Developmental and Comparative Immunology 46 (2014) 231–240

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Identification of a C-type lectin with antiviral and antibacterial activity from pacific white shrimp Litopenaeus vannamei Ming Li a,c,1, Chaozheng Li a,1, Chunxia Ma d, Haoyang Li a, Hongliang Zuo a, Shaoping Weng a, Xiaohan Chen c, Digang Zeng c, Jianguo He a,b,⇑, Xiaopeng Xu a,⇑ a

MOE Key Laboratory of Aquatic Product Safety/State Key Laboratory for Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, PR China School of Marine Sciences, Sun Yat-sen University, Guangzhou, PR China Guangxi Key Laboratory of Aquatic Genetic Breeding and Healthy Aquaculture, Guangxi Institute of Fisheries, Nanning, PR China d Guangxi Veterinary Research Institute, Guangxi University, Nanning, PR China b c

a r t i c l e

i n f o

Article history: Received 9 February 2014 Revised 20 April 2014 Accepted 22 April 2014 Available online 1 May 2014 Keywords: C-type lectin Litopenaeus vannamei NF-jB signaling pathway Innate immunity Agglutination WSSV

a b s t r a c t C-type lectins (CTLs) play crucial roles in innate immune responses in invertebrates by recognizing and eliminating microinvaders. In this study, a CTL from pacific white shrimp Litopenaeus vannamei (LvCTL3) was identified. LvCTL3 contains a single C-type lectin-like domain (CTLD), which shows similarities to those of other shrimp CTLs and has a mutated ‘EPD’ motif in Ca2+-binding site 2. LvCTL3 mRNA can be detected in all tested tissues and expression of LvCTL3 in gills was up-regulated after Lipopolysaccharides, poly (I:C), Vibrio parahaemolyticus and white spot syndrome virus (WSSV) challenges, suggesting activation responses of LvCTL3 to bacterial, virus and immune stimulant challenges. The 50 flanking regulatory region of LvCTL3 was cloned and we identified a NF-jB binding motif in the LvCTL3 promoter region. Dual-luciferase reporter assays indicated that over-expression of L. vannamei dorsal can dramatically up regulate the promoter activity of LvCTL3, suggesting that LvCTL3 expression could be regulated through NF-jB signaling pathway. As far as we know, this is the first report on signaling pathway involve in shrimp CTLs expression. The recombinant LvCTL3 protein was expressed in Escherichia coli and purified by Ni-affinity chromatography. The purified LvCTL3 can agglutinate Gram-negative microbe Vibrio alginolyticus and V. parahaemolyticus and Gram-positive bacteria Bacillus subtilis in the presence of calcium ions, but cannot agglutinate Gram-positive bacteria Streptococcus agalactiae. The agglutination activity of LvCTL3 was abolished when Ca2+ was chelated with EDTA, suggesting the function of LvCTL3 is Ca2+dependent. In vivo challenge experiments showed that the recombinant LvCTL3 protein can significantly reduce the mortalities of V. parahemolyticus and WSSV infection, indicating LvCTL3 might play significant roles in shrimp innate immunity defense against bacterial and viral infection. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Innate immunity is the main defense for invertebrates against threats from pathogens (Akira, 2009; Akira et al., 2006). Similar to those in vertebrates, innate immune responses against non-self invaders in invertebrates are initiated and primed by immune recognition (Akira, 2009; Akira et al., 2006). A range of germline-encoded molecules termed pattern recognition receptors ⇑ Corresponding authors. Address: School of Life Sciences, School of Marine Sciences, Sun Yat-sen (Zhongshan) University, Guangzhou 510275, PR China. Tel.: +86 20 39332988; fax: +86 20 84113229 (J. He). Address: School of Life Sciences, Sun Yat-sen (Zhongshan) University, Guangzhou 510275, PR China. Tel.: +86 20 84113793; fax: +86 20 84113229 (X. Xu). E-mail addresses: [email protected] (J. He), [email protected] (X. Xu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.dci.2014.04.014 0145-305X/Ó 2014 Elsevier Ltd. All rights reserved.

