Developmental and Comparative Immunology 44 (2014) 261–269

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Antibacterial activity of serine protease inhibitor 1 from kuruma shrimp Marsupenaeus japonicus Yan-Ran Zhao, Yi-Hui Xu, Hai-Shan Jiang, Sen Xu, Xiao-Fan Zhao, Jin-Xing Wang ⇑ MOE Key Laboratory of Plant Cell Engineering and Germplasm Innovation, School of Life Sciences, Shandong University, Jinan, Shandong 250100, China Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, School of Life Sciences, Shandong University, Jinan, Shandong 250100, China

a r t i c l e

i n f o

Article history: Received 4 November 2013 Revised 30 December 2013 Accepted 1 January 2014 Available online 9 January 2014 Keywords: Marsupenaeus japonicus Serpins Antibacterial activity Innate immunity

a b s t r a c t Serine protease inhibitors (Serpins) are a large family of protease inhibitors involved in many critical biological processes such as blood coagulation, fibrinolysis, programmed cell death, development, and innate immunity. We identified MjSerp1, a serpin in the kuruma shrimp Marsupenaeus japonicus. The MjSerp1 cDNA has a 1239 bp open reading frame (ORF) that encodes a 412–amino acid protein with a 23 aa signal peptide and a classic serpin domain. MjSerp1 has a calculated molecular mass of 46.3 kDa and a predicted isoelectric point of 5.51. MjSerp1 is mainly expressed in the hepatopancreas and the intestines, and is moderately expressed in hemocytes. Expression pattern analysis indicated that MjSerp1 is upregulated in the hepatopancreas after Vibrio anguillarum challenge. rMjSerp1 inhibits three Gram-positive bacteria and two Gram-negative bacteria, but does not inhibit phenoloxidase activity. The microorganism binding assay showed that rMjSerp1 closely binds to both Gram-positive and Gram-negative bacteria. MjSerp1 also exhibits inhibitory activity against microbial serine proteases, such as subtilisin A and proteinase K, indicating that MjSerp1 acts as a microbial serine protease inhibitor. rMjSerp1 injection into shrimp enhances V. anguillarum clearance, but MjSerp1 knockdown through RNA interference impairs Vibrio clearance in vivo. These results indicate that MjSerp1 functions as a direct effector in the bacterial clearance of M. japonicus. All together, our findings provide novel evidences for the serine protease inhibitor in shrimp immunity. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Serine proteases (SPs) are a class of proteolytic enzymes characterized by the presence of a uniquely reactive serine side chain (Gatto et al., 2013). They extremely widespread and they have diverse functions. SPs have been widely studied in vertebrates and invertebrates and have been shown to be involved in digestion, development, tissue degradation, blood coagulation, and immune defense (Molehin et al., 2012). Serine proteases are inhibited by a diverse group of inhibitors which are categorized into 18 subfamilies on the basis of similarities (Laskowski and Kato, 1980). The serine protease inhibitors (serpins) are one of the well characterized peptidase inhibitor families. Serpins are widely distributed proteins with similar structures that use conformational change to inhibit serine proteases (Chao et al., 2012). They are intracellular, as well as extracellular proteins, typically from 350 amino acids to 450 amino acids long. All serpins contain a unique structure comprising three b-sheets and seven to nine ⇑ Corresponding author at: MOE Key Laboratory of Plant Cell Engineering and Germplasm Innovation, School of Life Sciences, Shandong University, Jinan, Shandong 250100, China. Tel./fax: +86 531 88364620. E-mail address: [email protected] (J.-X. Wang). 0145-305X/$ - see front matter Ó 2014 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.dci.2014.01.002

a-helices that fold into a conserved spatial structure with a reactive centre loop (RCL) near the C-terminus (Silverman and Lomas, 2007). Serpins are cleaved between the P1 and P10 residues of the RCL to produce a relaxed conformation, which distorts the active site of the protease and traps the active site in a covalent serpin–protease complex (Wang et al., 2012b). Serpins form a family of more than 1000 proteins in plants, animals, and viruses, but only rarely in fungi, bacteria, and archaea (Garrett et al., 2009). Up to 34 human serpins, 32 Drosophila melanogaster serpins, and 12 Manduca sexta serpin have been identified (Gettins, 2002). Serpins are thus the largest and most diverse family of protease inhibitors. Their functions have been studied in many insects, such as Drosophila, M. sexta, Mamestra configurata, Schistocerca gregaria, and Anopheles gambiae, and they are involved in regulating immune responses, including hemolymph coagulation, proPO activation, and in inducing the synthesis of antimicrobial peptides (Franssens et al., 2008; Krüger et al., 2002; Suwanchaichinda and Kanost, 2009; Zou et al., 2009). Some serpins directly act against pathogens. For example, Esserpin mediates immune response, possibly via the inhibition of bacterial growth and the regulation of prophenoloxidase-activating system in the Chinese mitten crab Eriocheir sinensis (Wang et al., 2013). Ranaserpin exhibits a bacteriostatic effect on the Gram-positive bacterium

262

Y.-R. Zhao et al. / Developmental and Comparative Immunology 44 (2014) 261–269

Bacillus subtilis, and performs a defensive role in resistance to invasion of pests and pathogens in Rana graham (Han et al., 2008). Serpins involved in the negative regulation of prophenoloxidase system during the innate immune response have been well studied in the penaeid shrimp (Amparyup et al., 2012) and D. melanogaster (Scherfer et al., 2008). The expression of a serpin in Chinese white shrimp (Fenneropenaeus chinensis) is reportedly regulated by pathogen challenge (Liu et al., 2009). Eight serpins have been identified in the tiger shrimp (Penaeus monodon) and three of them are further studied. PmSERPIN6 expression respond to pathogens during the late phase of infection (Homvises et al., 2010); PmSERPIN8 inhibits Gram-positive bacteria, but not Gram-negative bacteria; it also inhibits the shrimp prophenoloxidase system (Somnuk et al., 2012), whereas PmSERPIN3 regulates the proPO activating system (Wetsaphan et al., 2013). Many serpins have been identified in shrimp but few have been characterized. In this study, we characterized a serpin (MjSerp1) from the kuruma shrimp Marsupenaeus japonicus. The expression patterns and functions of MjSerp1 against pathogens were analyzed. Our results suggest that MjSerp1 has direct antibacterial function in the shrimp innate immunity. 2. Materials and methods

