Developmental and Comparative Immunology 43 (2014) 35–46

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Identification, characterization and functional analysis of a serine protease inhibitor (Lvserpin) from the Pacific white shrimp, Litopenaeus vannamei Yongjie Liu a, Fujun Hou a, Shulin He a, Zhaoying Qian a, Xianzong Wang a, Aitao Mao b, Chengbo Sun b, Xiaolin Liu a,⇑ a b

College of Animal Science and Technology, Northwest A&F University, Shaanxi Yangling 712100, China Fisheries College, Guangdong Ocean University, Guangdong Zhanjiang 524025, China

a r t i c l e

i n f o

Article history: Received 10 September 2013 Revised 24 October 2013 Accepted 25 October 2013 Available online 6 November 2013 Keywords: Litopenaeus vannamei Serpin RNA interference Prophenoloxidase Immunity

a b s t r a c t As important arthropod immune responses, prophenoloxidase (proPO) activation and Toll pathway initiation are mediated by serine proteinase cascades and regulated by serpins. Herein, a serine protease inhibitor (Lvserpin), encoding for 415 amino acids with calculated molecular weight of 46,639 Da and isoelectric point of 7.03 was characterized from the Pacific white shrimp Litopenaeus vannamei. Multiple sequence alignment revealed that Lvserpin shared the highest similarity with Penaeus monodon serpin6 (87%). Quantitative real-time PCR (qRT-PCR) results showed that the transcripts of Lvserpin were detected in all the examined tissues and most highly expressed in gill. The expression profiles of Lvserpin were greatly fluctuated upon infection of Vibrio anguillarum, Micrococcus lysoleikticus or White Spot Syndrome Virus (WSSV). Double stranded RNA-mediated suppression of Lvserpin resulted in a significant increase in the transcripts of two clip-domain serine proteinases (PPAE and PPAF), prophenoloxidase (proPO), antilipopolysaccharide factor (ALF), Crustin and penaeidin3 (Pens3) and also increased the high cumulative mortality post V. anguillarum injection. Besides, the recombinant Lvserpin protein (rLvserpin) was purified and exhibited inhibitory activity against trypsin. Also the rLvserpin showed inhibition on prophenoloxidase activation and bacterial growth. Hence, we proposed that the Lvserpin played important role in the shrimp innate immunity. Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction In recent years, with the enlargement of the cultivation scale, shrimp diseases have become increasingly prominent, and it has become a major bottleneck restricting of the development of aquaculture (Akira et al., 2006; Lightner, 2005). Lacking of adaptive immunity compel shrimp to defense against the invasion of pathogens depending on the innate immunity, which function through the cellular and humoral responses (Lee and Söderhäll, 2002; Li and Xiang, 2013a; Tassanakajon et al., 2013). Actually, hemolymph coagulation, complement activation, melanization, phagocytosis, encapsulation and synthesis of antimicrobial peptides involved in the two immune responses are mediated by serine proteinase cascades (Cerenius and Söderhäll, 2004; Jiravanichpaisal et al., 2006; Söderhäll et al., 2003). And yet, these activated proteinase cascades needed regulation by serine proteinase inhibitors (SPIs) to prevent the damage to the host (Kanost, 1999). At present, there are several families of SPIs in biological system, for instance, Kazal, ⇑ Corresponding author. Tel.: +86 029 87054333; fax: +86 029 87092164. E-mail addresses: [email protected], [email protected] (X. Liu). 0145-305X/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.dci.2013.10.012

Kunitz, Bowman-Birk, serpin, a-macroglobulin, etc. (Kanost, 1999; Rimphanitchayakit and Tassanakajon, 2010). Serpins acting as suicide-like substrates participate in the regulation process and irreversibly inhibit their specific target proteinases (Silverman et al., 2001). So far, they have been found in all groups of organisms only with the exception of fungi. Serpin encodes a protein of 400 amino acid residues in length with high molecular weight of 40–60 kDa. All of these proteins have a common structure folded by eight to nine alpha helices and three sets of beta sheets. The reactive center loop (RCL), core feature of serpins, is an exposed protein motif composed of about 20 amino acids located near C-terminus. This motif contains a scissile bond between two residues, called P1 and P10 , which is cleaved by the target proteinase (Wilczynska et al., 1995). The cleavage in the reactive site induces a large conformational change. Then a stable serpin-proteinase complex was formed and resulted in the inactivation of the protease activity. The P1 residue determines the primary selectivity of a serpin, as well as determines the target specificity (Huntington, 2011; Mangan et al., 2008). In insects, the serpins have been characterized biochemically and shown regulation on proPO activation or synthesis of

36

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

antimicrobial peptides (Kanost, 1999). Serpins in Aedes aegypti (Zou et al., 2010), Tenebrio molitor (Jiang et al., 2009; Park et al., 2011), Manduca sexta (Christen et al., 2012; Suwanchaichinda et al., 2013) and Drosophila melanogaster (Tang et al., 2008) have been found to be associated with innate immune system through the activation of prophenoloxidase (proPO). Regulation of the Toll pathway by serpins has also been observed in A. aegypti (Shin et al., 2006), T. molitor (Jiang et al., 2009; Park et al., 2011), M. sexta (An et al., 2010, 2011) and D. melanogaster (Ahmad et al., 2009). In D. melanogaster, serpin-28D controls the activation of prophenoloxidase (Scherfer et al., 2008). Serpin-27A functions as a negative inhibitor of proPO activation by inhibiting the proPO activating enzyme (PPAE) (Nappi et al., 2005). In M. sexta, serpin-3 blocks proPO activation by inhibiting PAP-1 and PAP-3 in the hemolymph (Christen et al., 2012). Serpin-5 appears to negatively regulate expression of antimicrobial peptide genes by inhibiting the proteinase HP6 (Tong and Kanost, 2005). Furthermore, three novel serpins (SPN40, SPN55 and SPN48) from the hemolymph of T. molitor block the Toll signaling cascade by making specific serpin-serine protease pairs (Jiang et al., 2009). Within crustaceans a diverse range of serpins have been identified, including Pacifastacus leniusculus (Liang and Söderhäll, 1995), Penaeus monodon (Homvises et al., 2010), Fenneropenaeus chinesis (Liu et al., 2009), Marsupenaeus japonicas, Eriocheir sinensis (Wang et al., 2013), Scylla paramamosain (Chen et al., 2010) and Portunus trituberculatus (Wang et al., 2012b). In S. paramamosain, Spserpin was found to be up-regulated in response to lipopolysaccharide challenge (Chen et al., 2010). EsSerpin identified from hemocyte of E. sinensis were reported have the ability on inhibition of bacterial growth and regulation of prophenoloxidase-activating system (Wang et al., 2013). The first Penaeidea shrimp serpin was reported in P. monodon, called PmserpinB3, and its transcript was found to be up-regulated upon bacterial infection (Somboonwiwat et al., 2006). To date, 8 different serpin genes had been identified from P. monodon. Among them, Pmserpin3 and Pmserpin8 showed inhibition on prophenoloxidase system (Somnuk et al., 2012; Wetsaphan et al., 2013). Moreover, Fcserpin, identified from F. chinensis, exhibited the function to defense against invading pathogens (Liu et al., 2009). In view of the important functions of serpins, a novel serpin, namely Lvserpin, was identified from Litopenaeus vannamei. The tissue expression pattern and temporal response after injection with different pathogens were investigated. The function of Lvserpin in regulating the transcription of proPO-AS related genes and Toll pathway dependent AMPs were investigated by dsRNA-mediated RNA interference. Besides, Lvserpin was expressed in Escherichia coli, and the purified rLvserpin was used for the investigation on inhibition of proteinase activity, bacterial growth and prophenoloxidase activation.