(PRRs) that can recognize evolutionarily conserved pathogen-associated molecular patterns (PAMPs) on the surface of invading microorganisms play essential roles during the immune recognition process (Akira, 2009; Akira et al., 2006). In invertebrates, a number of PRRs have been identified, including Toll-like receptors (TLRs), scavenger receptors (SCRs), thioester-containing proteins (TEPs), peptidoglycan recognition proteins (PGRPs), Gram-negative binding proteins (GNBPs), fibrinogen-related proteins (FREPs), and lectins (Medzhitov, 2007; Iwanaga and Lee, 2005; Kim and Kim, 2005; Beutler, 2004). They can recognize many different PAMPs, such as lipopolysaccharide (LPS) from Gram-negative bacteria, peptidoglycan and lipoteichoic acid (LTA) from Gram-positive bacteria, mannans from fungi, and double stranded RNAs or glycoproteins from viruses, and then trigger a series of antimicrobial responses (Medzhitov, 2007; Iwanaga and Lee, 2005; Kim and Kim, 2005; Beutler, 2004).

232

M. Li et al. / Developmental and Comparative Immunology 46 (2014) 231–240

C-type lectins (CTLs), a large super-family of lectins characterized by containing at least one C-type lectin-like domains (CTLDs), are present in almost all living organisms (Robinson et al., 2006; Ofek et al., 2000). CTLs bind specific carbohydrates on the surfaces of pathogens through CTLD in the presence of calcium ions (Robinson et al., 2006; Ofek et al., 2000; Vasta et al., 1999; Drickamer, 1999). CTLD, the carbohydrate recognition domain (CRD) of CTLs commonly 110–130 residues in length, has a characteristic double-loop stabilized by two conserved disulfide bonds, and contains four Ca2+-binding sites involved in structure maintenance and carbohydrates binding (Robinson et al., 2006; Ofek et al., 2000; Vasta et al., 1999; Drickamer, 1999). The Ca2+-binding site 2 of most CTLs has a conserved ‘EPN’ or ‘QPD’ motif that is important for mannose or galactose binding, respectively (Robinson et al., 2006; Ofek et al., 2000; Vasta et al., 1999; Drickamer, 1999). A number of CTLs have been identified in various invertebrates, such as nematodes, shellfishes, insects and crustaceans (Wang et al., 2013; Boman and Hultmark, 1987; Wang and Wang, 2013; Schulenburg et al., 2008). Invertebrate CTLs work to eliminate invading pathogens through directly agglutinating or killing microorganisms, stimulating melanization or hemocyte encapsulation, and promoting signal transduction to evoke humoral immune responses. CTLs from shrimps are representative ones among invertebrates CTLs (Ofek et al., 2000; Wang and Wang, 2013). They usually contain one or two CTLDs and their expressions can be activated by pathogen infection or stimulant challenge (Vasta et al., 1999; Schulenburg et al., 2008). In recent years, a growing number of CTLs have been reported in pacific white shrimp Litopenaeus vannamei, Chinese white shrimp Fenneropenaeus chinensis, tiger prawn Penaeus monodon, kuruma prawn Marsupenaeus japonicus, and banana shrimp Fenneropenaeus merguiensis (Schulenburg et al., 2008; Zhang et al., 2009; Zhao et al., 2009; Junkunlo et al., 2012; Lai et al., 2013; Liu et al., 2007; Rattanaporn and Utarabhand, 2011; Rittidach et al., 2007). Shrimps are susceptible to a wide range of pathogens that bring great damages to farming industry (Mine and Boopathy, 2011). Exploring novel CTLs in shrimps is important for understanding the crustacean innate immune system and can help develop tools and strategies for protecting shrimps against pathogen infections. In this study, a CTL from L. vannamei, termed LvCTL3 distinguished from previously identified LvCTL1 and LvCTL2 (Wei et al., 2012), with agglutination activity was identified and its anti-bacterial and anti-viral activities were examined in vivo. Moreover, dual-luciferase reporter assays showed that expression of LvCTL3 was promoted by LvDorsal, suggesting that LvCTL3 expression could be regulated through NF-jB signaling pathway.