2.3. Semiquantitative RT-PCR and quantitative real-time PCR (qRTPCR) analysis of MjSerp1 expression The tissue distribution of MjSerp1 expression was analyzed via RT-PCR using the Serpin RT primers (Table 1). The PCR procedure was set as follows: 1 cycle at 94 °C for 3 min; followed by 35 cycles of 94 °C for 30 s, 58 °C for 1 min, and 72 °C for 45 s; and a final cycle at 72 °C for 10 min. b-actin was used as the control with the b-actin F and b-actin R primers (Table 1). The qRT-PCR was performed following the manufacturer’s instructions of SYBR Premix Ex Taq (Takara, Dalian, China) using a real-time thermal cycler (Bio-Rad, USA) in a total volume of 10 ll containing 5 ll of 2  Premix Ex Taq, 1 ll of the 1:50 diluted cDNA, 2 ll (1 lM) each of the MjSerp1 RTF and MjSerp1 RTR. The amplification procedure consisted of an initial denaturation step at 95 °C for 10 min, and then 40 cycles of 95 °C for 15 s and 60 °C for 1 min, followed by a melting curve analysis from 65 °C to 95 °C. All samples were repeated in triplicate for real-time PCR analysis. The qRT-PCR data were calculated by 2DDCT. The figure was made using GraphPad Prism software (GraphPad, San Diego, USA). Significant differences were calculated using an unpaired t-test.

2.4. Recombinant expression, and purification of MjSerp1

2.1. Immune challenge of shrimp and total RNA isolation M. japonicus(16–18 g each) were bought from a seafood market in Jinan, Shandong Province, China. The shrimp were cultured in aquariums containing aerated seawater. For the immune challenge experiments, we injected Vibrio anguillarum (3  107 CFU/shrimp) or white spot syndrome virus (WSSV) (3.2  107 virions/shrimp) into the abdomen of shrimp. Different tissues (hemocytes, heart, hepatopancreas, gills, stomach, and intestine) were collected from the pathogen-challenged shrimp at 2, 6, 12, 24 and 48 h post injection and total RNA was isolated. RNA was also isolated from the unchallenged shrimp as the control. Then, first strand cDNA was reverse transcribed from total RNA using the oligo anchor R and SMART F primers (Table 1) according to a previously described method (Du et al., 2007). 2.2. Sequence and phylogenetic analysis The serpin cDNA sequence was obtained through transcriptome sequencing of the shrimp hepatopancraes in our laboratory. Sequence similarity was analyzed by BLASTX (http://www.ncbi. nlm.nih.gov/). The nucleotide sequence was translated and the resulting protein was characterized using ExPASy (http:// www.expasy.ch/). The protein domain was predicted using SMART (http://smart.embl-heidelberg.de/). Sequence alignment was performed using ClustalW and GENEDOC software. A phylogenetic tree was constructed using MEGA 3 software (Kumar et al., 2004). Table 1 Sequences of the primers used in this study. Primer

Sequence (50 –30 )

SMART F Oligo anchor R MjSerp1 RTF MjSerp1 RTR MjSerp1 EXF MjSerp1 EXR b-actin F b-actin R dsMjSerp1 Fi dsMjSerp1 Ri dsGFP Fi dsGFP Ri

tacggctgcgagaagacgacagaaggg gaccacgcgtatcgatgtcgact16(a/c/g) ctgcccaataagcgtgatg cactatgcctaccactgttgc tactcaggatccatggctggtcgaatcagattt tactcagcggccgctcagctgtttgtttgcttcaa gcatcattctccatgtcgtcccagt tacggctgcgagaagacgacagaa gcgtaatacgactcactataggtcccagcatacccacacca gcgtaatacgactcactataggcactctcaccaaagtcaacaac gcgtaatacgactcactataggtggtcccaattctcgtggaac gcgtaatacgactcactataggcttgaagttgaccttgatgcc

The open reading frame (ORF) of MjSerp1 was amplified from hemocyte cDNA using the primers MjSerp1EXF and MjSerp1EXR (Table 1), and BamH I and Not I restriction sites were inserted at the beginning and end of the ORF, respectively. The PCR conditions were as follows: 1 cycle at 94 °C for 3 min; 35 cycles at 94 °C for 30 s, 58 °C for 1 min, and 72 °C for 45 s; and lastly 72 °C for 10 min. The PCR products were then digested with restriction enzymes, purified, and cloned into the pET30a (+) digested with the same enzymes. The recombinant pET30a (+) -MjSerp1 plasmid was transformed into Escherichia coli BL21 (DE3) cells, which were then cultured in Luria–Bertani medium supplemented with 25 lg/ml kanamycin. Isopropyl-d-thiogalactoside (IPTG; 0.5 mM) was added when the OD600 of the culture reached 0.5. After 3 h of culture, the cells were collected through centrifugation at 10,000  g for 10 min and resuspended in 1  PBS containing 0.2% Triton X-100. After cell ultrasonication and centrifugation, MjSerp1 was purified using high-affinity Ni-IDA resin (GenScript) according to the manufacturer’s instructions. The purified protein was analyzed using 12.5% SDS–PAGE and stained with Coomassie brilliant blue G250. The Bradford method was used to determine the protein concentration with bovine serum albumin (BSA) as the reference standard (Bradford, 1976). Empty pET30a(+) was transformed into E. coli for His-tag protein expression (named as PET30A). PET30A was expressed in the soluble form and purified using high-affinity Ni-IDA resin.

