLUT3 Forward Reverse GLUT4 Forward
1,515
TAACGCGACGACAAGACAAGAG TCAGAGCTGGGAGTCGCCCA ATGGAGTCGGACAAGCAGCTG TTAGGCATCTGTAGCGGACTTG ATGGAGCGTATGCATGATGAGAA CTAAGGAGCTCCGGCCTTATC ATGCCTGCCGGATTCCAGCA
Reverse TCAGTTCAGGTCATCCCCCAG
1,521 1,560 1,512
screened for inserts by visual comparison with a DNA size marker (1 kb plus ladder; Life Technologies) using 1.0 % agarose gel electrophoresis. Positive clones were sequenced on both strands at the Genomics and Proteomics Facility, CREAIT Network, Memorial University of Newfoundland. Sequence data were extracted using Sequence Scanner v1.0 (Life Technologies) and analyzed using Vector NTI Advance 11 (Life Technologies). QPCR assays mRNA levels of the class I sodium-independent glucose transporters GLUTs 1–4 in 11 tissues from 8 Atlantic cod were quantified by QPCR, using SYBR Green I dye chemistry with normalization to 18S ribosomal RNA using a commercially available TaqMan assay and the 7300 RealTime PCR system (Life Technologies). Two comparative studies were performed. In the first, the relative absolute quantity (RAQ) of a given GLUT was compared between tissues. In the second, the RAQ of each GLUT in a given tissue was compared. The sequences of the primer pairs used for QPCR are presented in Table 2. These primers were quality tested to ensure that a single product was amplified (dissociation curve analysis) and that there was no primer–dimer present in the no-template control. Amplicons were electrophoresed on 2 % agarose gels and compared with a 1 kb plus ladder (Life Technologies) to ensure the correct size fragment was being amplified. Finally, amplification efficiencies (Pfaffl 2001) were calculated and were required to be between 90 and 110 %. Briefly, cDNA synthesized (see below) from heart (GLUT1, 3, 4) and liver (GLUT2) of one Atlantic cod was used as template in the primer analysis. A 4-point 1:5 dilution series starting with 10 ng of cDNA (corresponding to 10 ng total RNA) was used for these calculations. First-strand cDNA was synthesized from 1 μg of DNaseI-treated total RNA using random primers and M-MLV Reverse Transcriptase (Life Technologies) as described in the cDNA cloning methods. A “no Reverse Transcriptase” control cDNA synthesis was also performed for each sample. PCR amplification of the target genes (GLUTs 1–4) was performed in a 25-μl reaction containing 10 ng of cDNA (corresponding to 10 ng total RNA), 50 nM each of forward and reverse primer and 1× Power SYBR Green PCR Master Mix (Life Technologies). A standard curve PCR for the GLUT of interest was also included on the plate. It consisted of a 5-point 1:10 dilution series starting with 1 ng of plasmid DNA for the GLUT of interest and a no-template control. Expression levels of the target genes were normalized to 18S ribosomal RNA using the Eukaryotic 18S rRNA Endogenous Control (VIC/MGB Probe, Primer Limited) (Life Technologies). PCR amplification
13
Table 2 Sequences of oligonucleotides used in QPCR
J Comp Physiol B Gene name
Direction
Nucleotide sequence (5′-3′)
Position of 5′-end in CDS
Amplicon size (bp)
Efficiency (%)
GLUT1
Forward Reverse Forward Reverse Forward Reverse Forward
GTGTTTGGCATCGAGTCCTT TCGTTCTTGTTGAGCAGCAG GAGGAGGGAGAGAAGGAGGA TGGGACAGATGCATCAAGAG ATTCGAAACAGCGGGTGTAG ATTCCAGCCAATCCAATCAG TCGTCACAGGCATCCTCATA
514 656 790 890 906 1,046 509
143
102
101
105
141
109
138
96
Reverse
TCTCTGGACAGAAGGGCAAC
GLUT2 GLUT3 GLUT4