the nested PCR was subsequently performed with NUP and LvCTL3–3RACE2. The second PCR products were cloned into pMD-20T vector (TaKaRa, Japan) and 12 positive clones were selected and sequenced (ABI PRISM, Applied Biosystems, USA). 50 -RACE is a technique used in molecular biology to obtain the 50 UTR of a transcript and identify the transcription starting site (TSS) of promoter elements (Olivarius et al., 2009; Scotto-Lavino et al., 2006). TSS of LvCTL3 is determined according to the 50 -RACE PCR amplification. 2.2. Genome walking Genome walking is a technology to identify the flanking genomic segments (e.g. promoter regions) adjacent to a known sequence (Leoni et al., 2008). The 50 flanking regulatory region of LvCTL3 was isolated by Genome walking method. The L. vannamei genome DNA was prepared according to the protocol as previously described (Koyama et al., 2010). Genome walking libraries were constructed by GenomeWalker™ Universal Kit (Clontech, Japan) according to the manufacturer’s recommendations. The primer pairs AP1/50 GW-LvCTL3–1 and AP2/50 GW-LvCTL3–2 were used to perform the first and second rounds of genome walking PCR amplification, respectively. The amplicon was cloned to pMD-20T vector (TaKaRa, Japan) and sequenced. 2.3. Bioinformatics analysis Protein sequences of C-type lectin homologs from other species were retrieved from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/) databases using the BLAST program (basic local alignment search tool). The CTLD domain of LvCTL3 were modeled by homology using 3D-JIGSAW webserver tool (http://bmm.cancerresearchuk.org/~3djigsaw/) with the default settings. Sequence alignments between LvCTL3 and CTLs from other species were analyzed using clustal X v2.0 program (Aiyar, 2000) and were visualized by Espript3.0 (http:// espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). Phylogenetic trees were constructed based on the deduced amino acid sequences using MEGA 5.0 software, applying the amino acid substitution type and poisson model and bootstrapping procedure with a minimum of 1000 bootstraps (Tamura et al., 2011). Protein domains were predicted using the SMART program (http://smart.embl-heidelberg.de/). The 50 flanking promoter sequences of LvCTL3 were analyzed for potential transcription factor binding sites with TRANSFACÒ 6.0 program (Wingender, 2008) using high quality matrices and 0.85 as matrix and core similarity cut-off.

2. Materials and methods

2.4. Real-time RT-PCR

2.1. Cloning of the shrimp LvCTL3 cDNA

Healthy specific-pathogen-free (SPF) shrimp L. vannamei with an average weight of 5 g were obtained from national SPF L. vannamei farm of Fangchenggang, Gunagxi province. For tissue expression analysis, shrimp tissues, including hepatopancreases, hemocytes, gills, eyestalks, muscles, scapes, epitheliums, pyloric ceca, intestines, and stomachs were sampled and pooled from 15 shrimps. For challenge experiments, shrimps were cultured in salt-water tanks at room temperature (27 °C) and divided into 4 experimental groups, in which L. vannamei was injected at the second abdominal segment with 2 lg/ll poly (I:C), 2 lg/ll LPS, 106 CFU (colony-forming unit) of Vibrio parahaemolyticus, and 106 copies newly extracted WSSV particles in 50 ll DEPC-treated water prepared PBS solution (pH 7.4), respectively, as well as a control group injected with 50 ll PBS (Ai et al., 2008). Gills of challenged shrimps were sampled at 0, 4, 8, 12, 24, 36, 48, 72 h post injection

A partial cDNA sequence that is homologous to shrimp CTLs was retrieved from the sequenced L. vannamei transcriptome data (Li et al., 2012). The full length cDNA sequence was then obtained using the rapid amplification of cDNA ends (RACE) method. Briefly, total RNA was extracted from L. vannamei gills with the RNeasy Plus Mini Kit (QIAGEN, USA). The cDNA template for RACE-PCR was prepared using the SMARTer™ RACE cDNA Amplification kit (Clontech, Japan). 50 -RACE-PCR amplification was performed with Universal Primer A Mix (UPM) and LvCTL3 specific reverse primer 5RACE1. Nested PCR was subsequently performed with Nested Universal Primer A (NUP) and LvCTL3–5RACE2 using the firstround PCR product as template. 30 -RACE-PCR was performed using UPM together with an LvCTL3-specific forward primer 3RACE1, and