2.5. Antiserum preparation and western blot analysis of MjSerp1 The purified rMjSerp1 was used as the antigen to produce polyclonal rabbit antiserum using a method described in an earlier study (Wang et al., 2009b). The western blot analysis has been previously described (Chen et al., 2011). Briefly, approximately 200 lg of the total proteins from the shrimp tissues was separated using SDS–PAGE and then transferred onto a nitrocellulose (NC) membrane. The NC membrane was incubated with MjSerp1-specific antiserum (1/100). After stringent washing with TBST (100 mM NaCl, 10 mM Tris–HCl, 0.02% Tween-20), goat anti-rabbit IgG peroxidase conjugates were used to detect the MjSerp1 polyclonal Abs. Ab binding was visualized by incubating the NC membrane with 4-chloro-1-naphthol (4-CIN) and H2O2.

Y.-R. Zhao et al. / Developmental and Comparative Immunology 44 (2014) 261–269

100 100

263

Fenneropenaeus chinensis ABC33916 Penaeus monodon ADC42878 Marsupenaeus japonicus BAI50776

71

Litopenaeus vannamei AGL39540

100 100

Penaeus monodon ADC42876

52

Penaeus monodon ADC42879 98

Paralithodes camtschaticus AEL22816 Pacifastacus leniusculus CAA57964

94

Tribolium castaneum XP 969846 Bombyx mori NP 001103823

100 100

Manduca sexta AAV91026 Bombyx mori AAF61252 Tachypleus tridentatus BAA03374

100 99

Tachypleus tridentatus BAA12795 Tribolium castaneum BAA06909 Marsupenaeus japonicas Serp1

85

Bos taurus XP 003584769

100 51

Equus caballus XP 001491416 Homo sapiens CAH73667.1

99 100

Rattus norvegicus AAH98686

0.1

Fig. 1. Phylogenetic analysis of MjSerp1 with serpins from other species. The NJ tree was constructed using MEGA 4. We performed 1000 bootstraps to determine the reproducibility of the results. MjSerp1 is underlined. The numbers on the branch represent the number of bootstraps, and the scale bar was used to measure the genetic distance.

Fig. 2. Tissue distribution and expression profiles of MjSerp1 in shrimp. (A) MjSerp1 tissue distribution in shrimp detected using semiquantitative RT-PCR (top panel) and western blot analysis (the third panel). The b-actin transcripts and protein were used as the controls for RT-PCR and western blot analysis. (B and C) Time course MjSerp1 expression in hepatopancreas after WSSV challenge (A) and after V. anguillarum challenge (B). Top panel: qRT-PCR; bottom panel: western blot analysis, b-actin was used as the loading control. D. Time course MjSerp1 expression in haemocytes after V. anguillarum challenge. 0 h represents the results of the unchallenged shrimp. Asterisks indicate significant differences (P < 0.05) and extremely significant differences (P < 0.01), determined using a t-test.

264

Y.-R. Zhao et al. / Developmental and Comparative Immunology 44 (2014) 261–269

cacodylate pH 7.0, 10 mM CaCl2). The collected hemocytes were homogenized in 200 ll of CAC buffer and then centrifuged at 10,000  g for 15 min at 4 °C. The separated supernatant was designated as the hemocyte lysate supernatant (HLS). The HLS protein concentration was quantified using a Bradford assay. Four tubes were used to test the prophenoloxidase inhibitory activity of rMjSerp1. Tube 1 (positive control) contained 70 lg of HLS mixed with 10 lg of LPS [1 mg/ml, from E. coli 0111:B4 (Sigma)]. Tube 2 contained 40 lg of rMjSerp1 mixed with 70 lg HLS and 10 lg of LPS (1 mg/ml). Tube 3 (blank control) contained 70 lg of HLS mixed with 30 ll of distilled water. Tube 4 (negative control) contained 40 lg of PET30A mixed with 70 lg of HLS and 10 lg of LPS (1 mg/ml). All tubes were adjusted to total volume of 80 ll. Then, 120 ll of L-Dopa (3 mg/ml in 50 mM sodium phosphate, pH 6.5) was added to the four tubes, which were maintained at room temperature (about 30 °C) for 15 min, and then the absorbance at 490 nm was measured using an ELX800 Universal Microplate Reader (Bio-Tek) to determine the PO activity. The tests were performed in triplicate and the results were subject to a t-test; differences with P < 0.05 were considered significant. 2.8. Microorganism binding assay

Fig. 3. Recombinant MjSerp1 did not inhibit PPO activation. (A) SDS–PAGE analysis of recombinant MjSerp1 expressed in E. coli. Lane M, molecular mass marker; lane 1, total proteins obtained through E. coli expression; lane 2, total proteins obtained through E. coli expression after IPTG induction; lane 3, purified recombinant MjSerp1. B. SDS–PAGE analysis of PET30A expressed in E. coli. Lane M, molecular mass marker; lane 4, total proteins obtained through E. coli expression; lane 5, total proteins obtained through E. coli expression after IPTG induction; lane 6, purified PET30A. (C) rMjSerp1 did not inhibit PPO activation. HLS provides the source of prophenoloxidase. LPS (10 lg) was used to stimulate PPO activation. rMjSerp1 (40 lg) was added to test the inhibitory ability. L-Dopa (360 lg) was used as the substrate. PET30A (40 lg) was used as the negative control. The experiment was performed in triplicate. Asterisks indicated significant differences (P < 0.05) which were determined using a t-test.