of 18S rRNA was performed in a separate 25-μl reaction, using 0.4 ng of cDNA (corresponding to 0.4 ng total RNA), 1× probe/primer mix and 1× TaqMan Universal PCR Master Mix, with AmpErase UNG (Life Technologies). A standard curve PCR for 18S ribosomal RNA was also included on the plate. It consisted of a 7-point 1:5 dilution series starting with 10 ng of freshly synthesized cDNA (using DNaseI-treated total RNA from the heart of fish 1 as template) and a no-template control. Average threshold cycle (CT) values for 18S rRNA between all tissues were less than one cycle apart, therefore it was deemed to be an acceptable normalizer. For the target and normalizer assays, each sample was tested in duplicate, as well as its “no Reverse Transcriptase” control; the standards were tested in duplicate. For all PCR reactions, the real-time analysis program consisted of 1 cycle of 50 °C for 2 min, 1 cycle of 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 1 min, with a dissociation stage included for the target gene expression analysis. GLUT mRNA levels were calculated using the relative standard curve method for quantification. For each experimental sample, the absolute quantity of the target gene (GLUT of interest) and endogenous control (18S) was determined by comparing the fluorescence CT for an experimental sample to the appropriate standard curve using the 7300 PCR Detection System SDS Software Absolute Quantification (Standard Curve) Application (Version 1.2.3) (Life Technologies). The target absolute quantity was then divided by the endogenous control absolute quantity to obtain a normalized target absolute quantity. The RAQ of a given GLUT was measured in different tissues. Initially, the sample with the lowest detectable normalized absolute quantity (mRNA level) of that particular GLUT was set as the calibrator. In all cases the calibrator sample was assigned a value = 1, and levels for the other samples were calculated relative to the calibrator. In a second study, GLUT expression was further analyzed to measure GLUT mRNA levels on a per gram tissue basis. Briefly, the GLUT mRNA level measured in the QPCR reaction was based upon 10 ng of cDNA (corresponding to 10 ng of input
13
646
RNA). Thereafter, the normalized GLUT mRNA level was multiplied by 100 to generate the GLUT mRNA level per μg of total RNA. Next, the quantity of total RNA (μg) generated from the TRIzol extraction(s) was calculated by multiplying the RNA concentration (μg/μL) by the final (total volume of RNA pools where multiple extractions were performed for a given sample) resuspension volume (μL). This value was then divided by the mass of tissue (g) used in the RNA extraction(s) to calculate the μg total RNA/g tissue. Finally, the GLUT mRNA level/μg total RNA was multiplied by the μg total RNA/g tissue to generate the GLUT mRNA level/g tissue. The sample with the lowest detectable normalized absolute quantity (mRNA level) per g tissue of that particular GLUT was set as the calibrator. Preparation of heart and gas gland cells Atlantic cod myocytes were isolated by a method previously described for rainbow trout (Shiels et al. 2000) with some modifications. Briefly, a retrograde perfusion of the heart was performed at 8 °C, first with an isolating solution for 8 min and then with an enzyme solution for 12–14 min. The isolating solution contained (in mM): 100 NaCl, 10 KCl, 1.2 KH2PO4, 4 MgSO4, 30 taurine, 20 glucose, and 10 HEPES, adjusted to pH 6.9. The enzyme solution contained 0.75 mg ml−1 collagenase (type 1A), 0.5 mg ml−1 trypsin (type IX.S) and 0.75 mg ml−1 BSA in the isolation solution. Following the enzymatic digestion, the atrium was removed from the ventricle; the ventricle was cut into small pieces and then gently agitated using the opening of a plastic Pasteur pipette. The isolated cells were passed through a 150-μm filter and centrifuged at 200g for 5 min. Cells were resuspended with incubation media containing (mmol l−1): 155 NaCl, 5 KCl, 1 NaH2PO4, 2 MgSO4, 10 HEPES, and 5 glucose, adjusted to pH 7.6. In order to protect myocytes from the ‘Ca2+ paradox’, Ca2+ was added back to the suspension to a final concentration of 2 mM in five increments over a period of 25 min. Cells were centrifuged and resuspended to a concentration of approximately 10–15 mg cells per 200 μl.