M. Li et al. / Developmental and Comparative Immunology 46 (2014) 231–240 Table 1 Summary of primers in this study. Name

Sequence (50 –30 )

RACE LvLectin3–3RACE1 LvLectin3–3RACE2 LvLectin3–5RACE1 LvLectin3–5RACE2

GACGGACGGGACGGCGGTCAAGATG TGACCAGGTTCAGGAGCCCGACAGT AGTTCTTCCCCTCGTACCACGAGAC GAAAACCTCCATCACAAACTCTCTG

Genome walking 50 GW-LvCTL3–1 AP1 50 GW-Lv CTL3–2 AP2

GGATTGGAGAGCCTGTCAGCAGT GTAATACGACTCACTATAGGGC GCAGGAGCACGAAGAACATCATTTTG ACTATAGGGCACGCGTGGT

Dual-luciferase reporter assay pGL3-LvCTL3-F GGGGTACCGTGTTATTTTGTATAATGCATTCACAC pGL3-LvCTL3-R GGCTCGAGAGAACATCATTTTGTGCGTTTGTAT pGL3-LvCTL3-jBmutant-F GGCACAGACTCCTAACAAAATCCGCCAGCTGTC ACCTATCTCG pGL3-LvCTL3-jBmutant-R GTGACAGCTGGCGGATTTTGTTAGGAGTCTGTG CCTTGTT

233

2.6. Dual-luciferase reporter assays Drosophila S2 cells were cultured at 28 °C in Drosophila SDM (Serum-Free Medium; Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen). For DNA transfection, Cell plating and transfection are performed on the same day, and plasmids were transfected using the Effectene Transfection Reagent (Qiagen) according to the manufacturer’s protocol. For dual-luciferase reporter assays, S2 cells in each well of a 96-well plate (TPP, Switzerland) were transfected with 0.05 lg reporter gene plasmids, 0.005 lg pRL-TK renilla luciferase plasmid (Promega), and 0.05 lg (0.02 or 0.03 lg) expression plasmids or empty pAc5.1/ V5-His A plasmid (as control). The pRL-TK renilla luciferase plasmid was used here as an internal control. At 48 h post transfection, Dual-Luciferase Reporter Assays were performed to measure the firefly and renilla luciferase activities according to the manufacturer’s instructions. Each experiment was done at least three times. 2.7. Expression and purification of recombinant LvCTL3

Real-time RT-PCR LvEF-1a-F LvEF-1a-R LvLectin3-F LvLectin3-R

TATGCTCCTTTTGGACGTTTTGC CCTTTTCTGCGGCCTTGGTAG ATGTTCTTCGTGCTCCTGCTGT GCAGTGGTCGTAAATGTTGTG

Protein expression LvLectin3-F LvLectin3-R

TCTCAATCACCCAACGCCCAGAG TTTCTCACAGATAATGGCTTCTGGA

(hpi), and each time point sample was collected and pooled from 15 shrimps. Total RNA was isolated with the TRIzol reagent and subsequently reverse transcribed to cDNA using PrimeScript RT Reagent Kit (TaKaRa) according to the manufacturer’s instructions. Reactions were performed in the LightCycler 480 System (Roche, Germany) according to the manufacturer’s protocol. Real-time RT-PCR assays were performed at a volume of 10 ll comprised of 1 ll of 1:10 cDNA diluted with ddH2O, 5 ll of 2 SYBRGreen Master Mix (Takara, Japan), and 250 nM of each primer. The cycling parameters were 95 °C for 2 min to activate the polymerase, followed by 40 cycles of 95 °C for 15 s, 62 °C for 1 min, and 70 °C for 1 s. Cycling ended at 95 °C with 5 °C/s calefactive velocity to create the melting curve. Fluorescence measurements were taken at 70 °C for 1 s during each cycle. Expression levels of LvCTL3 were calculated using the Livak (244CT) method after normalization to EF-1a (GenBank accession No. GU136229). Primer sequences are listed in Table 1.