We chose six bacteria to perform this assay: three Gram-positive bacteria (Bacillus subtilis, B. megaterium, and Staphylococcus aureus), and three Gram-negative bacteria (E. coli, Klebsiella pneumoniae, and V. anguillarum). The microorganisms were cultured overnight at 37 °C in 5 ml of LB medium and centrifuged at 10,000  g for 3 min. The resulting pellets were washed twice with 1 ml of 1  PBS (0.14 M NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4). About 50 lg of recombinant MjSerp1 was incubated with these microorganisms (2  107 CFU) with gentle rotation at 37 °C for 1 h. After washing the microorganisms with 1  PBS, 100 ll of 7% SDS was used to elute the bacteria. Then, the bacteria were washed twice with 1  PBS. The elution and the final pelleted bacteria were analyzed using 12.5% SDS–PAGE. The result was demonstrated through western blot analysis. His-tagged PET30A protein was used as the negative control. Anti-Histidine antibody (ZSGB Bio, Beijing, China) was used as the primary antibody. Secondary antibody was the alkaline phosphatase-conjugated horse anti-mouse IgG (ZSGB Bio, Beijing, China). 2.9. Antibacterial activity assays

2.6. Expression profiles of MjSerp1 protein under western blot analysis Hepatopancreas were collected from shrimp challenged with V. anguillarum and WSSV at each time point (0, 2, 6, 12, 24, and 48 h), and then homogenized in a buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 3 mM EDTA and 1 mM PMSF) and centrifuged at 10,000  g for 10 min at 4 °C to collect the supernatant. The total protein concentration was determined using the Bradford method (Bradford, 1976). Each 1 mg/ml sample (20 ll) was analyzed on 12.5% SDS–PAGE. Finally, the proteins were transferred onto a NC membrane for western blot analysis.

2.7. Prophenoloxidase inhibition assay Phenoloxidase inhibition assays were performed according to an earlier study (Wang et al., 2011) with slight modifications. Hemolymph was extracted (15 ml) using a syringe preloaded icecold anticoagulant buffer (0.14 M NaCl, 0.1 M glucose, 30 mM trisodium citrate, 26 mM citric acid, and 10 mM EDTA, pH 4.6). The buffer:hemolymph ratio was 1:3. The hemolymph was centrifuged at 800  g for 10 min at 4 °C. The supernatant was discarded and the pellet was washed twice with CAC buffer (10 mM sodium

Three Gram-positive bacteria (B. subtilis, B. megaterium, and S. aureus), and the three Gram-negative bacteria (E. coli, K. pneumoniae, and V. anguillarum) were used for the rMjSerp1 antibacterial activity analysis according to a previously described method (Li et al., 2005). The purified protein was dialyzed overnight in 1  PBS and diluted to 1 mg/ml with dialysis buffer. His-tagged PET30A protein and dialysis buffer were used as negative controls. The purified protein, PET30A (40 lg each) and same volume of dialysis buffer were added to a 96-well polypropylene microtiter plate, and each well was inoculated with 140 ll of mid-log phase bacterial suspension (2  105 CFU to 7  105 CFU) in Poor Broth [1% tryptone, 0.5% NaCl (w/v), pH 7.5]. The cultures were incubated for 48 h at 28 °C and bacterial growth was evaluated by measuring the absorbance at 600 nm using an ELX800 Universal Microplate Reader (Bio-Tek Instruments, INC). 2.10. Protease inhibitory activity assay of rMjSerp1 The rMjSerp1 inhibitory assays were performed against three serine proteases, subtilisin A (Bacillus licheniformis, Sigma), and protease K (Tritirachium album, Merck) and a-chymotrypsin (type II bovine pancreas, Sigma). Each reaction mixture contained the

Y.-R. Zhao et al. / Developmental and Comparative Immunology 44 (2014) 261–269

265

Fig. 4. rMjSerp1 has antimicrobial and bacteria-binding activities. (A) Antibacterial activity of rMjSerp1. PET30A expressed in E. coli with empty pET30a (+) and dialysis buffer were used as negative controls. Asterisks indicate significant differences (P < 0.05) and extremely significant differences (P < 0.01 and P < 0.001), which were determined using a t-test. B. Bacteria-binding activity. The bacteria after 7% SDS elution (upper panel), and the elution from the six bacteria (bottom panel) were used in the analysis. PET30A was used as the negative control (data not show).

manmade substrate N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (AAPF) (Sigma) with subtilisin A, protease K, a-chymotrypsin, and rMjSerp1 at 6.5 lM in reaction buffer 1 (100 mM Tris–HCl, pH 8.0, 1 mM CaCl2). The protease was first incubated for 10 min with the inhibitor in reaction buffer 1 at 25 °C. Then, the substrate of each enzyme was added into each tube and incubated at 25 °C for another 5 min. Finally, the reaction was terminated with 50 ll of 50% acetic acid. The blank control group was performed by replacing the rMjSerp1 with reaction buffer 1. His-tagged PET30A protein was used as the negative control. The protease inhibition experiments were performed three times. The remaining enzyme activity (%) was measured at 405 nm using an ELX800 Universal Micro plate Reader (Bio-Tek Instruments, INC). B. subtilis, B. megaterium, S. aureus, E. coli, and V. anguillarum were used for the inhibitory assay of crude bacterial proteases. The assay was performed as previously reported with slight modifications (Wang et al., 2009b). The bacteria were cultured overnight in 3 ml of LB medium at 37 °C, and then precipitated by centrifugation at 10,000  g for 3 min. The resulting pellets were washed twice in reaction buffer 2 (10 mM NaCl, 100 mM Tris–HCl, pH 8.0) and centrifuged at 10,000  g for 5 min. The supernatant was collected and used as the secreted proteases from bacteria. First, 15 ll of the washed supernatant was incubated for 5 min with a final concentration of 6.5 lM rMjSerp1 at 37 °C. Then, 30 ll of 1% casein in reaction buffer 2 was added into the mixture and kept for 1 h at 37 °C in a final volume of 75 ll. The blank control group was performed by replacing the rMjSerp1 with reaction buffer 2. His-tagged PET30A protein was used as the negative control. Each reaction was stopped by adding 75 ll of 5% trichloroacetic acid (TCA) and the enzymatic activity was determined via the Folin phenol method (Classics Lowry et al., 1951). Each reaction was carried out in triplicate.