J Comp Physiol B
The gas gland was minced in a watch glass with 5 ml of enzyme mixture. This mixture contained 0.5 mg ml−1 BSA, 0.3 U ml−1 collagenase (type 4), 0.3 U ml−1 protease, 70 U ml−1 DNase, and 3.9 U ml−1 elastase in the same incubation medium described above for myocytes. Enzymes were purchased from Worthington Biochemical Corp. with the exception of protease, which was purchased from Sigma. The tissue pieces were gently agitated by pipetting up and down with a plastic Pasteur pipette intermittently for 10 min. This mixture was put through a 70-μm filter and added to 20 ml of stopping buffer-containing incubation medium and 2 % BSA. The remaining undigested tissue left on the filter was put back onto the watch glass and enzyme incubation/ filtration procedure was repeated twice. Cells were centrifuged at 100g for 10 min. The medium was poured off, and the cells were washed twice with more incubation medium. Increasing increments of Ca2+ were added for a 10-min period until the final concentration of Ca2+ in the solution was 2 mM. Cells were centrifuged and resuspended to a concentration of approximately 5-mg cells per 200 μl. Glucose metabolism The procedure for determining glucose metabolism in myocytes, gas gland cells and whole blood was similar to the protocol used to measure glucose metabolism in isolated RBCs (Driedzic et al. 2013). 200 μl of the cell suspension or whole blood was incubated in 16 × 100 mm glass tubes containing [2-3H]-glucose (7.4 kBq; American Radiolabeled Chemicals, Burnaby, Canada). Cell suspensions contained 5 mmol l−1 glucose; however, no additional glucose was added to the whole blood incubations. A small aliquot of the blood was centrifuged and the plasma assayed for glucose as described in Clow et al. (2004). To test for linearity, myocytes and gas gland cells were incubated for 1, 2 and 3 h at 8 °C. In a few cases, gas gland cells were only incubated for 1.5 and 3 h. Blood was incubated for 3 h only as metabolism was already determined to be linear for up to 5 h with isolated RBCs (Driedzic et al. 2013) and blood (Driedzic et al., in preparation). After each time point, the sample was spun at 12,000g for 30 s; the supernatant or plasma was collected and frozen. The 3H2O produced during the incubation was separated from the [2-3H]-glucose in the supernatant using chromatography as previously described (Driedzic et al. 2013). Background counts were obtained by adding the label to a 200-μl aliquot of cell suspension or blood, spinning immediately and flash freezing the supernatant. These counts were subtracted from all time points. Lactate measurements Lactate was measured in the supernatant from the cell suspensions. 25–50 μl of extract was added to an assay
medium containing glycine buffer (Sigma, G5418) and 2.5 mmol l−1 NAD+, pH 9.0 at RT. Samples were read after 10 min before adding 30 IU ml−1 LDH. Absorbances were read for another 30 min or until stable. All absorbances were determined with a DTX 880 microplate reader (Beckman Coulter, Mississauga, ON, Canada). Data analysis All data were log10 transformed prior to statistical analysis. One-way ANOVA followed by Tukey’s post hoc test was then used to assess if there were any significant differences in relative GLUT mRNA levels, total RNA levels or rates of glucose metabolism. Exceptions are in Figs. 4j, k and 5b where two-tailed t tests were performed. In all cases, P
Original Paper
Transcript levels of class I GLUTs within individual tissues and the direct relationship between GLUT1 expression and glucose metabolism in Atlantic cod (Gadus morhua) Jennifer R. Hall · Kathy A. Clow · Connie E. Short · William R. Driedzic
Received: 25 October 2013 / Revised: 15 January 2014 / Accepted: 24 January 2014 © Springer-Verlag Berlin Heidelberg 2014
Abstract GLUTs 1–4 are sodium-independent facilitated glucose transporters and are considered to play a major role in glucose trafficking. The relative transcript levels of GLUTs 1–4 were determined in tissues of Atlantic cod (Gadus morhua). The distribution profile of GLUTs normalized to RNA is similar to mammals and with a few exceptions other fish. GLUT1 is ubiquitous, GLUT2 is relatively abundant in tissues that release glucose, GLUT3 expression is relatively strong in brain, and GLUT4 is relatively high in heart and muscle. The functionally significant level of transcript is presumably the level in the cell. Normalization of relative GLUT levels to tissue mass reveals there are extremely high levels of GLUT1 transcript in gas gland consistent with the high lactate production rates, GLUT3 is dominant in gill and head kidney as well as brain, and GLUT4 expression in gill is elevated relative to other tissues. Consideration of GLUTs within tissues reveals that GLUT1 is the dominant transcript in a group of tissues including gas gland, heart, white muscle, and RBCs. Brain, gill, and spleen display a co-dominance of GLUTs 1 and 3. There are relatively low levels of GLUT4 in most tissues, the highest being found in white muscle where GLUT4 accounts for only 12 % of the total transcript level. The apparent low level of GLUT4 transcript may reflect
