Comparative Biochemistry and Physiology, Part D 11 (2014) 37–44

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part D journal homepage: www.elsevier.com/locate/cbpd

RNA-Seq reveals the dynamic and diverse features of digestive enzymes during early development of Pacific white shrimp Litopenaeus vannamei Jiankai Wei a,b, Xiaojun Zhang a,⁎, Yang Yu a,b, Fuhua Li a, Jianhai Xiang a a b

Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China University of Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e

i n f o

Article history: Received 17 April 2014 Received in revised form 7 July 2014 Accepted 8 July 2014 Available online 15 July 2014 Keywords: Litopenaeus vannamei RNA-Seq Digestive enzyme Early development Diet transition

a b s t r a c t The Pacific white shrimp (Litopenaeus vannamei), with high commercial value, has a typical metamorphosis pattern by going through embryo, nauplius, zoea, mysis and postlarvae during early development. Its diets change continually in this period, and a high mortality of larvae also occurs in this period. Since there is a close relationship between diets and digestive enzymes, a comprehensive investigation about the types and expression patterns of all digestive enzyme genes during early development of L. vannamei is of considerable significance for shrimp diets and larvae culture. Using RNA-Seq data, the types and expression characteristics of the digestive enzyme genes were analyzed during five different development stages (embryo, nauplius, zoea, mysis and postlarvae) in L. vannamei. Among the obtained 66,815 unigenes, 296 were annotated as 16 different digestive enzymes including five types of carbohydrase, seven types of peptidase and four types of lipase. Such a diverse suite of enzymes illustrated the capacity of L. vannamei to exploit varied diets to fit their nutritional requirements. The analysis of their dynamic expression patterns during development also indicated the importance of transcriptional regulation to adapt to the diet transition. Our study revealed the diverse and dynamic features of digestive enzymes during early development of L. vannamei. These results would provide support to better understand the physiological changes during diet transition. © 2014 Elsevier Inc. All rights reserved.

1. Introduction The Pacific white shrimp (Litopenaeus vannamei) is one of the most important marine aquaculture species in the world (FAO, 2012). Meanwhile, as a Crustacea, it has a typical metamorphosis process during early development. It goes through embryo, nauplius, zoea, mysis and postlarvae before it becomes an adult, and both its morphological and physiological features change dramatically in this period (Dall et al., 1990). Death happened with high frequency at these stages. So the researches about early development and metamorphosis process are of considerable significance for both developmental biology and aquaculture in shrimp. As one of the most important physiological features, diets of the shrimp larvae change continually along with metamorphosis (Cuzon et al., 2004). There is no feeding process at embryo and nauplius stages, and all of the nutrients come from the reservation of yolk. When shrimp become zoea, they start to eat unicellular algae or plant debris. When they become mysis, they turn to eat planktons or animal debris. When they become postlarvae, they turn to eat benthic or sedimentary organisms. In the present industrial cultivation of shrimp, artificial diets and ⁎ Corresponding author at: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China. Tel.: +86 532 82898786; fax: +86 532 82898578. E-mail address: [email protected] (X. Zhang).

http://dx.doi.org/10.1016/j.cbd.2014.07.001 1744-117X/© 2014 Elsevier Inc. All rights reserved.

semi-humid artificial diets (based on microalgae and fish powder) are used widely instead of natural diets. To date, the information about the diets of larval shrimp is mainly based on morphology observation and a small amount of researches about digestive enzyme activities (Carrillo-Farnes et al., 2007). The digestion of food to obtain nutrients is a physiological function of digestive enzymes, so digestive enzyme activity is the most common indicator for evaluating the capacity of digestion (Dai et al., 2009). Among these enzymes, trypsin, chymotrypsin, amylase and lipase are considered to be the most important components for digestion. Recently, several enzyme activities during development have been studied (Puello-Cruz et al., 2002; Rivera-Perez et al., 2010) and their genes also have been cloned in adult L. vannamei (Klein et al., 1996; VanWormhoudt and Sellos, 1996; HernandezCortes et al., 1997). However, the researches about digestive enzyme gene diversity and gene regulation mechanisms at whole transcriptional level during shrimp development are still insufficient. There are also many other enzymes which participate in digesting nutrients into absorbable small molecules such as isomaltase and elastase, but few reports pay attention on them. This situation blocked more accurate research on diet transition during early development of shrimp. In order to investigate the types and expression patterns of digestive enzyme genes during early development of L. vannamei comprehensively, we used the RNA-Seq technology for data collection. RNA-Seq is a sequencing based method that allows the entire transcripts to be