2.5. Plasmid constructions The pGL3-jB vector was obtained by cloning the promoter sequence of LvCTL3 amplified by PCR using the primer pairs pGL3-LvCTL3-F/pGL3-LvCTL3-R from L. vannamei genome DNA into pGL3-Basic (Promega) vector at KpnI/XhoI sites. The overlap extension polymerase chain reaction are performed to construct vector of pGL3-jB mutant (named as pGL3-jBm) containing promoters of LvCTL3, with an NF-jB binding motif (AGGAATTTCC) deletion in its sequence. Firstly, two overlapping DNA fragments were amplified from pGL3-jB using the primer pair pGL3LvCTL3-F/pGL3-LvCTL3-jBmutant-R and pGL3-LvCTL3-jBmutantF/pGL3-LvCTL3-R, respectively. Then a single product was obtained by PCR using the two separate DNA fragments pooled as templates with the primer pairs pGL3-LvCTL3-F/pGL3-LvCTL3-R and was subcloned to pGL3-Basic (Promega) vector at KpnI/XhoI sites. The LvDorsal expression vector was obtained from previous study (Huang et al., 2010).

The open reading frame (ORF) of LvCTL3 without the signal peptide coding sequence was amplified using specific primers Re-F and Re-R and cDNA from shrimp gills as template and cloned into the pEASY™-E2 vector (pEASY™-E2 Expression Kit, TransGen Biotech, China). Recombinant plasmid was transformed into Escherichia coli strain Rosetta (DE3) (Qiagen, Germany) cells, which were subsequently induced by 0.1 mM isopropyl-b-D-thiogalactosidase (IPTG) for expression of recombinant proteins. Bacterial cells were harvested and sonicated, and the inclusion bodies were obtained, washed with 2 M urea in PBS buffer and dissolved in 8 M urea. The 6His-tagged LvCTL3 proteins were then purified with Ni–NTA agarose (Qiagen, Germany) under denaturing conditions and refolded by gradient dialysis against PBS buffer. The purified proteins were analyzed by Western-blot using mouse anti-6His antibody (TransGen Biotech, China) as the primary antibody. Concentration of the purified protein was determined using a BCA protein assay kit (ComWin Biotech, China). 2.8. Analysis of the microbe agglutinating specificity of LvCTL3 Gram-negative bacteria Vibrio alginolyticus and V. parahaemolyticus and Gram-positive bacteria Streptococcus agalactiae and Bacillus subtilis were labeled by 5 lg/ml fluorescein isothiocyanate (FITC), and resuspended in TBS-Ca buffer (50 mM Tris–HCl, 100 mM NaCl, 10 mM CaCl2, pH 7.5) at 1  106 CFU/ml (for Gram-negative bacteria) or 1  106 CFU/ml (for Gram-positive bacteria). 10 ll of bacteria were mixed with 20 ll LvCTL3 (0.1 mg/ml) or the control pEASY expression protein (0.1 mg/ml, a 27 kDa 6His fusion protein expressed by the control pEASY vector supplied with pEASY™-E2 Expression Kit, TransGen Biotech, China), followed by incubation at 25 °C for 1 h. Agglutination was observed with a Nikon TE2000 microscope (Japan) at 488 nm for FITC. To determine whether agglutination was calcium-dependent, FITClabeled microbe was incubated with LvCTL3 in TBS-EDTA buffer (50 mM Tris–HCl, 100 mM NaCl, 4 mM EDTA, pH 7.5) as described above. 2.9. In vivo anti-pathogen activity of recombinant LvCTL3 Healthy shrimps (average 5 g and n = 30 in each group) were injected with 50 ll PBS buffer containing 105 particles of WSSV or 105 CFU of V. alginolyticus together with 2 lg LvCTL3 or the control pEASY expression protein (as control), respectively. (Expression of the control pEASY vector [supplied with pEASY™-E2 Expression Kit, TransGen Biotech, China], which encodes a protein with a molecular weight of 27 kDa, was performed in E. coli Rosetta