Communicated by I. D. Hume. J. R. Hall Aquatic Research Cluster, CREAIT Network, Memorial University of Newfoundland, St. John’s, NL A1C 5S7, Canada K. A. Clow · C. E. Short · W. R. Driedzic (*) Department of Ocean Sciences, Ocean Sciences Centre, Memorial University of Newfoundland, St. John’s, NL A1C 5S7, Canada e-mail: [email protected]
two tissues that were not included in the current study, red muscle and adipose tissue, due to their low abundance in Atlantic cod. The rate of glucose metabolism in isolated cells prepared from gas gland, heart, and RBCs was determined by tracking the rate of 3H2O production from [2-3H]glucose. The steady-state rate of basal glycolysis in these three tissues correlates with relative transcript levels of GLUT1. Keywords Atlantic cod · Glucose transporters · GLUT · Gas gland · Heart · RBC · Glucose metabolism · Lactate production
Introduction Glucose movement across cell membranes is considered to occur through facilitated transport mechanisms involving specific transmembrane proteins (GLUTs). The class I sodium-independent GLUTs 1, 2, 3, and 4 are well recognized in mammals and play a major role in glucose trafficking (Wood and Trayhurn 2003; Uldry and Thorens 2004). GLUT transcripts similar to those in mammals have been identified in fish. An understanding of glucose uptake and exit mechanisms is essential to the overall picture of glucose utilization. Although glucose metabolism in fish has received considerable attention (Polakof et al. 2011, 2012), the role of glucose transporters remains open to investigation. The tissue distribution of transcript levels for GLUTs 1–4 normalized to RNA or β-actin has been described for Atlantic cod, salmonids, and to a lesser extent in a few other fish species. An overview of a collection of diverse studies suggests that GLUT 1 is ubiquitous; GLUT 2 occurs in liver, intestine, kidney and brain; GLUT 3 is
13
most abundant in kidney; and GLUT 4 is expressed primarily in heart followed by muscle (Castillo et al. 2009; Hall et al. 2005, 2006; Panserat et al. 2001; Planas et al. 2000; Teerijoki et al. 2000; Terova et al. 2009; Zhang et al. 2003). The above summary, based on a collection of reports, is extended here with a comprehensive and selfcontained experiment focused on Atlantic cod (Gadus morhua). The existing information with respect to the distribution of GLUTs, and especially the older studies are often qualitative and based on the normalization of transcript levels to RNA or β-actin; whereas, the functionally significant measure of transcript level is presumably the amount that is present in the cell. Given that total RNA levels vary amongst tissues, normalization of transcript level to RNA does not reveal the abundance of a specific transcript in different tissues. In the first part of the current experiment, we address these issues by determining quantitative transcript levels normalized to tissue mass in Atlantic cod. Furthermore, while all of the earlier work provides information with respect to the level of a specific transcript in different tissues, these reports provide no insight into the level of various transcripts within a given tissue. For instance, what is the most abundant GLUT transcript in heart or brain? The second part of this study presents novel information on this front and allows an immediate visualization of the most/least dominant of the GLUT transcripts in any given tissue. Finally, a number of papers imply an association between transcript expression levels and rates of glucose metabolism. For instance, the expression of various fish GLUTs in Xenopus laevis oocytes results in an increase in glucose uptake (Teerijoki et al. 2001; Castillo et al. 2009; Capilla et al. 2004). In addition, levels of GLUT transcripts in a variety of fish follow the same direction as presumptive increases in glucose metabolism in response to hypoxia, changes in insulin levels, or changes in energy demand associated with ion/osmo regulation (Capilla et al. 2002, 2004; Hall et al. 2005, 2009; Díaz et al. 2007, 2009; Terova et al. 2009; Tseng et al. 2009; Zhang et al. 2003). Our initial tissue distribution study revealed that three tissues, namely, gas gland, heart, and RBCs (red blood cells) expressed almost exclusively GLUT1 mRNA. This finding was capitalized upon in a third experiment to directly assess, for the first time, the relationship between GLUT1 transcript levels and rates of glucose metabolism. Overall, the current studies show that in Atlantic cod (1) GLUT1 is the most abundant transcript of the class I sodium-independent GLUTs in most tissue types (liver and kidney being the exceptions), (2) the gas gland has exceptionally high GLUT1 transcript levels, and (3) GLUT1 transcript levels correlate with rates of glucose metabolism in three tissue types.