2. Materials and methods 2.1. Shrimp and immune challenge The Pacific white shrimp, L. vannamei (average body mass of 10–15 g) were obtained from Hengxing Company in Guangdong province, China, and acclimatized in tanks for a week before processing. The salinity (30‰) and temperature (24–28 °C) were maintained at normal levels, and the shrimps were fed with commercial diet at 5% of body weight every day. For tissue distribution analysis, samples of hemocytes, gill, hepatopancreas, eyestalk, stomach, muscle, intestine, nerve, heart and testis were collected. For the challenge experiment, three pathogens were selected: Vibrio anguillarum, Micrococcus lysoleikticus and White Spot Syndrome Virus (WSSV). The bacterial

challenge group was injected with 20 ll of live V. anguillarum (4  108 CFU/ml) or M. lysoleikticu (4  1010 CFU/ml) suspended in Phosphate Buffered Saline (PBS), respectively. The WSSV challenge group was performed by injection into the last abdominal segment of 20 ll tissue suspension prepared from WSSV-infected shrimp. Both the control groups were injected with equal volume sterilized PBS. Then, hemolymph from three shrimps of bacterial challenge group and control group was collected at 0, 2, 6, 12, 24, and 48 h post injection (hpi). For WSSV challenge group, the hemolymph from three shrimps was collected at 0, 2, 6, 12, 24, 48 and 72 hpi, The shrimp hemolymph was collected into a sterilized syringe with an equal volume of anticoagulant modified Alsever solution (27 mM sodium citrate, 336 mM NaCl, 115 mM glucose, 9 mM EDTA, pH 7.0), and centrifuged (800g at 4 °C for 10 min) immediately to collect hemocytes (Rodriguez et al., 1995). All the samples were preserved in liquid nitrogen immediately for RNA extraction. 2.2. Production of dsRNA Preparation of dsRNA was done in vitro using T7 RiboMAX Express (Promega, USA) following the manufacturer’s instructions. Briefly, T7 promoter was incorporated to gene specific primers at the 50 terminus (Table 1) to produce sense and anti-sense strand separately. PCR products were purified, quantified and transcribed to yield single stranded RNAs. Equal amount of single stranded RNAs were mixed together and annealed to produce double stranded RNA which are further purified and quantified for RNA interference experiment. Then, ten microgram (1 lg/g shrimp) of dsRNA for Lvserpin or LvEGFP gene were injected to shrimp and hemocytes was collected from 0, 24, 36 and 48 hpi. Moreover, PBS was also injected to serve as control. 2.3. Total RNA extraction and first-strand cDNA synthesis Total RNA was extracted from selected tissues with Trizol Reagent (Invitrogen, USA) as described in the manufacturer’s protocol. The quality of RNA was verified on 1% agarose gels. Also, RNA concentration was determined by measuring the absorbance at 260 nm with a UV-spectrometer (Bio-Rad, USA). Then, 500 ng of the obtained RNA was used to synthesize cDNA using the PrimeScriptÒ RT Reagent Kit with gDNA Eraser (TaKaRa, Japan) in accordance with the manufacturer’s instructions. 2.4. Identification of Lvserpin cDNA sequence According to the full-length cDNA sequence of Pmserpin6 (GeneBank accession number: GQ260129.1), sequence specific primers (Ser-F; Ser-R) were designed to amplify the Open Reading Frame (ORF) (Table 1). The amplification reaction was run as follows: 95 °C for 5 min; 38 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; followed by a final extension at 72 °C for 10 min. The purified PCR products were cloned into the pUC-18T vector (CWBIO, China), then, transformed into the competent cells of E. coli DH5a. The potentially positive recombinant clones were identified by colony PCR. Then, the positive recombinants were picked for sequencing. 2.5. Bioinformatics analysis The BLAST program (http://blast.ncbi.nlm.nih.gov/Blast) was used to analyze the nucleotide sequences. Multiple sequence alignments were created using the ClustalW2 (http://www.ebi.ac.uk/ Tools/msa/clustalw2/). The protein domains were predicted by Simple Modular Architecture Research Tool (SMART) (http:// smart.emblheidelberg.de/). Signal peptide and nuclear localization

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

37

Table 1 Sequences of primers used in this research. Primer

Objective

Tm (°C)

Sequence (50 –30 )

Ser-F Ser-R S-F S-R T7Ser-F Ser-R Ser-F T7Ser-R T7EGFP-F EGFP-R EGFP-F T7EGFP-R St-F St-R proPO-F proPO-R PPAE-F PPAE-R PPAF-F PPAF-R ALF-F ALF-R Crus-F Crus-R Pens3-F Pens3-R Actin-F Actin-R

ORF amplification

55

Protein expression

66

CAGACATGAGGCTCCTGGTAG TACAAGCCCTCCCTTATCCCG CGGGGTACCCAGTGCTTTTCGGAGCGGGAC (KpnI, italic) CGCGGATCCCTACGCCTTGGCCTTCGTGG (BamHI, italic) TAATACGACTCACTATAGGGAGACAAAGGCAGGATCGACCAGA (T7promoter sequence, italic) GTGACATTCAGCAGAGGACCAA CAAAGGCAGGATCGACCAGA TAATACGACTCACTATAGGGAGAGTGACATTCAGCAGAGGACCAA(T7promoter sequence, italic) TAATACGACTCACTATAGGGAGAGTGCCCATCCTGGTCGAGCT (T7promoter sequence, italic) TGCACGCTGCCGTCCTCGAT GTGCCCATCCTGGTCGAGCT TAATACGACTCACTATAGGGAGATGCACGCTGCCGTCCTCGAT (T7promoter sequence, italic) TTCTACGCTACGTCTCAGAACAGC CCTCAGTGGGAAGGAAAACAAA CATAGAACACGGCCCTGAG AATGTCGTACCTGGCGATAAT CACGGGCAACAGGAGAAAC CGGCAGATTTGGAATGAGGA GCAAGAGGAACTCGCAAGGCTTC CGGCTGTGAGAACGATGGATGGA CGCTTCACCGTCAAACCTTAC GCCACCGCTTAGCATCTTGTT GGTGTTGGTGGTGGTTTCCC CAGTCGCTTGTGCCAGTTCC ATACCCAGGCCACCACCCTT TGACAGCAACGCCCTAACC CACGAGACCACCTACAACTCCATC TCCTGCTTGCTGATCCACATCTG