38

J. Wei et al. / Comparative Biochemistry and Physiology, Part D 11 (2014) 37–44

surveyed in a very high-throughput and quantitative manner (Wang et al., 2009). By deep sequencing of all transcripts in specific conditions, it provides a far more precise measurement of levels of transcripts and their isoforms than other methods and gives a general view of gene expression especially in the lack of a fully sequenced and assembled genome of L. vannamei. In this study, we identified the digestive enzyme genes of L. vannamei and analyzed their expression characteristics during five different early development stages through Solexa/Illumina high-throughput sequencing data. Results obtained from this study will contribute to further study molecular mechanisms of diet transition of L. vannamei, and can be used in nutrition regulation, evolution analysis, development biology and functional gene research in penaeid shrimp. 2. Materials and methods 2.1. Breeding and sampling of experimental shrimp The L. vannamei samples of different development stages were collected from Hainan Grandtop Ocean Breeding Co. Ltd. in Wenchang, Hainan, China. A total of 15 samples were collected based on their development stages, and they are in turn: zygote, blastula, gastrula, limb bud embryo, larva in membrane, nauplius I(N1), nauplius III (N3), nauplius VI(N6), zoea I (Z1), zoea II(Z2), zoea III (Z3), mysis I (M1), mysis II (M2), mysis III (M3) and postlarvae 1 (P1). Each stage was identified according to observation with a microscope. They were reared in a 25 m3 indoor pond with seawater at 31 °C, salinity of 2.5%. They were unfed during embryos and nauplius stages. At zoea stage larvae were fed with spirulina and multiform formulated diet, while at mysis and postlarvae stages they were fed with Artemia nauplii and multiform formulated diet. Larvae pools were sampled randomly at each stage when 90% of the population had reached that stage and used for assays. 2.2. RNA isolation and sample pooling The total RNA of 15 samples was extracted separately using a Unizol reagent following the manufacturer's instructions, assessed by electrophoresis in 1% agarose gel and quantified by a NanoDrop 1000 spectrophotometer and an Agilent 2100 bioanalyzer. Afterwards, the RNA samples of zygote, blastula, gastrula, limb bud embryo, larva in membrane were mixed equivalently into embryo sample (E), the RNA samples of N1, N3, N6 were mixed equivalently into nauplius sample (N), the RNA samples of Z1, Z2, Z3 were mixed equivalently into zoea sample (Z), the RNA samples of M1, M2, M3 were mixed equivalently into mysis sample (M) and the RNA samples of postlarvae 1 were considered as postlarvae sample (P). Then the five mixed RNA samples were used for library construction and sequencing. 2.3. Library construction and Illumina sequencing Beads with oligo(dT) were used to isolate poly(A) mRNA after total RNA was collected. Fragmentation buffer was added for interrupting mRNA to short fragments. Using these short fragments as templates, random hexamer-primer was used to synthesize the first-strand cDNA. The second-strand cDNA was synthesized using RNase H and DNA polymerase I. Short fragments were purified with QiaQuick PCR extraction kit and resolved with EB buffer for end reparation and tailing A. After that, the short fragments were connected with sequencing adapters. After the agarose gel electrophoresis, the suitable 200 bp fragments were selected for the PCR amplification as templates. At last, the libraries were sequenced using Illumina HiSeq™ 2000. 2.4. Sequencing data assembly and annotation Image data output from sequencing systems were transformed by base calling into raw reads and stored in fastq format. The raw reads

of all five samples were preprocessed by removing adaptors, reads with unknown nucleotides larger than 5% and low quality reads. The clean reads of each stage were then assembled into unigenes using the Trinity program (Grabherr et al., 2011). Unigenes of five samples were then clustered into all-unigenes using TGICL (Pertea et al., 2003). By means of reads mapping to all-unigenes, the RPKM (Reads Per Kilo bases per Million fragments) value of all-unigenes in each sample were obtained. In order to annotate all-unigenes, blast alignments (Altschul et al., 1990) (E value b 1e-5) against the nr, nt, Swiss-Prot, KEGG, and COG databases were performed. 2.5. Digestive enzyme identification and analysis According to the annotation result, the digestive enzyme genes were identified with the following criteria: the annotations of all-unigenes by blastx search against nr or Swiss-Prot database match the corresponding digestive enzymes with E value b1e − 10. The identified genes were grouped together according to their expression patterns by a hierarchical clustering analysis using the Cluster 3.0 (de Hoon et al., 2004) and visualizing gene expression profile using the TreeView 1.6 (Saldanha, 2004). The phylogenic tree was constructed using MEGA version 5 (Tamura et al., 2011). 2.6. Quantitative real-time PCR A total of four genes were selected for quantitative real-time PCR (qPCR) analysis to validate the RNA-Seq data and get more precise expression patterns. EvaGreen was used as DNA-binding fluorescent dye, and 18s rRNA was used as an internal standard considering that it showed relatively stable expression during development of L. vannamei in a previous publication (Qian et al., 2014). qPCR was performed by Eppendorf Mastercycler Heprealplex (Eppendorf, Germany) under the conditions described below: denaturation at 94 °C for 2 min; 40 cycles of 94 °C for 20 s, 55 °C for 20 s, and 72 °C for 20 s; final extension at 72 °C for 10 min. Relative gene expression levels were calculated using the comparative Ct method with the formula 2−ΔΔCt (Livak and Schmittgen, 2001). 3. Results 3.1. Profile of transcriptome sequencing We have investigated the transcriptomic characteristics of L. vannamei during five continuous developmental stages with high throughput Solexa/Illumina sequencing technology. We obtained 51,568,556, 52,824,674, 53,430,302, 53,902,786, 51,574,056 clean reads for samples E, N, Z, M and P respectively. The reads were assembled independently and then clustered into 66,815 all-unigenes used for the following analysis. Of these unigenes, 32,398 have putative homologues in the nr protein database, 29,022 have putative homologues in the Swiss-Prot protein database and 26,257 were associated with 255 pathways by KEGG pathway mapping. The expressed