13
J Comp Physiol B
Materials and methods Animal source and husbandry Atlantic cod (Gadus morhua) were randomly sampled from a population that had been reared from hatch in the Dr. Joe Brown Aquatic Research Building at the Ocean Sciences Centre, Memorial University of Newfoundland. Fish were held indoors in free-flowing seawater between 8 and 10 °C, and were exposed to a natural photoperiod with fluorescent lights set by an outdoor photocell. They were fed daily with a commercial diet (Shur-Gain, Truro, Nova Scotia: 45.0 % protein; 22.0 % fat; 4.0 % fiber; 1.6 % calcium; 1.2 % phosphorus; 0.7 % sodium; 10,000 IU kg−1 vitamin A; 4,000 IU kg−1 vitamin D; 250 IU kg−1 vitamin E). In the transcript analysis study, animals were killed by a sharp blow to the head, and the tissues removed quickly, flash frozen in liquid nitrogen and stored at −80 °C. In the metabolism study, 3 ml of blood was collected from the caudal vessel with a heparinized syringe and kept on ice until cell preparations were completed. Following a blow to the head, the heart was quickly excised for the isolation of myocytes. The gas gland was removed by sectioning the left body wall, making an anterior cut in the swim bladder and bluntly dissecting the gas gland from the swim bladder. Body mass was 120 ± 9 g. Animal protocols were approved by the Institutional Animal Care Committee, Memorial University of Newfoundland, St. John’s, NL, Canada. Transcript analysis RNA preparation For liver and white muscle samples, tissues were homogenized to a powder using a mortar and pestle that had been chilled with liquid nitrogen. Approximately 100-mg tissue was used in the RNA extraction. For tissues weighing between 200 and 300 mg, the tissue was divided into ~100 mg pieces, separate RNA extractions were performed and the RNA was pooled at the end of the procedure. For tissues weighing ~100 mg, the entire tissue was used in the RNA extraction. Total RNA was extracted using TRIzol Reagent (Life Technologies, Burlington, ON). Tissues were homogenized in TRIzol Reagent using a motorized Kontes RNase-Free Pellet Pestle Grinder (Kimble Chase, Vineland, NJ) and then further disrupted using QIAshredder spin columns (QIAGEN, Mississauga, ON). The remainder of the protocol was carried out following the manufacturer’s instructions. Total RNA was treated with TURBO DNAfree (Life Technologies) following the manufacturer’s instructions. RNA integrity was verified by 1 % agarose gel electrophoresis and purity was assessed by A260/280 and A260/230 UV NanoDrop spectrophotometry.