2.11. Bacterial clearance after rMjSerp1 injection The V. anguillarum cultured overnight was doubled washed with sterile 1  PBS and resuspended in buffer at 1  109 CFU. The shrimp were randomly divided into two groups with six shrimp each. Then, about 40 lg (1 mg/ml) of rMjSerp1 mixed with V. anguillarum at a final concentration of 2  107 CFU were injected into the experimental group and 40 lg (1 mg/ml) of PET30A mixed with V. anguillarum at a final concentration of 2  107 CFU were injected into another group as a negative control. At 30 min post injection, hemolymph (500 ll) was collected from both groups via the blood sinus (three shrimp for each sample) using a sterile syringe preloaded with 1 ml of anticoagulant buffer (340 mM sodium citrate, pH 7.0). After serial dilution with 1  PBS, the diluted hemolymph samples (50 ll) were plated onto 2216E agar plates (0.5% tryptone, 0.1% yeast extract, 0.1% FeCl3, 1.5% agar, and 2.4% seawater salt). The plates were cultures overnight at 37 °C and the number of monoclonal colonies on the plate was counted, and then the residual bacterial was calculated (Wang et al., 2009a). 2.12. In vivo RNAi assay MjSerp1 dsRNA was synthesized using a previously described method with minor modifications (Wang et al., 2012a). The MjSerp1 fragments were amplified with primers dsMjSerp1 Fi and dsMjSerp1 Ri (Table 1). After purifying the PCR product using a gel purification kit (BioTeke corporation, Beijing, China), the fragments were used as templates for dsRNA synthesis with an RNA interference (RNAi) kit from Fermentas (Thermo Fisher Scientific, USA). The green fluorescent protein gene (GFP) dsRNA was prepared the same way as the negative control using the primers

266

Y.-R. Zhao et al. / Developmental and Comparative Immunology 44 (2014) 261–269

includes a signal peptide and a characteristic serpin domain (GenBank accession number: KF873763). The protein has a theoretical molecular weight of 46.3 kDa and an isoelectric point of 5.51 (Fig. S1). MjSerp1 differed in sequence from other crustacean serpins (Fig. S2). Using the MEGA 4.0 software, a phylogenetic tree was constructed via the neighbor-joining method with serpins from different species (Fig. 1). The result shows that serpins could be divided into two groups. Group 1 contained serpins from insects and crustaceans, whereas group 2 contained the serpins from crustaceans and mammals. MjSerp1 was included into the second subgroup with mammalian serpins. 3.2. Expression of MjSerp1 was up-regulated by challenge of pathogens Semiquantitative RT-PCR and western blot analysis were performed to analyze the tissue distribution of MjSerp1. The results show that MjSerp1 is highly expressed in the hepatopancreas and intestines, moderate expressed in hemocytes, the gills, and the stomach, and not expressed in the heart (Fig. 2A). The expression patterns of MjSerp1 in hepatopancreas and hemocytes of shrimp challenged with WSSV or V. anguillarum were analyzed using real-time PCR and western blot analysis. In hepatopancreas, the MjSerp1 expression was induced by the V. anguillarum challenge, and was relatively highly expressed at 2 h and at 24 h post injection. Almost the same results were obtained in the western blot analysis (Fig. 2B). The MjSerp1 protein expression was also increased after the viral challenge (Fig. 2C). In hemocytes, the MjSerp1 expression was up-regulated at 2 h post V. anguillarum challenge (Fig. 2D). These data indicate that MjSerp1 participates in the innate immunity of shrimp. Fig. 5. rMjSerp1 has protease inhibitory activity. (A) rMjSerp1 inhibits bacteriasecreted protease. The remaining enzyme activity was measured at 405 nm using an ELX800 Universal Microplate Reader (Bio-Tek). The data were from three individual experiments. Asterisks indicate significant differences (P < 0.05) and extremely significant differences (P < 0.01), which were determined using a ttests. B. rMjSerp1 inhibits activity of subtilisin A and protease K. rMjSerp1 was first incubated with a-chymotrypsin, subtilisin A, and protease K, and then specific substrates (N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide or N-succinyl-Ala-Ala-Ala-pnitroanilide) were added into corresponding proteases. The remaining enzyme activity was measured at 405 nm using an ELX800 Universal Microplate Reader (Bio-Tek). His-tagged PET30A protein was used as the negative control. The experiment was repeated three times. Asterisks indicate extremely significant differences (P < 0.01), which were determined using a t-test.

dsGFP Fi and dsGFP Ri (Table 1). A total of 70 lg of MjSerp1 dsRNA and GFP dsRNA were injected separately into each shrimp (5–7 g). Then, total RNA was isolated from the hemocytes of the shrimp from the RNAi group and the control group after 24 h. The MjSerp1 transcripts were detected via RT-PCR to examine the effect of the RNAi. After the RNAi assay, a bacterial clearance assay was conducted using the MjSerp1-silenced shrimp. The shrimp (5–7 g) were divided into two groups with six shrimp each. Each shrimp in the first group was injected with 70 lg of MjSerp1 dsRNA, whereas 70 lg of GFP dsRNA was injected in the second group. At 24 h post injection, V. anguillarum (2  107 CFU per shrimp) were injected in the shrimp in both groups. At 30 min post-injection, hemolymph (500 ll) was collected from different shrimp and the residual bacteria were calculated as described above.

3.3. rMjSerp1 did not inhibit prophenoloxidase activation The recombinant protein was expressed and purified via His Bind resin chromatography (Fig. 3A). The prophenoloxidase inhibition assay of rMjSerp1 was performed using HLS as the source of zymogen (proPO), and LPS as the PPO activator. As shown in Fig. 3B, the prestimulation HLS significantly differed from the poststimulation HLS. Adding rMjSerp1 into the reaction system did not inhibit PPO activation. Therefore, rMjSerp1 cannot inhibit the PPO activation. 3.4. Antimicrobial activity of rMjSerp1 We performed an rMjSerp1 antimicrobial activity assay to study rMjSerp1 function further. The results show that rMjSerp1 has a wide antimicrobial spectrum (Fig. 4A). It inhibited the growth of all three Gram-positive bacteria tested (S. aureus, B. subtilis, and B. megaterium) and all three Gram-negative bacteria (E. coli, K. pneumoniae, and V. anguillarum). 3.5. rMjSerp1 binds to the six tested bacteria A microorganism binding assay was performed to determine whether MjSerp1 binds to bacteria. The results show that rMjSerp1 tightly binds to all the three Gram-positive bacteria and the three Gram-negative bacteria (Fig. 4 B).