234

M. Li et al. / Developmental and Comparative Immunology 46 (2014) 231–240

(DE3) cells, and the control pEASY-His-tag expression protein was purified according to the same method described under ‘‘Expression and purification of recombinant LvCTL3’’ above.) Shrimps were also singly injected with PBS with or without pathogens as positive or negative infection controls, respectively. Experiments were repeated triply and cumulative mortality was recorded every day. Differences in mortality between the experimental groups and the control groups were tested for statistical significance using the Kaplan–Meier plot (log-rank v2 test). The statistical procedures were carried out using MedCalc statistical software version 11.2 (Mariakerke, Belgium) (Schoonjans et al., 1995). 3. Results 3.1. Characteristic of the LvCTL3 full-length cDNA and 50 flanking promoter sequences The products of 30 and 50 RACE for LvCTL3 is 579 bp with an ORF of 492 bp encoding a protein of 163 amino acids with a calculated molecular weight of 18.67 kDa and a theoretical isoelectric point of 4.80. LvCTL3 contains a single CTLD and a putative signal peptide of 16 residues, suggesting it could be a secreted protein. Conserved domain analysis using the SMART program showed that LvCTL3 has a single CTLD (Figs. 1 and 2C). The 50 flanking promoter sequences of LvCTL3 is 195 bp long and has a conserved TATA box sequence (TATAAA) located 22 base pairs upstream of the transcription start site (TSS) (Fig. 1). The transcription factor binding sites analysis with TRANSFACÒ 6.0 program shows that a conserved NF-jB (dorsal) binding motif at 103 to 93, suggesting that LvCTL3 expression could be regulated by NF-jB (Fig. 1). 3.2. Homology and phylogenetic analysis of LvCTL3 The full amino acid sequences of LvCTL3 and other CTLs from shrimps as well as other animals, including Danio rerio, Rattus norvegicus and Homo sapiens, were subjected to phylogenetic analysis by the neighbor-joining (NJ) method using MEGA5.0 software. According to the NJ phylogenetic tree (Fig. 2B), CTLs could been

clustered to invertebrates and vertebrates gourp and LvCTL3 is closely clustered with FiCTL from Fenneropenaeus indicus (GenBank Accession No. ADV17348.1) and SpCTL from Scylla paramamosain (AEO92001.1). Multiple sequence alignment showed that the CTLD of LvCTL3 is conversed and consists of two a helices and seven b strands (Fig. 2A). LvCTL3 CTLD domain contains four disulphidebonded cysteine residues (Cys30, Cys41, Cys58, and Cys137) and an ‘EPN’ motif mutated to ‘EPD’ in the Ca2+-binding site 2 (Figs. 1 and 2A).

3.3. Tissue distribution of LvCTL3 Realtime RT-PCR demonstrated that LvCTL3 mRNA is low abundant in the hepatopancreas, moderately abundant in the stomach, pyloric caecum, epithelium, muscle eyestalk, scape, and intestine, and high abundant in the hemocytes and gills with levels 8.6and 9.0-fold over that in the hepatopancreas (Fig. 3A).

3.4. Expression of LvCTL3 in hemocytes of pathogen- and stimulantchallenged shrimps Real-time RT-PCR was used to detect the expression of LvCTL3 in gills from shrimps challenged with LPS, poly (I:C), V. parahemolyticus, WSSV, and PBS (as control), respectively. In response to LPS, LvCTL3 showed a continuously up-regulation expression profile from 4 to 36 hpi with a peak of 7.72-fold at 12 hpi followed by returning back to levels of 4.12-fold at 48 hpi and baseline levels at 72 hpi (Fig. 3C). During V. parahemolyticus challenge, the expression of LvCTL3 continuously increased with a peak of 5.51-fold at 24 hpi (Fig. 3D). During poly (I:C) challenge, LvCTL3 significantly up-regulated during 4–12 hpi with a peak of 4.39-fold at 8 hpi and then slowly returned to basal levels at 24–72 hpi (Fig. 3E). After WSSV infection, the LvCTL3 expression levels kept acutely increasing from 4 to 36 hpi with a peak of 21.00-fold at 12 hpi followed by returning back to the baseline levels at 48–72 hpi (Fig. 3F). The control group injected by PBS showed no obvious change of LvCTL3 expression (Fig. 3B).