J Comp Physiol B
cDNA cloning Atlantic cod class I sodium-independent glucose transporters GLUT1 (GenBank accession number AY526497), GLUT2 (AY795481), GLUT3 (AY645944) and GLUT4 (DQ109810) were amplified using RT-PCR and subcloned into a TA cloning vector for use as template to generate standard curves for quantitative reverse transcription-polymerase chain reaction (QPCR) assays. The sequences of all primers used in cDNA cloning are presented in Table 1. The GLUT1 primers were designed to amplify the fulllength coding sequence (CDS) plus 45 nucleotides of the 5′ untranslated region to bring the amplicon size closer to that of the other GLUTs, whereas the primers for GLUTs 2–4 amplified the entire CDS only. DNaseI-treated total RNA (1 μg) extracted from posterior kidney (GLUT1 and 3), liver (GLUT2) and heart (GLUT4) was reverse-transcribed in a 20-μl reaction using random primers (250 ng) (Life Technologies) and M-MLV reverse transcriptase (200 U) (Life Technologies) with the manufacturer’s first-strand buffer (1× final concentration) and DTT (10 mM final concentration) at 37 °C for 50 min. PCR amplification was performed using DyNAzyme EXT (Thermo Fisher Scientific, Ottawa, ON). Briefly, 50-μl reactions were prepared containing 100 ng of cDNA (corresponding to 100 ng total RNA), DyNAzyme EXT DNA polymerase (1 U), the manufacturer’s Optimized DyNAzyme EXT Buffer (1× final concentration), 0.2 mM dNTPs and 0.2 μM each of forward and of reverse primer. Touchdown PCR was used with 40 cycles of 94 °C for 30 s, 65 °C↓0.3 °C per cycle (to 53.3 °C at cycle 40) for 30 s and 72 °C for 1.5 min. PCR products were electrophoresed on a 1 % agarose gel, excised and purified using the QIAquick Gel Extraction Kit (QIAGEN). They were then subcloned into pGEM-T Easy (Thermo Fisher Scientific) and transformations performed using subcloning efficiency DH5α competent cells (Life Technologies). Plasmid DNA was isolated from individual clones using the QIAprep Spin Miniprep Kit (QIAGEN) and clone restriction fragments Table 1 Sequences of oligonucleotides used in cDNA cloning cDNA Direction Nucleotide sequence (5′-3′)
Amplicon size (bp)
GLUT1 Forward Reverse GLUT2 Forward Reverse GLUT3 Forward Reverse GLUT4 Forward
1,515
TAACGCGACGACAAGACAAGAG TCAGAGCTGGGAGTCGCCCA ATGGAGTCGGACAAGCAGCTG TTAGGCATCTGTAGCGGACTTG ATGGAGCGTATGCATGATGAGAA CTAAGGAGCTCCGGCCTTATC ATGCCTGCCGGATTCCAGCA
Reverse TCAGTTCAGGTCATCCCCCAG
1,521 1,560 1,512
screened for inserts by visual comparison with a DNA size marker (1 kb plus ladder; Life Technologies) using 1.0 % agarose gel electrophoresis. Positive clones were sequenced on both strands at the Genomics and Proteomics Facility, CREAIT Network, Memorial University of Newfoundland. Sequence data were extracted using Sequence Scanner v1.0 (Life Technologies) and analyzed using Vector NTI Advance 11 (Life Technologies). QPCR assays mRNA levels of the class I sodium-independent glucose transporters GLUTs 1–4 in 11 tissues from 8 Atlantic cod were quantified by QPCR, using SYBR Green I dye chemistry with normalization to 18S ribosomal RNA using a commercially available TaqMan assay and the 7300 RealTime PCR system (Life Technologies). Two comparative studies were performed. In the first, the relative absolute quantity (RAQ) of a given GLUT was compared between tissues. In the second, the RAQ of each GLUT in a given tissue was compared. The sequences of the primer pairs used for QPCR are presented in Table 2. These primers were quality tested to ensure that a single product was amplified (dissociation curve analysis) and that there was no primer–dimer present in the no-template control. Amplicons were electrophoresed on 2 % agarose gels and compared with a 1 kb plus ladder (Life Technologies) to ensure the correct size fragment was being amplified. Finally, amplification efficiencies (Pfaffl 2001) were calculated and were required to be between 90 and 110 %. Briefly, cDNA synthesized (see below) from heart (GLUT1, 3, 4) and liver (GLUT2) of one Atlantic cod was used as template in the primer analysis. A 4-point 1:5 dilution series starting with 10 ng of cDNA (corresponding to 10 ng total RNA) was used for these calculations. First-strand cDNA was synthesized from 1 μg of DNaseI-treated total RNA using random primers and M-MLV Reverse Transcriptase (Life Technologies) as described in the cDNA cloning methods. A “no Reverse Transcriptase” control cDNA synthesis was also performed for each sample. PCR amplification of the target genes (GLUTs 1–4) was performed in a 25-μl reaction containing 10 ng of cDNA (corresponding to 10 ng total RNA), 50 nM each of forward and reverse primer and 1× Power SYBR Green PCR Master Mix (Life Technologies). A standard curve PCR for the GLUT of interest was also included on the plate. It consisted of a 5-point 1:10 dilution series starting with 1 ng of plasmid DNA for the GLUT of interest and a no-template control. Expression levels of the target genes were normalized to 18S ribosomal RNA using the Eukaryotic 18S rRNA Endogenous Control (VIC/MGB Probe, Primer Limited) (Life Technologies). PCR amplification