3. Results

3.6. rMjSerp1 inhibits bacterial proteases

3.1. MjSerp1 is similar to mammalian serpins

The bacterial protease inhibitory activity of rMjSerp1 was further analyzed using proteases secreted by B. megaterium, S. aureus, E. coli, B. subtilis, and V. anguillarum. PET30A was used as the negative control. The results show that rMjSerp1 inhibits the proteases from B. megaterium, S. aureus, E. coli, B. subtilis, and V. anguillarum (Fig. 5A).

The MjSerp1 cDNA is 2185 bp long, and contains a complete 1239 bp open reading frame (ORF), as well as a 125 bp untranslated region at the 50 end and an 805 bp untranslated region at the 30 end. The MjSerp1 ORF encodes a 412–amino acid protein that

Y.-R. Zhao et al. / Developmental and Comparative Immunology 44 (2014) 261–269

267

Fig. 6. MjSerp1 enhances bacterial clearance in vivo. (A) Bacterial clearance in shrimp after rMjSerp1 injection (70 lg/shrimp) and PET30A was used as the control. (B) RNAi effect after dsMjSerp1 injection. dsGFP injection was used as the control. (C) Bacterial clearance analysis after MjSerp1 knockdown, dsGFP injection was used as the control. Asterisks indicate significant differences (P < 0.05) and extremely significant differences (P < 0.01 and P < 0.001), which were determined using a t-test.

3.7. rMjSerp1 inhibits subtilisin A and protease K The serine proteases inhibitory activity of rMjSerp1 was also investigated against chymotrypsin, subtilisin A, and protease K. rMjSerp1 exhibited stronger activity against subtilisin A and proteinase K, and did not inhibit chymotrypsin (Fig. 5B). The results show that rMjSerp1 inhibits some serine proteases. 3.8. rMjSerp1 facilitates V. anguillarum clearance in vivo To examine the effects of MjSerp1 in vivo, we performed a bacterial clearance assay after injecting rMjSerp1 and MjSerp1 knockdown. Fig. 6A shows that MjSerp1 injection significantly enhanced bacterial clearance compared with the control (PET30A injection). We further performed the RNAi of MjSerp1. The expression level of MjSerp1 was inhibited about 70% by the injection of dsMjSerp1 (Fig. 6B). After MjSerp1 knockdown, the bacteria were injected into the shrimp, and the result showed that bacterial clearance was significantly impaired compared with the control (dsGFP injection) (Fig. 6C). These results suggest that MjSerp1 facilitates in vivo V. anguillarum clearance. 4. Discussion Serpins are reportedly involved in regulating various physiologic processes, including hemolymph coagulation, proPO activation, and antimicrobial peptide synthesis (Molehin et al., 2012). In this study, we identified a serpin in kuruma shrimp, MjSerp1, and demonstrated its antibacterial activity and participation in the shrimp antibacterial response. Many serpins have been identified in insects and their functions been determined. Serpin-1 J from M. sexta inhibits proSpatzle-activating protease HP8 to regulate expression of antimicrobial hemolymph proteins (An et al., 2011). In Drosophila, Spn43Ac negatively

regulates the Toll signaling pathway (Levashina et al., 1999), Spn27A and Spn28Dc negatively regulate phenoloxidase (Nappi et al., 2005; Scherfer et al., 2008), and Spn77Ba regulates immune melanization in the respiratory system (Tang et al., 2008). Some serpins are also found in crustacean. For example, eight serpins have been identified in the tiger shrimp P. monodon, but only 3 have been functionally studied. PmSERPIN3 regulates the proPO activating system (Wetsaphan et al., 2013). Esserpin mediates immune responses possibly by inhibiting bacterial growth and regulating the prophenoloxidase-activating system in the Chinese mitten crab E. sinensis (Wang et al., 2013). In our study, we identified MjSerp1 from M. japonicus. It is not involved in activating the PPO system, but is involved as an effector molecule in the antimicrobial response and acts as a microbial serine protease inhibitor. MjSerp1 differs from other crustacean serpins. In the phylogenetic analysis, MjSerp1 was separated from other shrimp serpins and clustered with mammalian serpins. MjSerp1 is expressed mainly in the hepatopancreas and the intestines, the two major tissues that respond efficiently during immune challenges (Wang et al., 2011). Interestingly, the distribution of MjSerp1 differs from that of most other crustacean serpins, which are mainly expressed in hemocytes. For example, high levels of PtSerpin mRNA transcripts are present in the hemocytes and gills of the gazami crab Portunus trituberculatus (Wang et al., 2012b). In the Chinese white shrimp, F. chinensis, Fc-serpin mRNA transcripts are mainly detected in the hemocytes and the lymphoid organ (Liu et al., 2009). PmSERPIN6 transcripts are expressed in the lymphoid organ, hemocytes, the heart, and gills of the tiger shrimp P. monodon (Homvises et al., 2010), whereas PmSERPIN8 is expressed mainly in the hemocyte and the epipodite (Somnuk et al., 2012). The serpins are involved in immune responses of crustaceans against pathogens. In P. monodon, PmSERPIN8 expression is upregulated in response to V. harveyi at 24 h post-injection and to YHV at 48 h post-injection (Somnuk et al., 2012), whereas PmSERPINB3 is