65 Serpin-dsRNA

EGFP-dsRNA

65

Real-time RT-PCR

60

Real-time RT-PCR

60

Real-time RT-PCR

60

Real-time RT-PCR

60

Real-time RT-PCR

60

Real-time RT-PCR

60

Real-time RT-PCR Real-time RT-PCR

60 60

signals (NLS) were predicted using signal 3.0 prediction (http:// www.cbs.dtu.dk/services/SignalP/) and NLS prediction programs (http://cubic.bioc.columbia.edu/cgi/var/nair). The phylogenetic tree was constructed using MEGA version 5.0 by the neighbor-joining method based on the serpin amino acid sequence distances and was tested for reliability using 1000 bootstrap replications. 2.6. Tissue distribution and temporal expression profile of Lvserpin The mRNA expression of Lvserpin transcripts in various tissues and temporal expression of Lvserpin transcripts in hemocytes after pathogens challenged were determined by quantitative real-time PCR (qRT-PCR). Sequence-specific primers, St-F, St-R (Table 1) were designed to amplify a product of 190 bp. The b-actin, amplified with primers Actin-F and Actin-R (Table 1) was used as an internal reference gene. The qRT-PCR was carried out in a total volume of 20 ll, containing 10 ll SYBR Green Super mix (CWBIO, China), 2 ll of diluted cDNA, 0.4 ll of each primer (10 pmol/ll) and 7.2 ll nuclease-free water. The PCR program was 95 °C for 10 min, followed by 38 cycles of 95 °C for 15 s, 60 °C for 1 min. To verify the amplification of a single product, dissociation curve analysis was performed at the end of each PCR reaction. The relative expression to controls was determined by the 2DDCT method (Livak and Schmittgen, 2001). All data represented means ± standard deviation and were subjected to a one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test using the SPSS 16.0 program. Differences were considered statistically significant at P < 0.05. 2.7. Genes expression in hemocytes after knocked-down Lvserpin and V. anguillarum challenge At 48 hpi of dsRNA for Lvserpin or LvEGFP and PBS, shrimps of the three groups were challenged with V. anguillarum. Then the hemocytes was collected at 2, 6 and 12 hpi and used for further experiment. The transcripts level of two clip-domain serine proteinases (clip-SPs), PPAE (JX644452), PPAF (JX644454) and prophenoloxidase (proPO, AY723296) and three antimicrobial peptide

genes, anti-lipopolysaccharide factor (ALF, DQ208705), Crustin (Crustin, AY488497) and Penaeidin3 (Pens3, Y14926) were analyzed by the qRT-PCR. 2.8. Recombinant plasmid construction, expression and purification The mature peptide of Lvserpin was amplified with the specific primers (Table 1), which were with the restriction sites of KpnI and BamHI added to the 50 end of the forward and reverse primers, respectively. The PCR product was gel-purified and digested with KpnI and BamHI, then, cloned into the pET32a vector which was cut with the same restriction enzymes. After being confirmed by restriction enzyme and sequencing, both the pET32a vector plasmid and the recombinant plasmid were transformed into the E. coli BL21 pLysS (DE3) strain for protein expression. The recombinant and control plasmids were incubated at 37 °C until the OD600 was 0.6–0.8, then isoprophyl-b-D-thiogalactoside (IPTG) was added to the final concentration of 0.1 mM for additional 18 h incubation at 16 °C. The harvested cells were resuspended in ice cooled PBS (pH 7.4), and sonicated for 30 min on ice. The supernatant was collected by centrifugation at 14,100g for 10 min at 4 °C and used for further purification. The recombinant protein was purified with 6  His-Tagged Protein Purification Kit (CWBIO, China). Briefly, the supernatant was loaded onto a Ni2+-chelating column chromatography which had been previously equilibrated with the binding buffer (20 mM Tris–HCl, 500 mM NaCl and 10 mM imidazole, pH 8.0). Then, the recombinant Lvserpin protein (rLvserpin) and the recombinant thioredoxin (rTrx) were eluted with the elution buffer (20 mM Tris– HCl, 500 mM NaCl and 500 mM imidazole, pH 8.0). Subsequently, the purified protein was analyzed by 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). 2.9. Proteinase activity inhibitory assay The inhibitory activity of the rLvserpin against proteinase trypsin (bovine pancreas, Sigma) and chymotrypsin (bovine pancreas, Sigma) was performed by the reported method with slight modifi-

38

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

cation (Jitvaropas et al., 2009). The proteinases (5 nM trypsin or 3 nM chymotrypsin) were prepared in 50 mM Tris–HCl pH 8.0, and separately incubated with increasing concentration of inhibitor (0, 25.3, 50.6, 101.2, 202.4, 404.8, 809.6 nM) in the buffer. Then the remaining activity was determined by addition of chromogenic substrate, in which 293.6 lM N-benzoyl-Phe-Val-Arg-p-nitroanilide (Sigma) or 147.3 lM N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (Sigma) were used as substrates for trypsin and chymotrypsin, respectively. The reaction mixture was incubated at 30 °C for 15 min and the absorbance of mixture was determined at 405 nm using an iMark Microplate Reader (Bio-Rad, USA). The control reaction was performed using rTrx (1 mM) instead of rLvserpin. All reactions were done in triplicate. 2.10. Bacterial growth inhibitory assay Involvement of the rLvserpin on bacterial growth was processed following the procedure by Han et al. (2008). A gram-positive bacterium, M. lysoleikticus and a gram-negative bacterium, V. anguillarum were grown overnight at 37 °C in LB and 2216E culture media (1.5% agar, 0.5% Tryptone, 0.1% Yeast extract, 0.01‰ Ferric phosphate, aged seawater, pH 7.8), respectively. The cultures were

diluted 100-folds with respective culture media. Then, the culture was grown at 37 °C for M. lysoleikticus, 28 °C for V. anguillarum in a shaking incubator in the presence of 4 and 8 lM of rLvserpin. The rTrx protein (10 lM) was added as a control. The bacterial growth was monitored by measuring the optical density at 595 nm with an iMark Microplate Reader (Bio-Rad, USA) at various times from 0 to 12 h. 2.11. Prophenoloxidase inhibitory assay Inhibition of prophenoloxidase system was processed using a method modified from Somnuk et al. (2012). The hemocytes were separated from the hemolymph by centrifugation at 800g for 10 min at 4 °C. Then, hemocyte pellet was washed with CAC buffer (10 mM sodium cacodylate, 10 mM CaCl2 pH 7.0) and homogenized in 500 ll CAC buffer for the preparation of shrimp hemocyte lysate supernatant (HLS). The HLS was separated by centrifugation at 12,000 rpm for 10 min at 4 °C. The protein concentration of HLS was determined using Bradford assay. Appropriate amount of HLS (about 270 lg protein) was used in the proPO inhibitory activity assay. Then the rLvserpin was added to the final concentrations of 2.1 and 4.8 lM in the final volume of

Fig. 1. The nucleotide and deduced amino acid sequences of Lvserpin in L. vannamei (GenBank accession No. KC529336). The start codon (ATG) is boxed, and the stop codon (TAG) is indicated with an asterisk. The putative signal peptide is underlined. The serpin domain is shadowed. The hinge region is double-underlined, and the serpin signature is shown with a dotted line.

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

85 ll adjusted with CAC buffer. The proPO reaction was activated by adding 40 ll of 1 mg/ml lipopolysaccharide (LPS) from E. coli 0111:B4 (Sigma, USA) and incubated at room temperature for 5 min. Twenty-five microliters of 3 mg/ml L-3,4-dihydroxyphenyl-

39

alanine (L-DOPA) (Sigma, USA) was added to start the reaction and the PO activity was monitored at 490 nm using a iMark Microplate Reader (Bio-Rad, USA) every 10 min for the duration of 1 h. Phenylthiourea (PTU) (Sigma, USA), was added instead of rLvserpin to

Fig. 2. Multiple alignments of Lvserpin (AGL39540.1) with other known serpins. GenBank accession numbers for these amino acid sequences are as follows: Pm-serpinB3 (ADC42877.1); Ms-serpin6 (AAV91026.1); Bm-serpin6 (ABV74209.1); Pl-serpin (CAA57964.1); Pm-serpin8 (ADC42879.1); Pm-serpin6 (ADC42876.1); Mj-serpin (BAI50776.1); Fc-serpin (ABC33916.1) and Pm-serpin7 (ADC42878.1). Residues highlighted in black were identical and those in dark gray were similar. The characteristic domains of Lvserpin are boxed and named on the domain.