13
Table 2 Sequences of oligonucleotides used in QPCR
J Comp Physiol B Gene name
Direction
Nucleotide sequence (5′-3′)
Position of 5′-end in CDS
Amplicon size (bp)
Efficiency (%)
GLUT1
Forward Reverse Forward Reverse Forward Reverse Forward
GTGTTTGGCATCGAGTCCTT TCGTTCTTGTTGAGCAGCAG GAGGAGGGAGAGAAGGAGGA TGGGACAGATGCATCAAGAG ATTCGAAACAGCGGGTGTAG ATTCCAGCCAATCCAATCAG TCGTCACAGGCATCCTCATA
514 656 790 890 906 1,046 509
143
102
101
105
141
109
138
96
Reverse
TCTCTGGACAGAAGGGCAAC
GLUT2 GLUT3 GLUT4
of 18S rRNA was performed in a separate 25-μl reaction, using 0.4 ng of cDNA (corresponding to 0.4 ng total RNA), 1× probe/primer mix and 1× TaqMan Universal PCR Master Mix, with AmpErase UNG (Life Technologies). A standard curve PCR for 18S ribosomal RNA was also included on the plate. It consisted of a 7-point 1:5 dilution series starting with 10 ng of freshly synthesized cDNA (using DNaseI-treated total RNA from the heart of fish 1 as template) and a no-template control. Average threshold cycle (CT) values for 18S rRNA between all tissues were less than one cycle apart, therefore it was deemed to be an acceptable normalizer. For the target and normalizer assays, each sample was tested in duplicate, as well as its “no Reverse Transcriptase” control; the standards were tested in duplicate. For all PCR reactions, the real-time analysis program consisted of 1 cycle of 50 °C for 2 min, 1 cycle of 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 1 min, with a dissociation stage included for the target gene expression analysis. GLUT mRNA levels were calculated using the relative standard curve method for quantification. For each experimental sample, the absolute quantity of the target gene (GLUT of interest) and endogenous control (18S) was determined by comparing the fluorescence CT for an experimental sample to the appropriate standard curve using the 7300 PCR Detection System SDS Software Absolute Quantification (Standard Curve) Application (Version 1.2.3) (Life Technologies). The target absolute quantity was then divided by the endogenous control absolute quantity to obtain a normalized target absolute quantity. The RAQ of a given GLUT was measured in different tissues. Initially, the sample with the lowest detectable normalized absolute quantity (mRNA level) of that particular GLUT was set as the calibrator. In all cases the calibrator sample was assigned a value = 1, and levels for the other samples were calculated relative to the calibrator. In a second study, GLUT expression was further analyzed to measure GLUT mRNA levels on a per gram tissue basis. Briefly, the GLUT mRNA level measured in the QPCR reaction was based upon 10 ng of cDNA (corresponding to 10 ng of input
13
646
RNA). Thereafter, the normalized GLUT mRNA level was multiplied by 100 to generate the GLUT mRNA level per μg of total RNA. Next, the quantity of total RNA (μg) generated from the TRIzol extraction(s) was calculated by multiplying the RNA concentration (μg/μL) by the final (total volume of RNA pools where multiple extractions were performed for a given sample) resuspension volume (μL). This value was then divided by the mass of tissue (g) used in the RNA extraction(s) to calculate the μg total RNA/g tissue. Finally, the GLUT mRNA level/μg total RNA was multiplied by the μg total RNA/g tissue to generate the GLUT mRNA level/g tissue. The sample with the lowest detectable normalized absolute quantity (mRNA level) per g tissue of that particular GLUT was set as the calibrator. Preparation of heart and gas gland cells Atlantic cod myocytes were isolated by a method previously described for rainbow trout (Shiels et al. 2000) with some modifications. Briefly, a retrograde perfusion of the heart was performed at 8 °C, first with an isolating solution for 8 min and then with an enzyme solution for 12–14 min. The isolating solution contained (in mM): 100 NaCl, 10 KCl, 1.2 KH2PO4, 4 MgSO4, 30 taurine, 20 glucose, and 10 HEPES, adjusted to pH 6.9. The enzyme solution contained 0.75 mg ml−1 collagenase (type 1A), 0.5 mg ml−1 trypsin (type IX.S) and 0.75 mg ml−1 BSA in the isolation solution. Following the enzymatic digestion, the atrium was removed from the ventricle; the ventricle was cut into small pieces and then gently agitated using the opening of a plastic Pasteur pipette. The isolated cells were passed through a 150-μm filter and centrifuged at 200g for 5 min. Cells were resuspended with incubation media containing (mmol l−1): 155 NaCl, 5 KCl, 1 NaH2PO4, 2 MgSO4, 10 HEPES, and 5 glucose, adjusted to pH 7.6. In order to protect myocytes from the ‘Ca2+ paradox’, Ca2+ was added back to the suspension to a final concentration of 2 mM in five increments over a period of 25 min. Cells were centrifuged and resuspended to a concentration of approximately 10–15 mg cells per 200 μl.