Table 1 The number and percentage of expressed and annotated unigenes in each sample. Sample

E N Z M P All

Expressed unigenes

Unigenes with nr annotation

Unigenes fit in KEGG pathway

Number

Percentage

Number

Percentage

Number

Percentage

37,833 41,194 44,344 45,957 44,618 66,815

56.62% 61.65% 66.37% 68.78% 66.78% 100.00%

16,862 19,649 21,607 22,360 21,873 32,398

52.05% 60.65% 66.69% 69.02% 67.51% 100.00%

13,333 15,682 17,212 17,782 17,429 26,257

50.78% 59.73% 65.55% 67.72% 66.38% 100.00%

J. Wei et al. / Comparative Biochemistry and Physiology, Part D 11 (2014) 37–44

unigenes at each stage were determined by reads mapping (RPKM value ≥ 1) that varied from 56.62% to 68.78% (Table 1). The unigenes with nr annotation and fit in KEGG pathway at each stage were also shown in Table 1. Many pathways are related to food digestion and absorption such as salivary secretion, pancreatic secretion and protein digestion and absorption (Table 2). Hundreds of unigenes were classified into these pathways by blast annotation, and many of them were annotated as digestive enzymes that played key roles during food digestion. The reads related to digestive enzyme genes have been submitted to NCBI SRA database with accession numbers SRR1037362, SRR1037363, SRR1037364, SRR1037365 and SRR1037366. These results showed a high coverage and integrity which can guarantee that our investigation about digestive enzymes at transcriptional level is typical and reliable.

39

first detected at the embryo stage, while polysaccharidases (alpha amylase and isomaltase) were first detected at the nauplius stage. Their expression levels all increased sharply from nauplius stage to zoea stage, and then kept stable relatively until mysis stage and postlarvae stage. For peptidase genes, the maximum expression levels were much higher than that of carbohydrase, and the expression patterns were more diverse. Trypsin and chymotrypsin shared a similar pattern peaking at zoea stage, while carboxypeptidase A and B shared a similar pattern also peaking at zoea stage, and aminopeptidase N reached peak at nauplius stage. From zoea to mysis, the expression of most peptidases declined at different degrees. For lipase genes, triacylglycerol lipase first appeared at embryo stage, and kept increasing until mysis stage. The expression of pancreatic triacylglycerol lipase was dominant through all stages.

3.2. Identification of digestive enzyme genes 3.4. Unigene hierarchical clustering analysis Unigenes which annotated as digestive enzymes were identified according to blastx alignment with nr and Swiss-Prot database. These genes were divided into three major groups (Table 3), and some of them have been reported in shrimp (Klein et al., 1998; Sellos and Van Wormhoudt, 1999; Le Chevalier et al., 2000; Van Wormhoudt and Sellos, 2003; Zhao et al., 2007; Huang et al., 2010; Proespraiwong et al., 2010; Rivera-Perez et al., 2011). The first group was carbohydrases which were composed of three types of polysaccharidase and two types of disaccharidase. The chitinase had the highest unigene occurrence. 67 unigenes were annotated as chitinase including chitinase types 1, 2, 3, 4, 5, 6 and Chid1 (Huang et al., 2010). Alpha amylase, considered as the key polysaccharidase involved in the process of glycogen catabolism, also had a high unigene occurrence (16 unigenes). 7 unigenes were identified as isomaltase which was unnoticed in shrimp before. Two types of disaccharidase were also identified including maltase (also known as alpha glucosidase) and beta galactosidase. The second group was peptidases which were composed of three types of endopeptidase, three types of exopeptidase and one type of dipeptidase. The endopeptidases contained trypsin, chymotrypsin and elastase which all belong to serine protease family, while no digestive aspartic proteases (pepsin or chymosin) were identified in this study. The exopeptidases contained carboxypeptidase A, carboxypeptidase B and aminopeptidase N. Aminopeptidase N had the highest unigene occurrence (67 unigenes), and followed by trypsin (29 unigenes). The third group was lipases composed of triacylglycerol lipase. The triacylglycerol lipases contained gastric triacylglycerol lipase, bile salt-activated lipase and pancreatic triacylglycerol lipase, and pancreatic triacylglycerol lipase had the highest unigene occurrence (13 unigenes). 3.3. Gene expression patterns of different digestive enzymes The line graphs of gene expression were drawn according to the total RPKM value of different digestive enzymes at each stage, and a clear variation was observed (Fig. 1) in the three groups. For carbohydrase genes, disaccharidases (maltase and beta galactosidase) were

Table 2 KEGG pathways and unigene counts related to food digestion and absorption. Pathways

Unigene counts

Salivary secretion Protein digestion and absorption Pancreatic secretion Amino sugar and nucleotide sugar metabolism Glycerolipid metabolism Starch and sucrose metabolism Fat digestion and absorption Fructose and mannose metabolism Galactose metabolism Fatty acid metabolism