40

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

the final concentration of 6.8 lM for the positive inhibition control. The rTrx (10 lM) was also added to the reaction mixture for a control.

relationship to Pmserpin6, and with Pmserpin7, Pmserpin8 and M. japonicas serpin were all clustered in the same group as the F. chinensis serpin, with a putative serpin from P. leniusculus as slightly more distant (Fig. A).

3. Results 3.1. cDNA cloning and characterization of Lvserpin

3.3. Tissue expression of Lvserpin

Based on the sequence specific primers (Table 1), a 1284 bp fragment was amplified. Sequence analysis of the product from L. vannamei confirmed that it contained a 5 bp 50 UTR, a 1248 bp open reading frame (ORF) coding for a 415 aa protein and a 30 UTR of 31 bp (Fig. 1). Blastx analysis showed that the cDNA sequence had significant homology to the P. monodon serpin6. Analysis of the deduced amino acid sequence revealed that it had a calculated molecular weight of 46,639 Da and isoelectric point of 7.03. SignalP software analysis revealed that the deduced protein contained a putative signal peptide of 19 amino acids. The SMART indicated that a serpin domain (position 44-410nt) was found in the deduced amino acid sequence of Lvserpin (Evalue = 1.24e97). The highly conserved hinge region (356EEGTEAAAAT365) was existed at the N-terminal of the reactive center loop and near its C-terminus, a serpin signature sequence (383FHCTRPFLFLI393) was located (Fig. 2). Serpins that act as proteinase inhibitors are cleaved at the peptide bond between P1 and P10 amino acid residues by the target proteinase and the P1 residue determine the target specificity of the serpin to proteinase. According to the multiple alignment of amino acid sequence, the putative P1 residues of Lvserpin represented for arginine (Arg), which was in accordance with Pmserpin6 and Msserpin-6 (Homvises et al., 2010; Wang and Jiang, 2004).

The quantitative real-time PCR was employed in this experiment to determine the Lvserpin gene expression in shrimp tissues, such as hemocytes, gill, hepatopancreas, eyestalk, stomach, muscle, intestine, nerve, heart and testis. The b-actin gene was used as an internal control. The qRT-PCR analysis revealed that the Lvserpin transcripts were expressed in all the selected tissues, most highly expressed in gill, moderately expressed in hemocytes, heart, intestine, stomach, testis, muscle, eyestalk, and lesser expressed in nerve and hepatopancreas (Fig. 3).

3.2. Sequence comparison and phylogenetic analysis The pairwise alignment showed that Lvserpin is most similar to P. monodon serpin6 (87%), which was most expressed in lymphoid organ. The serpins from M. japonicas (63%), F. chinensis (61%), P. monodon serpin8 (62%) and serpin7 (60%) were related to Lvserpin to the same extent. Moreover, Lvserpin was 36% identical to Msserpin-6, which was previously characterized as a regulator of the prophenoloxidase system. A phylogenetic tree based on the amino acid sequences of 26 serpins from varieties of species, including crustaceans, insects, birds, bony fishes, mammals, amphibians, cyclostomata and trematoda was constructed using the neighbor-joining distance method. The distance tree showed that Lvserpin had closest genetic

Fig. 3. Tissue distribution of Lvserpin transcripts in selected 10 tissues detected by quantitative real-time PCR. The relative change in fold-expression was calculated by the 2DDCT method using b-actin as a reference gene. Vertical bars are presented as mean ± SD (N = 6) and are derived from six different shrimps. Significant differences were indicated with different letters at P < 0.05.

Fig. 4. Temporal expression analysis of Lvserpin in hemocytes after V. anguillarum, M. lysoleikticus and WSSV challenge by quantitative real-time PCR. The change in fold-expression was calculated by the 2DDCT method using b-actin as a reference gene. Data are presented as the mean ± SD (N = 3) and are derived from three different shrimps. (A) Transcriptional regulation of Lvserpin challenged by V. anguillarum. (B) Transcriptional regulation of Lvserpin challenged by M. lysoleikticus. (C) Transcriptional regulation of Lvserpin challenged by WSSV. Significant difference compared to the control group is marked with an asterisk at P < 0.05.

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

3.4. Expression of Lvserpin in response to pathogenic infection To determine whether the expression of Lvserpin gene was influenced by pathogenic infection, shrimps were challenged with V. anguillarum, M. lysoleikticus and WSSV, respectively. The hemocytes were collected at different time points from pathogens challenged shrimps for the qRT-PCR analysis. For V. anguillarum

41

challenge, the expression of Lvserpin was significantly increased and reached a peak at 6 hpi (compared to the blank group, P < 0.05). Then, the expression level was decreased at 12 hpi (P < 0.05) and dropped back to the original level at 24 hpi (Fig. 4A). In M. lysoleikticus, the expression of Lvserpin increased markedly at 2 hpi (P < 0.05), and then declined significantly to the bottom at 6 hpi compared with the blank (0 h) and control

Fig. 5. Silencing of Lvserpin increased the expression of selected genes post V. anguillarum injection. Temporal expression of (A) Lvserpin, (B) PPAE, (C) PPAF, (D) proPO, (E) ALF, (F) Crustin and (G) Pens3 were analyzed by quantitative real-time PCR. The LvEGFP dsRNA group and PBS group challenged with V. anguillarum were used as control. The change in fold-expression was calculated by the 2DDCT method using b-actin as a reference gene. Data are presented as the mean ± SD (N = 3) and are derived from three different shrimps. Significant difference compared to the control group is marked with an asterisk at P < 0.05.

42

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

(6 h, control) (P < 0.05). However, interesting is that the expression of Lvserpin was increased and returned to the normal levels at 12 hpi, and reached a second peak at 48 hpi (P < 0.05) (Fig. 4B). In the WSSV challenged group, the expression of Lvserpin was fluctuated, but no significant change was found before 48 h. At 48 hpi, the expression level was up-regulated and reached the highest in the whole experimental stage of WSSV challenge (P < 0.05). Although a gentle decrease was detected at 72 hpi (P < 0.05), there was still a significant difference compared with the control group (Fig. 4C).

3.8. Suppression of Lvserpin led to increased mortality after challenge with V. anguillarum As shown in Fig. 6, the cumulative mortality of Lvserpin dsRNA group injected with V. anguillarum was remarkably increased compared to the PBS group or the LvEGFP dsRNA group injected with V. anguillarumin (P < 0.05). The final mortality of the Lvserpin dsRNA group, the LvEGFP dsRNA group and the PBS group reached 78.0%, 38.0% and 36.7%, respectively.

3.5. Knock-down of Lvserpin by RNA interference in vivo

3.9. Recombinant expression and purification of Lvserpin

To further characterize the role of Lvserpin in the immune system of shrimp, a dsRNA-mediate RNA interference assay was processed. Ten microgram of Lvserpin dsRNA (1 lg/g shrimp) was intramuscularly injected into shrimp. A significant reduction of Lvserpin expression was detected at 24 hpi (P < 0.05), and the silencing efficiency of Lvserpin reached more than 80% at 48 hpi (P < 0.05). However, the expression of Lvserpin was not affected by LvEGFP dsRNA or PBS injection (Fig. 5).