268

Y.-R. Zhao et al. / Developmental and Comparative Immunology 44 (2014) 261–269

upregulated within 0–48 h after V. harveyi challenge (Somboonwiwat et al., 2006). Fc-serpin from F. chinensis is markedly upregulated at 24–72 h post bacterial infection and significantly upregulated at 8 h post WSSV infection (Liu et al., 2009). The Esserpin transcription levels in E. sinensis peaks at 3 h post V. anguillarum challenge (Wang et al., 2013). In our study, the MjSerp1 mRNA and protein expression levels were significantly upregulated at 2 h after Vibrio challenge and were gradually upregulated within 12–48 h after WSSV challenge (Fig. 2). These results suggest that MjSerp1 expression rapidly responds to bacterial challenge and plays a role in the early phase of bacterial infections. Most studies have shown that serpins inhibit serine proteases to block the PPO pathway, thereby regulating the proPO activating system. In M. sexta, serpin-5 inhibits proPO activation by inhibiting the activation of proHP8 and proPAP1 during immune responses (An and Kanost, 2010). In addition, serpin-3, an immune-inducible serpin in M. sexta, forms an SDS-stable complex with active hemolymph proteinase 8 in vitro to negatively regulate proPO activation (Christen et al., 2012). In P. monodon, PmSERPIN3 inhibits the in vitro activation of the shrimp prophenoloxidase system (Wetsaphan et al., 2013). However, in our study, MjSerp1 did not inhibit PO activity after PPO activation (Fig. 3B). This result implies that MjSerp1 exert its function through other pathways rather than the PPO pathway. MjSerp1 could function as a direct effector in regulating the antimicrobial immune system. Some serpins reportedly inhibit bacterial growth, such as the bacteriostatic effect of ranaserpin from R. grahami on the Gram-positive bacterium B. subtilis (Han et al., 2008), as well as the inhibitory effect of Esserpin from E. sinensis on the growth of the Gram-negative bacterium E. coli (Wang et al., 2013). PmSERPIN8 inhibits Gram-positive bacteria, but not Gram-negative bacteria (Somnuk et al., 2012). rMjSerp1 strongly inhibited both Gram-negative and Gram-positive bacteria (Fig. 4A). Further study indicated that MjSerp1 closely binds to different bacteria (Fig. 4B) and inhibits bacterial protease (Fig. 5A). The bacterial proteases are key components of invasive cocktails, required for entry into the host and rapid utilization of its constituent proteins (Christeller, 2005). Therefore, these results suggest a possible mechanism for the inhibitory activity of MjSerp1: MjSerp1 binds to bacteria and inhibits bacterial serine proteases, and ultimately interrupting bacterial growth. The exact mechanism of bacterial inhibition of MjSerp1 needs further study. MjSerp1 exhibits bacterial inhibitory activity in shrimp. In P. monodon, injecting rPmSERPIN3 into shrimp increased the total bacterial counts compared with the control group (Wetsaphan et al., 2013). However, our results show that rMjSerp1 injection increases bacterial clearance and MjSerp1 knockdown using RNAi decreases bacterial clearance. These results suggested that as a direct antibacterial effector, MjSerp1 could inhibit or kill the bacteria in vivo. After its expression was knockdown, the antibacterial activity of MjSerp1 was declined, and the bacterial clearance was decreased. In summary, MjSerp1, a new serine protease inhibitor, was identified from M. japonicus. It acts as bacterial protease inhibitor and exhibits antibacterial ability. It facilitates V. anguillarum clearance in vivo. Our findings provide new evidences for the serpin functions in shrimp immunity.

Acknowledgements This work was supported financially by the National Natural Science Foundation of China (Grant No. 31130056), National Basic Research Program of China (973 Program, Grant No. 2012CB114405), the Ph.D. Programs Foundation of the Ministry of Education of China (Grant No. 20110131130003), the Provincial

Natural Science Foundation of Shandong, China (Grant No. ZR2011CM014).

Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.dci.2014.01.002. References Amparyup, P., Charoensapsri, W., Tassanakajon, A., 2012. Prophenoloxidase system and its role in shrimp immune responses against major pathogens. Fish Shellfish Immunol. 34, 990–1001. An, C., Kanost, M.R., 2010. Manduca sexta serpin-5 regulates prophenoloxidase activation and the Toll signaling pathway by inhibiting hemolymph proteinase HP6. Insect Biochem. Mol. 40, 683–689. An, C., Ragan, E.J., Kanost, M.R., 2011. Serpin-1 splicing isoform J inhibits the proSpätzle-activating proteinase HP8 to regulate expression of antimicrobial hemolymph proteins in Manduca sexta. Dev. Comp. Immunol. 35, 135–141. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Chao, Y., Fan, C., Liang, Y., Gao, B., Zhang, S., 2012. A novel serpin with antithrombinlike activity in Branchiostoma japonicum: implications for the presence of a primitive coagulation system. PLoS ONE 7, e32392. Chen, A.-J., Wang, S., Zhao, X.-F., Yu, X.-Q., Wang, J.-X., 2011. Enzyme E2 from Chinese white shrimp inhibits replication of white spot syndrome virus and ubiquitinates its RING domain proteins. J. Virol. 85, 8069–8079. Christeller, J.T., 2005. Evolutionary mechanisms acting on proteinase inhibitor variability. FEBS J. 272, 5710–5722. Christen, J.M., Hiromasa, Y., An, C., Kanost, M.R., 2012. Identification of plasma proteinase complexes with serpin-3 in Manduca sexta. Insect Biochem. Mol. 42, 946–955. Classics Lowry, O., Rosebrough, N., Farr, A., Randall, R., 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265. Du, X.-J., Zhao, X.-F., Wang, J.-X., 2007. Molecular cloning and characterization of a lipopolysaccharide and b-1, 3-glucan binding protein from fleshy prawn (Fenneropenaeus chinensis). Mol. Immunol. 44, 1085–1094. Franssens, V., Simonet, G., Breugelmans, B., Van Soest, S., Van Hoef, V., Vanden Broeck, J., 2008. The role of hemocytes, serine protease inhibitors and pathogenassociated patterns in prophenoloxidase activation in the desert locust, Schistocerca gregaria. Peptides 29, 235–241. Garrett, M., Fullaondo, A., Troxler, L., Micklem, G., Gubb, D., 2009. Identification and analysis of serpin-family genes by homology and synteny across the 12 sequenced Drosophilid genomes. BMC Genom. 10, 489. Gatto, M., Iaccarino, L., Ghirardello, A., Bassi, N., Pontisso, P., Punzi, L., Shoenfeld, Y., Doria, A., 2013. Serpins, immunity and autoimmunity: old molecules, new functions. Clin. Rev. Allerg. Immu., 1–14. Gettins, P.G., 2002. Serpin structure, mechanism, and function. Chem. Rev. 102, 4751–4804. Han, Y., Yu, H., Yang, X., Rees, H.H., Liu, J., Lai, R., 2008. A serine proteinase inhibitor from frog eggs with bacteriostatic activity. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 149, 58–62. Homvises, T., Tassanakajon, A., Somboonwiwat, K., 2010. Penaeus monodon SERPIN, Pm SERPIN6, is implicated in the shrimp innate immunity. Fish Shellfish Immunol. 29, 890–898. Krüger, O., Ladewig, J., Köster, K., Ragg, H., 2002. Widespread occurrence of serpin genes with multiple reactive centre-containing exon cassettes in insects and nematodes. Gene 293, 97–105. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings in bioinformatics 5, 150–163. Laskowski Jr., M., Kato, I., 1980. Protein inhibitors of proteinases. Annu. Rev. Biochem. 49, 593–626. Levashina, E.A., Langley, E., Green, C., Gubb, D., Ashburner, M., Hoffmann, J.A., Reichhart, J.-M., 1999. Constitutive activation of toll-mediated antifungal defense in serpin-deficient Drosophila. Science 285, 1917–1919. Li, L., Wang, J.-X., Zhao, X.-F., Kang, C.-J., Liu, N., Xiang, J.-H., Li, F.-H., Sueda, S., Kondo, H., 2005. High level expression, purification, and characterization of the shrimp antimicrobial peptide, Ch-penaeidin, in Pichia pastoris. Protein Expr. Purif. 39, 144–151. Liu, Y., Li, F., Wang, B., Dong, B., Zhang, X., Xiang, J., 2009. A serpin from Chinese shrimp Fenneropenaeus chinensis is responsive to bacteria and WSSV challenge. Fish Shellfish Immunol. 26, 345–351. Molehin, A.J., Gobert, G.N., McMANUS, D.P., 2012. Serine protease inhibitors of parasitic helminths. Parasitol.-Cambridge 139, 681. Nappi, A., Frey, F., Carton, Y., 2005. Drosophila serpin 27A is a likely target for immune suppression of the blood cell-mediated melanotic encapsulation response. J. Insect Physiol. 51, 197–205. Scherfer, C., Tang, H., Kambris, Z., Lhocine, N., Hashimoto, C., Lemaitre, B., 2008. Drosophila Serpin-28D regulates hemolymph phenoloxidase activity and adult pigmentation. Dev. Biol. 323, 189–196.

Y.-R. Zhao et al. / Developmental and Comparative Immunology 44 (2014) 261–269 Silverman, G.A., Lomas, D.A., 2007. Molecular and Cellular Aspects of the Serpinopathies and Disorders in Serpin Activity. World Scientific Pub. Somboonwiwat, K., Supungul, P., Rimphanitchayakit, V., Aoki, T., Hirono, I., Tassanakajon, A., 2006. Differentially expressed genes in hemocytes of Vibrio harveyi-challenged shrimp Penaeus monodon. J. Biochem. Mol. Biol. 39, 26–36. Somnuk, S., Tassanakajon, A., Rimphanitchayakit, V., 2012. Gene expression and characterization of a serine proteinase inhibitor Pm SERPIN8 from the black tiger shrimp Penaeus monodon. Fish Shellfish Immunol. 33, 332–341. Suwanchaichinda, C., Kanost, M.R., 2009. The serpin gene family in Anopheles gambiae. Gene 442, 47–54. Tang, H., Kambris, Z., Lemaitre, B., Hashimoto, C., 2008. A serpin that regulates immune melanization in the respiratory system of Drosophila. Dev. Cell 15, 617–626. Wang, X.-W., Zhang, X.-W., Xu, W.-T., Zhao, X.-F., Wang, J.-X., 2009a. A novel C-type lectin (FcLec4) facilitates the clearance of Vibrio anguillarum in vivo in Chinese white shrimp. Dev. Comp. Immunol. 33, 1039–1047. Wang, Z.-H., Zhao, X.-F., Wang, J.-X., 2009b. Characterization, kinetics, and possible function of Kazal-type proteinase inhibitors of Chinese white shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol. 26, 885–897.

269

Wang, X.-W., Zhang, H.-W., Li, X., Zhao, X.-F., Wang, J.-X., 2011. Characterization of a C-type lectin (PcLec2) as an upstream detector in the prophenoloxidase activating system of red swamp crayfish. Fish Shellfish Immunol. 30, 241–247. Wang, S., Chen, A.-J., Shi, L.-J., Zhao, X.-F., Wang, J.-X., 2012a. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response. PLoS ONE 7, e30057. Wang, S., Cui, Z., Liu, Y., Li, Q., Song, C., 2012b. Identification and characterization of a serine protease inhibitor (PtSerpin) in the swimming crab Portunus trituberculatus. Fish Shellfish Immunol. 32, 544–550. Wang, L., Ma, Z., Yang, J., Gai, Y., Zhou, Z., Wang, L., Yue, F., Song, L., 2013. Identification and characterization of a serine protease inhibitor Esserpin from the Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 34, 1576– 1586. Wetsaphan, N., Rimphanitchayakit, V., Tassanakajon, A., Somboonwiwat, K., 2013. PmSERPIN3 from black tiger shrimp Penaeus monodon is capable of controlling the proPO system. Dev. Comp. Immunol. 41, 110–119. Zou, Z., Picheng, Z., Weng, H., Mita, K., Jiang, H., 2009. A comparative analysis of serpin genes in the silkworm genome. Genomics 93, 367–375.