572 519 443 214 170 143 114 114 106 99

Considering tens of unigenes were annotated as the same digestive enzymes, we chose unigenes annotated as alpha amylase, trypsin, chymotrypsin and triacylglycerol lipase, analyzed expression levels of these unigenes throughout development and grouped them using cluster analysis. The heat map (Fig. 2) showed that the number of expressed unigenes for the four enzymes gradually increased along with development. The expression of trypsin, chymotrypsin and lipase appeared at embryo stage, while none of the unigenes annotated as alpha amylase were expressed until nauplius stage. As color gradations in the heat map represent gene expression level, we can find that most unigenes for alpha amylase (9 out of 16) turned red from nauplius to zoea which meant they had a dramatic increase in expression at this period, and for trypsin and chymotrypsin this happened both from embryo to nauplius and from nauplius to zoea. For lipase, some unigenes had high expression levels at embryo stage while some others did not express until nauplius stage. 3.5. Phylogenetic tree analysis In order to analyze the evolutionary relationships between unigenes which were annotated as the same enzymes, a phylogenic tree analysis was constructed using alpha amylase sequences. The analyzed sequences include 7 amylase genes (amy lv d1–d7, with accession numbers KM077129, KM077130, KM077131, KM077132, KM077133, KM077134 and KM077135) with complete ORF from our dataset, 3 amylase genes in adult L. vannamei (Van Wormhoudt and Sellos, 2003) (amy lv 1–3, CAB65552, CAB65553 and CAB63937) and 2 amylase genes from the genome of Daphnia pulex (Colbourne et al., 2011) (amy dp1–2, EFX75683 and EFX81580). Phylogenic analysis showed that they were categorized into two major groups. Six amylase sequences identified in our dataset (amy lv d1–d6) and one amylase sequence of D. pulex (amy dp1) were in group 1. Three amylase protein sequences of adult L. vannamei from NCBI (amy lv 1–3) and one amylase from our dataset (amy lv d7) were classified into group 2 with the other amylase sequence of D. pulex (amy dp2). (Fig. 3). 3.6. qPCR validation Although some enzymes have a relatively high unigene occurrence, only one or two unigenes predominated at transcriptional level. We use qPCR to validate relative expression levels in four unigenes (Table 4): CL3722.Contig3_All, CL2613.Contig1_All, CL1205.Contig1_All and Unigene1584_All (annotated as preamylase 1, trypsin, Chymotrypsin BII and triacylglycerol lipase respectively). The primers are shown in Table 4. The qPCR provided more precise results about the expression pattern of these enzymes during different development stages. The results (Fig. 4) showed that the expression profiles of transcriptome data and the qPCR data were consistent.

40

J. Wei et al. / Comparative Biochemistry and Physiology, Part D 11 (2014) 37–44

Table 3 Classification of annotated digestive enzymes in this study. Major group

Family

Enzyme

Unigene number

Reports about digestive enzyme genes in penaeid shrimp

Carbohydrase

Polysaccharidase

Alpha amylase Isomaltase Chitinase Maltase/alpha glucosidase Beta galactosidase Trypsin Chymotrypsin Elastase Carboxypeptidase A Carboxypeptidase B Aminopeptidase N Dipeptidase Gastric triacylglycerol lipase Bile salt-activated lipase Pancreatic triacylglycerol lipase Triacylglycerol lipase

16 7 67 14 4 29 17 3 14 14 67 23 4 3 13 1

Van Wormhoudt and Sellos (2003)

Disaccharidase Peptidase

Endopeptidase

Exopeptidase

Lipase

Dipeptidase Acidic lipase Alkaline lipase

4. Discussion Using RNA-Seq technology, we analyzed the types and expression characteristics of the digestive enzyme genes during five different development stages (embryo, nauplius, zoea, mysis and postlarvae) in L. vannamei. Among the obtained 66,815 unigenes, 296 were annotated as 16 different digestive enzymes, including five types of carbohydrase, seven types of peptidase and four types of lipase (Table 3). Such a diverse suite of enzymes illustrated the capacity of L. vannamei to exploit varied diets to fit their nutritional requirements. Furthermore, the analysis of their dynamic expression patterns during development also indicated the importance of transcriptional regulation to adapt the diet transition. The digestion of carbohydrates is performed by various enzymes. Alpha-amylases break down polysaccharides by hydrolyzing alpha-D(1,4)-glucan bonds. Isomaltase breaks the bonds linking saccharides by digesting polysaccharides at the alpha 1–6 linkages, which cannot be broken by amylase or maltase. Other sugar-converting enzymes such as maltase break disaccharide into monose. The detection of these carbohydrates in larval shrimps suggests they are capable of completely hydrolyzing both glycogen and starch to absorbable glucose (Johnston, 2003). In marine species, chitinase is particularly associated with the molting processes of crustaceans (Tan et al., 2000). However, there are also many reports of chitinase activity in the gastrointestinal tract of many marine organisms (Danulat, 1986; Kono et al., 1990). This indicates that chitinase may have complementary digestive functions, helping to disrupt the exoskeleton of the food in the absence of mechanical structures thereby enabling other digestive enzymes to penetrate the inner tissues (Shahidi and Kamil, 2001). Nevertheless, we inferred that the high occurrence of chitinase was involved in their

Huang et al. (2010); Proespraiwong et al. (2010) Le Chevalier et al. (2000) Klein et al. (1998) Sellos and Van Wormhoudt (1999)

Zhao et al. (2007)