In order to study the inhibition of Lvserpin on proteinase activity, bacterial growth and proPO system, the rLvserpin was IPTG-induced to express in an E. coli expression system. In this study, the recombinant protein was expressed as soluble protein, and purified with a commercial kit. The purified protein was analyzed on 12% SDS–PAGE, and an apparent 67 kDa target protein band was visualized, which is closed to the size of calculated molecular mass

3.6. Suppression of Lvserpin increased the transcription of PPAE, PPAF and proPO after challenge with V. anguillarum In this RNAi experiment, PPAE, PPAF and proPO were selected for further detection. As shown in Fig. 5, the expression of PPAE, PPAF and proPO in Lvserpin dsRNA group were all increased dramatically compared to the PBS group or the LvEGFP dsRNA group at 6 h and 12 h post V. anguillarumin injection (P < 0.05). For the proPO gene, though a visibly decrease was detected at 12 hpi (P < 0.05), there was still a significant difference compared to the control groups. 3.7. Suppression of Lvserpin increased the transcription of ALF, Crustin and Pens3 after challenge with V. anguillarum Transcriptions of three antimicrobial peptide genes, ALF, Crustin and Pens3 in Lvserpin dsRNA group were measured post V. anguillarum injection. Quantitative RT-PCR results showed that the relative expression of ALF was significantly increased at 2 hpi and reached the peak at 6 hpi (P < 0.05). While the expression of Crustin and Pens3 were remarkably increased at 6 hpi (P < 0.05). Unexpectedly, at 12 hpi, a visibly reduce of the expression of ALF, Crustin and Pens3 was detected comparing to the expression at 6 hpi (P < 0.05) (Fig. 5).

Fig. 6. Cumulative mortalities of Lvserpin silenced shrimp challenged with V. anguillarum. Mortality was measured in each experimental group (n = 30) and was recorded every 6 h post-injection. The Pearson’s chi-square test was used to compare different cumulative mortality. Significant differences in shrimp mortality are marked with asterisks.

Fig. 7. Recombinant expression and purification of thioredoxin and Lvserpin. (A) SDS–PAGE of Lvserpin. Lane 1, the induced Lvserpin-pET32a; lane 2, the purified recombinant Lvserpin protein; land M, protein marker. (B) SDS–PAGE of thioredoxin. Lane 1, the induced recombinant thioredoxin protein; lane 2, the purified recombinant thioredoxin protein; land M, protein marker.

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

Fig. 8. Proteinase inhibitory activity of rLvserpin against trypsin and chymotrypsin. Different concentrations (0–900 nM) of rLvserpin were incubated with trypsin (5 nM) or chymotrypsin (3 nM) and appropriate chromogenic substrates for 15 min. The remaining activity of proteinase was recorded by measuring the absorbance at 405 nm. The results are means of three replicates ± SD.

of rLvserpin protein (Fig. 7A). Meanwhile, a unique product representing for rTrx was visualized (Fig. 7B).

43

Fig. 10. Inhibition of prophenoloxidase system by rLvserpin. The hemocyte lysate supernatant (HLS) was added the rLvserpin to the final concentrations of 2.1 lM (j) and 4.8 lM (N). The rTrx protein of 10 lM () was added instead in the positive control. The negative control was added PTU to the final concentration of 6.8 lM (d). The experiment was done in triplicate. The results are means with standard deviation. Significant differences compared to the control group are marked with asterisks at P < 0.05.

3.12. Inhibition of prophenoloxidase activation 3.10. Proteinase activity inhibition To study the inhibitory activity of the recombinant Lvserpin protein, a dose-dependent test of rLvserpin against trypsin and chymotrypsin was performed. The result revealed that the rLvserpin could inhibit trypsin activity but did not inhibit chymotrypsin. And the proteinase activity of trypsin could even be more completely inhibited with increasing concentration of rLvserpin (Fig. 8). As a control, the rTrx showed no influence on both trypsin and chymotrypsin (data not shown).

3.11. Bacterial growth inhibition A Gram-positive bacterium, M. lysoleikticus and a gram-negative bacterium, V. anguillarum were chosen to investigate the inhibition of rLvserpin on bacterial growth. The optical density at 595 nm was measured to monitor the growth of bacterium. Results showed that the growth of V. anguillarum was markedly decreased in the presence of 4 and 8 lM rLvserpin compared with the control (Fig. 9) while that of M. lysoleikticus was not affected by the rLvserpin (data not shown). Moreover, the growth inhibition effect on V. anguillarum was also dose dependent.

Fig. 9. Growth of V. anguillarum in the presence of rLvserpin. The rLvserpin was added into the culture to the final concentration of 4 lM (j) and 8 lM (N). The rTrx protein of 10 lM () was added as a control. The growth was monitored by measuring the optical density at 595 nm. The experiment was done in triplicate. Significant differences compared to the control group are marked with asterisks at P < 0.05.

As previously reported, the serpins were involved in regulating the activation of prophenoloxidase (proPO) system. In this present experiment, the involvement of Lvserpin in regulating the proPO activating system was verified by measuring the activity of phenoloxidase (PO) in the LPS-induced hemocyte lysate supernatant (HLS) in the presence of rLvserpin. The reaction was started by adding L-DOPA and the absorbance at 490 nm was measured at various times. At final concentrations of 2.1 and 4.8 lM, the rLvserpin was found to inhibit the activation of shrimp prophenoloxidase cascade by about 51–65% at 60 min reaction time point as compared to the control (Fig. 10). Therefore, the Lvserpin might have an important regulatory function in the shrimp prophenoloxidase system.

4. Discussion For invertebrates, lacking an adaptive immune system compel them to defense against pathogens depending on the innate immune response (Ghosh et al., 2011; Lee and Söderhäll, 2002). The Toll pathway and proPO activation system involved in the innate immune system could be activated to synthetize some antimicrobial peptides and melanin in the presence of proteinases (Amparyup et al., 2013; An and Kanost, 2010; Li and Xiang, 2013a,b). Simultaneously, such activated proteinase cascades need regulation to prevent damage to the host. And this regulation is performed, at least in part, by inhibitors of the serpin superfamily (Herrid et al., 2006; Kanost, 1999). In L. vannamei, there is no serpin has been reported so far. Being interested in the immune regulator of serpin in shrimp, we attempt to search for the potential shrimp serpins from L. vannamei. Luckily, a cDNA sequence coding for 415-amino acid residue protein with 19-residue signal peptide of Lvserpin was identified. The presence of a putative signal peptide points out that Lvserpin is a secretory protein and probably indicates the inhibiting role on extracellular serine proteinase cascades. Amino acid sequence comparison reveals Lvserpin shared 87% amino acid sequence identity to Pmserpin6. Like Pmserpin6, the Lvserpin showed homology to the M. sexta serpin-6, which was reported to regulate the prophenoloxidase system in M. sexta by inhibiting the prophenoloxidase activating proteinase-3 (PAP-3) (Wang and Jiang, 2004). Besides, the conserved hinge region, serpin signature sequence and