J Comp Physiol B
The gas gland was minced in a watch glass with 5 ml of enzyme mixture. This mixture contained 0.5 mg ml−1 BSA, 0.3 U ml−1 collagenase (type 4), 0.3 U ml−1 protease, 70 U ml−1 DNase, and 3.9 U ml−1 elastase in the same incubation medium described above for myocytes. Enzymes were purchased from Worthington Biochemical Corp. with the exception of protease, which was purchased from Sigma. The tissue pieces were gently agitated by pipetting up and down with a plastic Pasteur pipette intermittently for 10 min. This mixture was put through a 70-μm filter and added to 20 ml of stopping buffer-containing incubation medium and 2 % BSA. The remaining undigested tissue left on the filter was put back onto the watch glass and enzyme incubation/ filtration procedure was repeated twice. Cells were centrifuged at 100g for 10 min. The medium was poured off, and the cells were washed twice with more incubation medium. Increasing increments of Ca2+ were added for a 10-min period until the final concentration of Ca2+ in the solution was 2 mM. Cells were centrifuged and resuspended to a concentration of approximately 5-mg cells per 200 μl. Glucose metabolism The procedure for determining glucose metabolism in myocytes, gas gland cells and whole blood was similar to the protocol used to measure glucose metabolism in isolated RBCs (Driedzic et al. 2013). 200 μl of the cell suspension or whole blood was incubated in 16 × 100 mm glass tubes containing [2-3H]-glucose (7.4 kBq; American Radiolabeled Chemicals, Burnaby, Canada). Cell suspensions contained 5 mmol l−1 glucose; however, no additional glucose was added to the whole blood incubations. A small aliquot of the blood was centrifuged and the plasma assayed for glucose as described in Clow et al. (2004). To test for linearity, myocytes and gas gland cells were incubated for 1, 2 and 3 h at 8 °C. In a few cases, gas gland cells were only incubated for 1.5 and 3 h. Blood was incubated for 3 h only as metabolism was already determined to be linear for up to 5 h with isolated RBCs (Driedzic et al. 2013) and blood (Driedzic et al., in preparation). After each time point, the sample was spun at 12,000g for 30 s; the supernatant or plasma was collected and frozen. The 3H2O produced during the incubation was separated from the [2-3H]-glucose in the supernatant using chromatography as previously described (Driedzic et al. 2013). Background counts were obtained by adding the label to a 200-μl aliquot of cell suspension or blood, spinning immediately and flash freezing the supernatant. These counts were subtracted from all time points. Lactate measurements Lactate was measured in the supernatant from the cell suspensions. 25–50 μl of extract was added to an assay
medium containing glycine buffer (Sigma, G5418) and 2.5 mmol l−1 NAD+, pH 9.0 at RT. Samples were read after 10 min before adding 30 IU ml−1 LDH. Absorbances were read for another 30 min or until stable. All absorbances were determined with a DTX 880 microplate reader (Beckman Coulter, Mississauga, ON, Canada). Data analysis All data were log10 transformed prior to statistical analysis. One-way ANOVA followed by Tukey’s post hoc test was then used to assess if there were any significant differences in relative GLUT mRNA levels, total RNA levels or rates of glucose metabolism. Exceptions are in Figs. 4j, k and 5b where two-tailed t tests were performed. In all cases, P