Rivera-Perez et al. (2011)

adaption to the molting habit during metamorphosis, so the expression patterns of chitinase were not discussed in this article. Trypsin is considered as the most important enzyme in digesting dietary protein, and together with chymotrypsin is the most abundant proteolytic enzyme in the digestive gland (DG) of crustaceans. These two enzymes are responsible for over 60% of protein digestion in the DG of penaeid shrimps (Hernandez and Murueta, 2009). Their relatively high unigene occurrence illustrated the capacity to exploit varied protein resource diets to fit their nutritional requirements in L. vannamei. Compared to the high expression of serine proteases (trypsin and chymotrypsin), no pepsin or chymosin which are aspartic enzymes were identified in our dataset. Serine proteinases show highest activities at neutral or mild alkaline pH while aspartic proteinases are most active at acidic conditions. The aspartic proteinases are confirmed to play a role in digestion in some crustaceans like clawed lobster (Rojo et al., 2013). Since activities were significantly higher in clawed lobster than in other species of crustaceans, it may be suggested that the expression of acid proteinases is favored in certain groups and reduced in others (Gildberg, 1988; Del Toro et al., 2006). After proteinases change dietary protein into polypeptide, exopeptidases change them into dipeptide or amino acids which are absorbable. To our surprise, exopeptidases also have relatively high unigene occurrences, even higher than that of proteinases, indicating that they may have also diversified to enhance the protein absorbing ability. Lipases play a vital physiological role in preparing the fatty acids of water-insoluble triacylglycerols (TAG) for absorption into and transport through membranes by converting the TAG to the more polar diacylglycerols, monoacylglycerols, free-fatty acids and glycerol (Jensen, 1983). Both acidic and alkaline lipases were annotated in this dataset including gastric triacylglycerol lipase, pancreatic triacylglycerol lipase

Fig. 1. Gene expression patterns of different digestive enzymes during early development of L. vannamei. X axis represents the developmental stages and Y axis represents their RPKM values. (A) Gene expression patterns of carbohydrases; (B) gene expression patterns of peptidases; (C) gene expression patterns of lipases.

J. Wei et al. / Comparative Biochemistry and Physiology, Part D 11 (2014) 37–44

41

Fig. 2. Unigene hierarchical clustering heat maps for amylase, trypsin, chymotrypsin and triacylglycerol lipase in L. vannamei. The RPKM values were log transformed and genes were clustered using complete linkage method by calculating Euclidean distance.

and bile salt-activated lipase. The pH and temperature range over which an enzyme would be stable varies from one protein to another. The assay of lipase activity also showed multiple bands in L. vannamei (Rivera-Perez et al., 2010). These all indicated their different distributions and verified types for fatty acid metabolism (Rivera-Perez et al., 2011). At embryo stage, most of the enzymes kept a relatively low expression level such as carboxypeptidases A and B (Fig. 1), showing that it was a non-feeding stage and was related to the use of the yolk reserves. When shrimp developed into nauplius stage, the expression level of the enzymes increased slightly, it is consistent to the fact that nauplius was still unfed. Entering zoea stage, their expression level increased sharply and even reached their peaks such as trypsin and amylase, corresponding to food components (Ma et al., 2001), which also was the representation of a developed digestive system (Muhammad et al., 2012). At mysis and postlarvae stages, most carbohydrase and lipase kept a stable expression level while the expression of most peptidase declined at different degrees (Fig. 1). There is a common decline in trypsin content in those species that make a transition in trophic level during larval development. These trends have been found to hold true in comparative studies of larvae from diverse groups including cirripeds (Le Vay et al., 2001), decapods (Lovett and Felder, 1990) and branchiopods (Le Vay et al., 2001). This decline might be involved in the transition from herbivores to carnivores. While herbivorous decapod larvae adapt to low food energy values with high enzyme activity levels, rapid food turnover and low assimilation efficiency, carnivorous larvae exhibit low levels of enzyme activity but compensate by extending retention time of high-energy food to maximize assimilation efficiency (Le Vay et al., 2001). At zoea stage, shrimps are mainly dependent on phytoplankton as food resource; as a consequence they tend to have higher ingestion, digestive enzyme expression level and feces production, compared to larger carnivorous larvae. This difference is reflected in the highest RPKM value of digestive enzymes at this stage, mainly trypsin and chymotrypsin. In addition, the RPKM value of trypsin, chymotrypsin and carboxypeptidase is hundreds of times higher than that of carbohydrases and lipases after nauplius stage, indicating a greater capacity to digest dietary proteins than carbohydrates and lipids (Johnston, 2003). Considering that many unigenes had complete open reading frames, we regard them as isoforms of the digestive enzyme genes (Perera et al., 2008). The type and expression of these isoforms changed during