44

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

RCL were presented at the C-terminus of Lvserpin. The RCL contains a scissile bond between two residues, called P1–P10 , which could be cleaved by the target protease (Wilczynska et al., 1995). The P1 amino acid residue on the amino-terminal side of the scissile bond generally determines the primary specificity of the serpins (Huntington, 2011; Potempa et al., 1994). An Arg at the P1 position of RCL, like serpin-6 from M. sexta, serpin3, serpin6 and serpin7 from P. monodon and serpin from F. chinensis, indicates that Lvserpin may have inhibitory activity against bovine plasmin, bovine trypsin, prophenoloxidase activating proteases (PAP), Limulus factor C, factor G, clotting enzyme and human tissue plasminogen activator (Agarwala et al., 1996; Kanost and Jiang, 1997; Miura et al., 1994, 1995; Wang, 1996). To characterize the biological role of Lvserpin in shrimp, the mRNA expression pattern of Lvserpin in different tissues was investigated by real-time PCR analysis. The expression of Lvserpin was detected in all examined tissues, and most highly expressed in gill. As the first obstacle against the invaders, gill is more directly connected to the environment than other tissues (Zhao et al., 2007). Previous researches have reported that some immune-related genes, such as Toll, Spätzle and Pelle were expressed and regulated in gill of L. vannamei (Wang et al., 2011, 2012a). The highest expression in gill might reveal the vital role of Lvserpin in host defense. In crustaceans, hemocytes function as a defender through direct sequestration, killing of infectious agents or synthesis and exocytosis of a series of bioactive molecules (Smith and Chisholm, 1992). The moderately expression in hemocytes might indicate a crucial role of Lvserpin in crustacean immunity. Besides, the wide distribution of Lvserpin transcripts might suggest the multiplex biological functions of Lvserpin in shrimps. In the pathogenic infection experiments, the transcription of Lvserpin was remarkably up-regulated at 2 hpi after M. lysoleikticu challenge and 6 hpi after V. anguillarum challenge which may suggest that Lvserpin was involved in the early immune defense against bacterial in shrimp. Of note is that a markedly decrease of Lvserpin transcription was detected at 6 h post-challenge M. lysoleikticu, which was in accord with a hypothesis that low yield of serpin and high expression of relevant serine proteinase was emerged in the meantime. And it could be the involvement of serine proteinase in wound healing, proPO activation, phagocytosis and other defense responses after pathogenic challenge that comprised the core of this phenomenon (Liu et al., 2007). Later on, the expression of Lvserpin increased gradually and reached the second peak at 48 hpi after M. lysoleikticu challenge, while that in the V. anguillarum challenge group began to decrease at 12 hpi and resumed to the initial level at 24–48 h. The likely explanation for such increase in M. lysoleikticu challenge group was that the induction of Lvserpin to promptly clear the redundant serine proteinase. As a lethal virus for Penaeidae shrimp, WSSV could lead to high mortality of shrimps within 48 h. In WSSV challenged experiment, an explosion of Lvserpin transcript was detected at 48 hpi. So, we here inferred that Lvserpin have the capacity to defense against different pathogens in the immune response. To further confirm the involvement of Lvserpin in shrimp immune response, a dsRNA-mediated RNA interference was processed. Silencing of Lvserpin in vivo led to a significant rise of two clip-SP genes (PPAE and PPAF) and proPO gene upon challenged with V. anguillarum. Biochemical studies in insects have demonstrated that several members of the clip-SPs are essential in the regulation of the proPO activating cascade (Barillas-Mury, 2007; Jang et al., 2008; Jiang and Kanost, 2000). The clip-SPs in shrimp also were revealed to mediate the proteolysis of the inactive proPO into the active PO (Charoensapsri et al., 2009, 2011; Jiang and Kanost, 2000). Moreover, researches have reported that serpin-3 from M. sexta could block proPO activation by inhibiting PAP-1, which exhibited some amino acid sequence similarity to the PPAEs

(Charoensapsri et al., 2011; Zhu et al., 2003). The up-regulation here suggested that Lvserpin could inhibit the expression of PPAE, PPAF and proPO, and might function as negative regulator to the proteinase activities. In order to confirm the hypothesis, the rLvserpin was expressed and purified for testing the inhibitory activity. The inhibitory assay showed that the rLvserpin could completely inhibit the proteinase activity of trypsin. Since it shared the same P1 residue arginine with M. sexta serpin-6, the Lvserpin might have similar function in the proPO system (Wang and Jiang, 2004). Interestingly, our obtained data suggested that the rLvserpin strongly impeded the extent of proPO cascade. Therefore, it is speculated that Lvserpin was involved in the inhibition of prophenoloxidase activation system. More importantly, we have found that the rLvserpin could suppress the growth of V. anguillarum. Previous study reported that Ranaserpin in Rana grahami could inhibit the growth of Bacillus subtilis by inhibiting the activity of trypsin, elastase, and subtilisin produced by the bacteria (Han et al., 2008). We here predicted that the rLvserpin might also inhibit some bacterial proteinases. Previous studies have revealed that serpins could inhibit the synthesis of antimicrobial peptides in invertebrates (An and Kanost, 2010; Christen et al., 2012). However, none of studies has been reported for the regulation of serpin in the synthesis of antimicrobial peptides in Penaeidae shrimp. In our assay, we found the expression of ALF, Crustin and Pens3 in Lvserpin dsRNA group were remarkably up-regulated post injection of V. anguillarum. A potential explanation for our observation in this current study may be that Lvserpin could inhibit the synthesis of some AMPs by the regulation of serine proteinase in host defense responses in shrimp. Furthermore, suppression of Lvserpin led to the high mortality of shrimp at 18–24 h after challenged with V. anguillarum. As shown in the challenge experiment, the expression of Lvserpin was on a downward curve during that stage which might suggest the existence of redundant serine proteinase. As we know, serine proteinase inhibitors played important role in regulating the activated proteinase cascades (Kanost, 1999). Silencing of Lvserpin disturbed the balance and led to the over-expressed proteinases, which could induce the damage to the host. All the results collectively indicated that Lvserpin was likely to have capability in protecting shrimps from pathogen invasion through inhibiting bacterial proteinases, modulating antimicrobial peptide production or regulating the proteinases involved in proPO activation. In conclusion, a cDNA sequence of Lvserpin was cloned from the Pacific white shrimp, L. vannamei. The Lvserpin was mainly detected in gill. The expression profile of Lvserpin after challenged with different pathogens suggested that it is inducible and may be involved in shrimp immune response. RNAi assay further revealed the involvement of Lvserpin in the proPO activation and synthesis of antimicrobial peptides. Moreover, the rLvserpin was purified and showed inhibition on proteinase activity, prophenoloxidase activation and bacterial growth.

Acknowledgements We thank the professor Fuhua Li for kindly giving the three pathogens. This work was supported by the Agricultural Science and Technology Achievement Transformation Fund Project of Ministry of Science and Technology, China (No. 2012GB2E200361), the National Fundamental Research Program, China (No. 2006AA10A406), the Key laboratory of Marine Biology, Institute of Oceanology, Chinese Academy of Sciences and the Northwest A&F University experimental demonstration station (base) and innovation of science and technology achievement transformation project (No. XNY2013-4).

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

Appendix A.