development as shown in the heat map (Fig. 2). The multiform of these genes indicated the complexity of gene expression regulation (Muhlia-Almazan et al., 2008) and the probability of gene expansion (Klein et al., 1998). The larval shrimp need to use different nutrients as energy resource during metamorphosis, so it is essential to keep the diversity of digestive enzymes and their differential expression patterns at transcriptional level to guarantee their completion of diet transition especially for a possible wide range of salinity, temperature and pH during early development (Hernandez and Murueta, 2009). The amylase gene is a member of a multigene family in many species and the alpha-amylase system is one of the extensively examined systems in the field of evolutionary research (Sellos et al., 2003). The variation in developmental and tissue-specific expression derives mainly from the mRNA abundance (Inomata and Yamazaki, 2002). The structure of the amylase genes in adult L. vannamei has been characterized and they showed a high degree of polymorphism (Van Wormhoudt and Sellos, 2003). Another amylase subfamily was identified in our dataset according to our phylogenetic tree analysis (Fig. 3), and this subfamily might appear during larval stages specifically to provide assistant hydrolysis function. Only one unigene in our dataset was categorized with the adult amylase genes, showing the different expression preference between larvae and adults. Amylases are located on two different chromosomes in Drosophila, in which up to seven copies have been detected and two groups were produced by duplication (Dalage et al., 1992; Inomata et al., 1995). Both coding and flanking regions are very divergent between the two duplication groups (Inomata and Yamazaki, 2000). According to our phylogenetic tree and multiple alignments, we inferred that there were also two groups for amylase in penaeid shrimp. The one detected in adult might be more adaptive for food digestion, while the other only provided facilitation of food digestion for larvae. 5. Conclusion Our study revealed the diverse and dynamic features of digestive enzymes during early development of L. vannamei. These results provided support to better understand the physiological changes during diet transition that occurred in this period. These digestive enzyme sequences obtained from the RNA-Seq will contribute to phylogenetics, development biology and functional gene research in shrimp.

42

J. Wei et al. / Comparative Biochemistry and Physiology, Part D 11 (2014) 37–44

Fig. 3. The maximum likelihood phylogenic tree and multiple sequence alignments of alpha amylase sequences. (A) Phylogenic tree. Group 1 contains amy lv d1–d6 and amy dp1, while group 2 contains amy lv 1–3, amy lv d7 and amy dp2; (B) multiple sequence alignments. Identical and similar amino acid residues were highlighted. Inserts (−) were added to maximize sequence identity. The putative Aamy domain was shown between arrows.

Table 4 Genes and their primers for quantitative real-time PCR validation. Unigene name

Nr annotation

Unigene size (bp)

qPCR primer (5′–3′)

CL3722.Contig3_All

Preamylase 1 [Litopenaeus vannamei]

1669

CL2613.Contig1_All

Trypsin [Litopenaeus vannamei]

1183

CL1205.Contig1_All

Chymotrypsin BII [Litopenaeus vannamei]

1052

Unigene1584_All

Triacylglycerol lipase [Litopenaeus vannamei]

1481

F: GTTCCTTACTCCGCTTTCG R: CGTAGTCAGTGCCTTGGTTC F: TCTGCTCGTTGCCCTCATC R: GGCTTCGCCTTCCACTTCT F: ATCTTGAACAATCCATAAAGCACCT R: ATGACGAACGACGACTGTGAC F: ACTGTCTCCTCTGCTCGTC R: ATGGTTTCTGGAATAGGTGTTT

J. Wei et al. / Comparative Biochemistry and Physiology, Part D 11 (2014) 37–44

43

Fig. 4. Relative expressions of transcriptome sequencing and qPCR of four unigenes in L. vannamei. X axis represents the developmental stages. Columns and bars represent the means and standard errors of qPCR result (Y axis at left). Lines represent the means of RPKM value (Y axis at right). (A) CL3722.Contig3_All (annotated as preamylase); (B) CL2613.Contig1_All (annotated as trypsin); (C) CL1205.Contig1_All (annotated as Chymotrypsin BII); (D) Unigene1584_All (annotated as triacylglycerol lipase).

Acknowledgment This work was supported by the National High-Tech Research and Development Program of China (863 program) (2012AA092205 and 2012AA10A404) and the National Natural Science Foundation of China (31172396 and 31272683). The authors would like to give sincere thanks to Dr. Hao Huang from Hainan Grandtop Ocean Breeding Co. Ltd. who kindly provided shrimp for this experiment. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cbd.2014.07.001. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Carrillo-Farnes, O., Forrellat-Barrios, A., Guerrero-Galvan, S., Vega-Villasante, F., 2007. A review of digestive enzyme activity in penaeid shrimps. Crustaceana 80, 257–275. Colbourne, J.K., Pfrender, M.E., Gilbert, D., Thomas, W.K., Tucker, A., Oakley, T.H., Tokishita, S., Aerts, A., Arnold, G.J., Basu, M.K., Bauer, D.J., Caceres, C.E., Carmel, L., Casola, C., Choi, J.H., Detter, J.C., Dong, Q.F., Dusheyko, S., Eads, B.D., Frohlich, T., GeilerSamerotte, K.A., Gerlach, D., Hatcher, P., Jogdeo, S., Krijgsveld, J., Kriventseva, E.V., Kultz, D., Laforsch, C., Lindquist, E., Lopez, J., Manak, J.R., Muller, J., Pangilinan, J., Patwardhan, R.P., Pitluck, S., Pritham, E.J., Rechtsteiner, A., Rho, M., Rogozin, I.B., Sakarya, O., Salamov, A., Schaack, S., Shapiro, H., Shiga, Y., Skalitzky, C., Smith, Z., Souvorov, A., Sung, W., Tang, Z.J., Tsuchiya, D., Tu, H., Vos, H., Wang, M., Wolf, Y.I., Yamagata, H., Yamada, T., Ye, Y.Z., Shaw, J.R., Andrews, J., Crease, T.J., Tang, H.X., Lucas, S.M., Robertson, H.M., Bork, P., Koonin, E.V., Zdobnov, E.M., Grigoriev, I.V., Lynch, M., Boore, J.L., 2011. The ecoresponsive genome of Daphnia pulex. Science 331, 555–561. Cuzon, G., Lawrence, A., Gaxiola, G., Rosas, C., Guillaume, J., 2004. Nutrition of Litopenaeus vannamei reared in tanks or in ponds. Aquaculture 235, 513–551.

Dai, Y., Wang, T.T., Wang, Y.F., Gong, X.J., Yue, C.F., 2009. Activities of digestive enzymes during embryonic development in the crayfish Procambarus clarkii (Decapoda). Aquac. Res. 40, 1394–1399. Dalage, J.L., Lemeunier, F., Cariou, M.L., David, J.R., 1992. Multiple amylase genes in Drosophila ananassae and related species. Genet. Res. 59, 85–92. Dall, W., Hill, B.J., Rothlisberg, P.C., Staples, D.J., 1990. The biology of the penaeidae. Adv. Mar. Biol. 27, 1–461. Danulat, E., 1986. The effects of various diets on chitinase and beta-glucosidase activities and the condition of cod, Gadus morhua (L). J. Fish Biol. 28, 191–197. de Hoon, M.J.L., Imoto, S., Nolan, J., Miyano, S., 2004. Open source clustering software. Bioinformatics 20, 1453–1454. Del Toro, M., Garcia-Carreno, F., Lopez, M.D., Celis-Guerrero, L., Saborowski, R., 2006. Aspartic proteinases in the digestive tract of marine decapod crustaceans. J. Exp. Zool. A 305A, 645–654. FAO, 2012. The State of World Fisheries and Aquaculture. Gildberg, A., 1988. Aspartic proteinases in fishes and aquatic invertebrates. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 91, 425–435. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X., Fan, L. , Raychowdhury, R., Zeng, Q.D., Chen, Z.H., Mauceli, E., Hacohen, N., Gnirke, A., Rhind, N., di Palma, F., Birren, B.W., Nusbaum, C., Lindblad-Toh, K., Friedman, N., Regev, A., 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29, 644–652. Hernandez, J.C.S., Murueta, J.H.C., 2009. Activity of trypsin from Litopenaeus vannamei. Aquaculture 290, 190–195. Hernandez-Cortes, P., Whitaker, J.R., Garcia-Carreno, F.L., 1997. Purification and characterization of chymotrypsin from Penaeus vannamei (Crustacea: Decapoda). J. Food Biochem. 21, 497–514. Huang, Q.S., Yan, J.H., Tang, J.Y., Tao, Y.M., Xie, X.L., Wang, Y., Wei, X.Q., Yan, Q.H., Chen, Q. X., 2010. Cloning and tissue expressions of seven chitinase family genes in Litopenaeus vannamei. Fish Shellfish Immunol. 29, 75–81. Inomata, N., Yamazaki, T., 2000. Evolution of nucleotide substitutions and gene regulation in the amylase multigenes in Drosophila kikkawai and its sibling species. Mol. Biol. Evol. 17, 601–615. Inomata, N., Yamazaki, T., 2002. Nucleotide variation of the duplicated amylase genes in Drosophila kikkawai. Mol. Biol. Evol. 19, 678–688. Inomata, N., Shibata, H., Okuyama, E., Yamazaki, T., 1995. Evolutionary relationships and sequence variation of alpha-amylase variants encoded by duplicated genes in the amy locus of Drosophila melanogaster. Genetics 141, 237–244. Jensen, R.G., 1983. Detection and determination of lipase (acylglycerol hydrolase) activity from various sources. Lipids 18, 650–657.