Fig. A. Phylogenetic tree of serpins from various organisms was constructed using the NJ-method with 1000 trials by MEGA 5.0 software. Sequences used in the phylogenetic tree are: Fc-serpin (ABC33916.1); Pm-serpin7 (ADC42878.1); Mjserpin (BAI50776.1); Pm-serpin6 (ADC42876.1); Lv-serpin (AGL39540.1); Pmserpin8 (ADC42879.1); Pl-serpin (CAA57964.1); Es-serpin (ADF87946.1); Pc-serpin (AEL22816.1); Dm-serpin6 (NP_524953.1); Cc-serpinB4 (ACO14815.1); Dm-serpin88Ea (NP_524954.2); Ms-serpin6 (AAV91026.1); Bm-serpin6 (ABV74209.1); Sjserpin (AAG45932.1); Xl-serpin (AAA49703.1); Cc-serpin (AAA73954.1); Hs-serpinB5 (NP_002630.2); Gg-serpinB6 (NP_001006377.1); Cc-serpinB8 (ACO15589.1); Cr-serpinB8 (ACO11695.1); Pm-serpin (AAC63406.1); Pm-serpinB3 (ADC42877.1); Pt-serpin2 (AFA42363.1); Pt-serpin1 (AFC61250.1) and Sp-serpin (ACY66635.1).

References Agarwala, K., Kawabata, S., Miura, Y., Kuroki, Y., Iwanaga, S., 1996. Limulus intracellular coagulation inhibitor type 3. Purification, characterization, cDNA cloning, and tissue localization. J. Biol. Chem. 271, 23768–23774. Ahmad, S.T., Sweeney, S.T., Lee, J.A., Sweeney, N.T., Gao, F.B., 2009. Genetic screen identifies serpin5 as a regulator of the toll pathway and CHMP2B toxicity associated with frontotemporal dementia. Proc. Natl. Acad. Sci. USA 106, 12168–12173. Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity. Cell 124, 783–801. Amparyup, P., Charoensapsri, W., Tassanakajon, A., 2013. Prophenoloxidase system and its role in shrimp immune responses against major pathogens. Fish Shellfish Immunol. 34, 990–1001. An, C., Kanost, M.R., 2010. Manduca sexta serpin-5 regulates prophenoloxidase activation and the Toll signaling pathway by inhibiting hemolymph proteinase HP6. Insect Biochem. Mol. 40, 683–689. An, C., Jiang, H., Kanost, M.R., 2010. Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta. FEBS J. 277, 148–162. An, C., Ragan, E.J., Kanost, M.R., 2011. Serpin-1 splicing isoform J inhibits the proSpatzle-activating proteinase HP8 to regulate expression of antimicrobial hemolymph proteins in Manduca sexta. Dev. Comp. Immunol. 35, 135–141. Barillas-Mury, C., 2007. CLIP proteases and Plasmodium melanization in Anopheles gambiae. Trends Parasitol. 23, 297–299. Cerenius, L., Söderhäll, K., 2004. The prophenoloxidase-activating system in invertebrates. Immunol. Rev. 198, 116–126. Charoensapsri, W., Amparyup, P., Hirono, I., Aoki, T., Tassanakajon, A., 2009. Gene silencing of a prophenoloxidase activating enzyme in the shrimp, Penaeus

45

monodon, increases susceptibility to Vibrio harveyi infection. Dev. Comp. Immunol. 33, 811–820. Charoensapsri, W., Amparyup, P., Hirono, I., Aoki, T., Tassanakajon, A., 2011. PmPPAE2, a new class of crustacean prophenoloxidase (proPO)-activating enzyme and its role in PO activation. Dev. Comp. Immunol. 35, 115–124. Chen, F.Y., Liu, H.P., Bo, J., Ren, H.L., Wang, K.J., 2010. Identification of genes differentially expressed in hemocytes of Scylla paramamosain in response to lipopolysaccharide. Fish Shellfish Immunol. 28, 167–177. Christen, J.M., Hiromasa, Y., An, C.J., Kanost, M.R., 2012. Identification of plasma proteinase complexes with serpin-3 in Manduca sexta. Insect Biochem. Mol. 42, 946–955. Ghosh, J., Lun, C.M., Majeske, A.J., Sacchi, S., Schrankel, C.S., Smith, L.C., 2011. Invertebrate immune diversity. Dev. Comp. Immunol. 35, 959–974. Han, Y.P., Yu, H.N., Yang, X.B., Rees, H.H., Liu, J.Z., Lai, R., 2008. A serine proteinase inhibitor from frog eggs with bacteriostatic activity. Comp. Biochem. Phys. B 149, 58–62. Herrid, M., Vignarajan, S., Davey, R., 2006. Successful transplantation of bovine testicular cells to heterologous recipients. Reproduction 132, 617–624. Homvises, T., Tassanakajon, A., Somboonwiwat, K., 2010. Penaeus monodon SERPIN, PmSERPIN6, is implicated in the shrimp innate immunity. Fish Shellfish Immunol. 29, 890–898. Huntington, J.A., 2011. Serpin structure, function and dysfunction. JTH 9 (Suppl. 1), 26–34. Jang, I.H., Nam, H.J., Lee, W.J., 2008. CLIP-domain serine proteases in Drosophila. BMB Rep. 41, 102–107. Jiang, H.B., Kanost, M.R., 2000. The clip-domain family of serine proteinases in arthropods. Insect Biochem. Mol. 30, 95–105. Jiang, R., Kim, E.H., Gong, J.H., Kwon, H.M., Kim, C.H., Ryu, K.H., Park, J.W., Kurokawa, K., Zhang, J.H., Gubb, D., Lee, B.L., 2009. Three pairs of protease-serpin complexes cooperatively regulate the insect innate immune responses. J. Biol. Chem. 284, 35652–35658. Jiravanichpaisal, P., Lee, B.L., Söderhäll, K., 2006. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 211, 213–236. Jitvaropas, R., Amparyup, P., Gross, P.S., Tassanakajon, A., 2009. Functional characterization of a masquerade-like serine proteinase homologue from the black tiger shrimp Penaeus monodon. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 153, 236–243. Kanost, M.R., 1999. Serine proteinase inhibitors in arthropod immunity. Dev. Comp. Immunol. 23, 291–301. Kanost, M.R., Jiang, H., 1997. Characterization and functional analysis of 12 naturally occurring reactive site variants of serpin-1 from Manduca sexta. J. Biol. Chem. 272, 1082–1087. Lee, S.Y., Söderhäll, K., 2002. Early events in crustacean innate immunity. Fish Shellfish Immunol. 12, 421–437. Li, F., Xiang, J., 2013a. Recent advances in researches on the innate immunity of shrimp in China. Dev. Comp. Immunol. 39, 11–26. Li, F., Xiang, J., 2013b. Signaling pathways regulating innate immune responses in shrimp. Fish Shellfish Immunol. 34, 973–980. Liang, Z., Söderhäll, K., 1995. Isolation of cDNA encoding a novel serpin of crayfish hemocytes. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 112, 385–391. Lightner, D.V., 2005. Biosecurity in shrimp farming: pathogen exclusion through use of SPF stock and routine surveillance. J. World Aquacult. Soc. 36, 229–248. Liu, H., Jiravanichpaisal, P., Cerenius, L., Lee, B.L., Söderhäll, I., Söderhäll, K., 2007. Phenoloxidase is an important component of the defense against Aeromonas hydrophila infection in a crustacean, Pacifastacus leniusculus. J. Biol. Chem. 282, 33593–33598. Liu, Y., Li, F., Wang, B., Dong, B., Zhang, X., Xiang, J., 2009. A serpin from Chinese shrimp Fenneropenaeus chinensis is responsive to bacteria and WSSV challenge. Fish Shellfish Immunol. 26, 345–351. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Mangan, M.S., Kaiserman, D., Bird, P.I., 2008. The role of serpins in vertebrate immunity. Tissue Antigens 72, 1–10. Miura, Y., Kawabata, S., Iwanaga, S., 1994. Limulus intracellular coagulation inhibitor with characteristics of the serpin superfamily. Purification, characterization, and cDNA cloning. J. Biol. Chem. 269, 542–547. Miura, Y., Kawabata, S., Wakamiya, Y., Nakamura, T., Iwanaga, S., 1995. A limulus intracellular coagulation inhibitor type 2. Purification, characterization, cDNA cloning, and tissue localization. J. Biol. Chem. 270, 558–565. Nappi, A.J., Frey, F., Carton, Y., 2005. Drosophila serpin 27A is a likely target for immune suppression of the blood cell-mediated melanotic encapsulation response. J. Insect Physiol. 51, 197–205. Park, S.H., Jiang, R., Piao, S.F., Zhang, B., Kim, E.H., Kwon, H.M., Jin, X.L., Lee, B.L., Ha, N.C., 2011. Structural and functional characterization of a highly specific serpin in the insect innate immunity. J. Biol. Chem. 286, 1567– 1575. Potempa, J., Korzus, E., Travis, J., 1994. The serpin superfamily of proteinaseinhibitors-structure, function, and regulation. J. Biol. Chem. 269, 15957–15960. Rimphanitchayakit, V., Tassanakajon, A., 2010. Structure and function of invertebrate Kazal-type serine proteinase inhibitors. Dev. Comp. Immunol. 34, 377–386. Rodriguez, J., Boulo, V., Mialhe, E., Bachere, E., 1995. Characterisation of shrimp haemocytes and plasma components by monoclonal antibodies. J. Cell Sci. 108, 1043–1050.