44

J. Wei et al. / Comparative Biochemistry and Physiology, Part D 11 (2014) 37–44

Johnston, D.J., 2003. Ontogenetic changes in digestive enzyme activity of the spiny lobster, Jasus edwardsii (Decapoda; Palinuridae). Mar. Biol. 143, 1071–1082. Klein, B., LeMoullac, G., Sellos, D., VanWormhoudt, A., 1996. Molecular cloning and sequencing of trypsin cDNAs from Penaeus vannamei (Crustacea, Decapoda): use in assessing gene expression during the moult cycle. Int. J. Biochem. Cell Biol. 28, 551–563. Klein, B., Sellos, D., Van Wormhoudt, A., 1998. Genomic organisation and polymorphism of a crustacean trypsin multi-gene family. Gene 216, 123–129. Kono, M., Matsui, T., Shimizu, C., Koga, D., 1990. Purifications and some properties of chitinase from the liver of a prawn, Penaeus japonicus. Agric. Biol. Chem. 54, 2145–2147. Le Chevalier, P., Sellos, D., Van Wormhoudt, A., 2000. Molecular cloning of a cDNA encoding alpha-glucosidase in the digestive gland of the shrimp, Litopenaeus vannamei. Cell. Mol. Life Sci. 57, 1135–1143. Le Vay, L., Jones, D.A., Puello-Cruz, A.C., Sangha, R.S., Ngamphongsai, C., 2001. Digestion in relation to feeding strategies exhibited by crustacean larvae. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 128, 623–630. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(T)(−delta delta C) method. Methods 25, 402–408. Lovett, D.L., Felder, D.L., 1990. Ontogenic change in digestive enzyme activity of larval and postlarval white shrimp Penaeus setiferus (crustacea, decapoda, penaeidae). Biol. Bull. 178, 144–159. Ma, P., Sivaloganathan, B., Reddy, P.K., Chan, W.K., Lam, T.J., 2001. Ontogeny of alphaamylase gene expression in sea bass larvae (Lates calcarifer). Mar. Biotechnol. 3, 463–469. Muhammad, F., Zhang, Z.F., Shao, M.Y., Dong, Y.P., Muhammad, S., 2012. Ontogenesis of digestive system in Litopenaeus vannamei (Boone, 1931) (Crustacea: Decapoda). Ital. J. Zool. 79, 77–85. Muhlia-Almazan, A., Sanchez-Paz, A., Garcia-Carreno, F.L., 2008. Invertebrate trypsins: a review. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 178, 655–672. Perera, E., Moyano, F.J., Diaz, M., Perdomo-Morales, R., Montero-Alejo, V., Alonso, E., Carrillo, O., Galich, G.S., 2008. Polymorphism and partial characterization of digestive enzymes in the spiny lobster Panulirus argus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 150, 247–254. Pertea, G., Huang, X.Q., Liang, F., Antonescu, V., Sultana, R., Karamycheva, S., Lee, Y., White, J., Cheung, F., Parvizi, B., Tsai, J., Quackenbush, J., 2003. TIGR Gene Indices clustering tools (TGICL): a software system for fast clustering of large EST datasets. Bioinformatics 19, 651–652. Proespraiwong, P., Tassanakajon, A., Rimphanitchayakit, V., 2010. Chitinases from the black tiger shrimp Penaeus monodon: phylogenetics, expression and activities. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 156, 86–96. Puello-Cruz, A.C., Sangha, R.S., Jones, D.A., Le Vay, L., 2002. Trypsin enzyme activity during larval development of Litopenaeus vannamei (Boone) fed on live feeds. Aquac. Res. 33, 333–338.

Qian, Z., He, S., Liu, T., Liu, Y., Hou, F., Liu, Q., Wang, X., Mi, X., Wang, P., Liu, X., 2014. Identification of ecdysteroid signaling late-response genes from different tissues of the Pacific white shrimp, Litopenaeus vannamei. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 172, 10–30. Rivera-Perez, C., del Toro, M., Garcia-Carreno, F.L., 2010. Digestive lipase activity through development and after fasting and re-feeding in the whiteleg shrimp Penaeus vannamei. Aquaculture 300, 163–168. Rivera-Perez, C., Garcia-Carreno, F.L., Saborowski, R., 2011. Purification and biochemical characterization of digestive lipase in whiteleg shrimp. Mar. Biotechnol. 13, 284–295. Rojo, L., Garcia-Carreno, F., del Toro, M.D.N., 2013. Cold-adapted digestive aspartic protease of the clawed lobsters Homarus americanus and Homarus gammarus: biochemical characterization. Mar. Biotechnol. 15, 87–96. Saldanha, A.J., 2004. Java Treeview — extensible visualization of microarray data. Bioinformatics 20, 3246–3248. Sellos, D., Van Wormhoudt, A., 1999. Polymorphism and evolution of collagenolytic serine protease genes in crustaceans. Biochim. Biophys. Acta Protein Struct. Mol. Enzymol. 1432, 419–424. Sellos, D., Moal, J., Degremont, L., Huvet, A., Daniel, J.Y., Nicoulaud, S., Boudry, P., Samain, J.F., Van Wormhoudt, A., 2003. Structure of amylase genes in populations of pacific cupped oyster (Crassostrea gigas): tissue expression and allelic polymorphism. Mar. Biotechnol. 5, 360–372. Shahidi, F., Kamil, Y., 2001. Enzymes from fish and aquatic invertebrates and their application in the food industry. Trends Food Sci. Technol. 12, 435–464. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tan, S.H., Degnan, B.M., Lehnert, S.A., 2000. The Penaeus monodon chitinase 1 gene is differentially expressed in the hepatopancreas during the molt cycle. Mar. Biotechnol. 2, 126–135. Van Wormhoudt, A., Sellos, D., 2003. Highly variable polymorphism of the alpha-amylase gene family in Litopenaeus vannamei (Crustacea decapoda). J. Mol. Evol. 57, 659–671. VanWormhoudt, A., Sellos, D., 1996. Cloning and sequencing analysis of three amylase cDNAs in the shrimp Penaeus vannamei (Crustacea decapoda): Evolutionary aspects. J. Mol. Evol. 42, 543–551. Wang, Z., Gerstein, M., Snyder, M., 2009. RNA-Seq: a revolutionary tool for transcriptomics. Nat. Rev. Genet. 10, 57–63. Zhao, Z.Y., Yin, Z.X., Weng, S.P., Guan, H.J., Li, S.D., Xing, K., Chan, S.M., He, J.G., 2007. Profiling of differentially expressed genes in hepatopancreas of white spot syndrome virus-resistant shrimp (Litopenaeus vannamei) by suppression subtractive hybridisation. Fish Shellfish Immunol. 22, 520–534.