46

Y. Liu et al. / Developmental and Comparative Immunology 43 (2014) 35–46

Scherfer, C., Tang, H., Kambris, Z., Lhocine, N., Hashimoto, C., Lemaitre, B., 2008. Drosophila serpin-28D regulates hemolymph phenoloxidase activity and adult pigmentation. Dev. Biol. 323, 189–196. Shin, S.W., Bian, G., Raikhel, A.S., 2006. A toll receptor and a cytokine, Toll5A and Spz1C, are involved in toll antifungal immune signaling in the mosquito Aedes aegypti. J. Biol. Chem. 281, 39388–39395. Silverman, G.A., Bird, P.I., Carrell, R.W., Church, F.C., Coughlin, P.B., Gettins, P.G., Irving, J.A., Lomas, D.A., Luke, C.J., Moyer, R.W., Pemberton, P.A., RemoldO’Donnell, E., Salvesen, G.S., Travis, J., Whisstock, J.C., 2001. The serpins are an expanding superfamily of structurally similar but functionally diverse proteins. Evolution, mechanism of inhibition, novel functions, and a revised nomenclature. J. Biol. Chem. 276, 33293–33296. Smith, V.J., Chisholm, J.R.S., 1992. Non-cellular immunity in crustaceans. Fish Shellfish Immunol. 2, 1–31. Söderhäll, I., Bangyeekhun, E., Mayo, S., Söderhäll, K., 2003. Hemocyte production and maturation in an invertebrate animal; proliferation and gene expression in hematopoietic stem cells of Pacifastacus leniusculus. Dev. Comp. Immunol. 27, 661–672. Somboonwiwat, K., Supungul, P., Rimphanitchayakit, V., Aoki, T., Hirono, I.A.T., 2006. Differentially expressed genes in hemocytes of Vibrio harveyi-challenged. J. Biochem. Mol. Biol. 39, 26–36. Somnuk, S., Tassanakajon, A., Rimphanitchayakit, V., 2012. Gene expression and characterization of a serine proteinase inhibitor PmSERPIN8 from the black tiger shrimp Penaeus monodon. Fish Shellfish Immunol. 33, 332–341. Suwanchaichinda, C., Ochieng, R., Zhuang, S., Kanost, M.R., 2013. Manduca sexta serpin-7, a putative regulator of hemolymph prophenoloxidase activation. Insect Biochem. Mol. 43, 555–561. Tang, H., Kambris, Z., Lemaitre, B., Hashimoto, C., 2008. A serpin that regulates immune melanization in the respiratory system of Drosophila. Dev. Cell 15, 617–626. Tassanakajon, A., Somboonwiwat, K., Supungul, P., Tang, S., 2013. Discovery of immune molecules and their crucial functions in shrimp immunity. Fish Shellfish Immunol. 34, 954–967. Tong, Y., Kanost, M.R., 2005. Manduca sexta serpin-4 and serpin-5 inhibit the prophenol oxidase activation pathway: cDNA cloning, protein expression, and characterization. J. Biol. Chem. 280, 14923–14931.

Wang, Y., 1996. Organization of serpin gene-1 from Manduca sexta. Evolution of a family of alternate exons encoding the reactive site loop. J. Biol. Chem. 271, 28017–28023. Wang, Y., Jiang, H., 2004. Purification and characterization of Manduca sexta serpin6: a serine proteinase inhibitor that selectively inhibits prophenoloxidaseactivating proteinase-3. Insect Biochem. Mol. 34, 387–395. Wang, P.H., Gu, Z.H., Wan, D.H., Zhang, M.Y., Weng, S.P., Yu, X.Q., He, J.G., 2011. The shrimp NF-kappaB pathway is activated by white spot syndrome virus (WSSV) 449 to facilitate the expression of WSSV069 (ie1), WSSV303 and WSSV371. Plos One 6, e24773. Wang, P.H., Liang, J.P., Gu, Z.H., Wan, D.H., Weng, S.P., Yu, X.Q., He, J.G., 2012a. Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spatzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei. Dev. Comp. Immunol. 36, 359–371. Wang, S., Cui, Z., Liu, Y., Li, Q., Song, C., 2012b. Identification and characterization of a serine protease inhibitor (PtSerpin) in the swimming crab Portunus trituberculatus. Fish Shellfish Immunol. 32, 544–550. Wang, L., Ma, Z., Yang, J., Gai, Y., Zhou, Z., Wang, L., Yue, F., Song, L., 2013. Identification and characterization of a serine protease inhibitor Esserpin from the Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 34, 1576– 1586. Wetsaphan, N., Rimphanitchayakit, V., Tassanakajon, A., Somboonwiwat, K., 2013. PmSERPIN3 from black tiger shrimp Penaeus monodon is capable of controlling the proPO system. Dev. Comp. Immunol. 41, 110–119. Wilczynska, M., Fa, M., Ohlsson, P.I., N.T., 1995. The inhibition mechanism of serpins. Evidence that the mobile reactive center loop is cleaved in the native protease-inhibitor complex. J. Biol. Chem. 270, 29652–29655. Zhao, J., Song, L., Li, C., Zou, H., Ni, D., Wang, W., Xu, W., 2007. Molecular cloning of an invertebrate goose-type lysozyme gene from Chlamys farreri, and lytic activity of the recombinant protein. Mol. Immunol. 44, 1198–1208. Zhu, Y., Wang, Y., Gorman, M.J., Jiang, H., Kanost, M.R., 2003. Manduca sexta serpin-3 regulates prophenoloxidase activation in response to infection by inhibiting prophenoloxidase-activating proteinases. J. Biol. Chem. 278, 46556–46564. Zou, Z., Shin, S.W., Alvarez, K.S., Kokoza, V., Raikhell, A.S., 2010. Distinct melanization pathways in the mosquito Aedes aegypti. Immunity 32, 41–53.