Fig. 1. The 50 flanking sequence and full lengths cDNA sequence of LvCTL3 gene. The ORF of the nucleotide sequence is shown in upper-case letters, while the promoter, 50 and 30 -UTRs sequences are shown in lowercase. Nucleotides and amino acids are numbered on the left of the sequences. The putative signal peptide is underlined in black, the CTLD predicted by SMART program is shaded and the mutated EPD motif is boxed. Putative NF-jB (Dorsal) binding motif site in the promoter region is underlined with red line, while the transcription start site (TSS) is shown in red, and the poly A signal is underlined with blue line. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

M. Li et al. / Developmental and Comparative Immunology 46 (2014) 231–240

235

Fig. 2. Phylogenetic tree construction and multiple sequence alignment of CTLs from various species. (A) Multiple sequence alignment of the CTLD region of CTLs with the identical amino acid residues shaded in red and the similar residues boxed. (B) Neighbor-joining phylogenetic tree analysis of the full-length amino acid sequences of CTLs. LvCTL3 was marked with black triangle. (C) The schematic representation of the LvCTL3 protein. Proteins analyzed list below: LvCTL3 from L. vannamei (Accession No. AGV68681.1); BtCTL from Bos taurus (Accession No. NP_001180046.1); ClfCTL from Canis lupus familiaris (Accession No. XP_005637254.1); DrCTL from Danio rerio (Accession No. XP_005172687.1); EsCTL from Eriocheir sinensis (Accession No. ADK66338.1); FcCTL from Fenneropenaeus chinensis (Accession No. ABA54612.1); FiCTL from Fenneropenaeus indicus (Accession No. ADV17348.1); FmCTL from Fenneropenaeus merguiensis (Accession No. AEB96259.1); HsCTL from Homo sapiens (Accession No. CAA65480); LvCTL from L. vannamei (Accession No. DQ858900); PcCTL from Procambarus clarkia (Accession No. ADX60057.1); PmCTL from Penaeus monodon (Accession No. AAZ29608.1); RnCTL from Rattus norvegicus (Accession No. XP_006237382.1); SpCTL from Scylla paramamosain (Accession No. AEO92001.1); SsCTL from Salmo salar (Accession No. ACI68944.1). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.5. NF-jB regulates the expression of LvCTL3 The pGL3-jB and pGL3-jBm vector containing the 195 bp promoter region of LvCTL3 with or deletion of the putative NF-jB (dorsal) binding motif (AGGAATTTCC) were constructed (Fig. 4A). Dual-Luciferase Reporter Assay showed that over-expression of LvDorsal could significantly increase pGL3-jB activity but had no impact on pGL3-jBm (Fig. 4B). Moreover, the pGL3-jB activity was increased at a rate proportionate to the amount of LvDorsal (Fig. 4B), suggesting that LvCTL3 promoter activity stimulated by LvDorsal was dose-dependent manner. 3.6. Expression and purification of recombinant LvCTL3 The LvCTL3 protein was recombinantly expressed in E. coli. The recombinant protein, mainly expressed as inclusion bodies, was analyzed by SDS–PAGE and purified by Ni-affinity chromatography under denaturing conditions and refolded by dialysis against PBS (Fig. 5A). The purified protein was verified by Western blot analysis using monoclonal antibody against the His tag, which showed a specific band consistent with the predicted molecular weight of the LvCTL3–6His fusion protein (18 kDa) (Fig. 5B). 3.7. Microbe agglutinating activity of LvCTL3 The agglutinating activity of recombinant LvCTL3 protein was investigated using FITC-labeled microbes. Gram-negative microbe V. alginolyticus and V. parahaemolyticus and Gram-positive bacteria

B. subtilis can be agglutinated by incubation with 60 lg/ml LvCTL3 in the presence of Ca2+, and the agglutination can be abolished when Ca2+ is chelated with EDTA, suggesting that LvCTL3 agglutination activity is Ca2+-dependent (Fig. 6). However, LvCTL3 showed no agglutination activity for Gram-positive bacteria S. agalactiae even in higher protein concentrations (Fig. 6). The control pEASY expression protein within His-tag have no bacteria agglutination activity (Fig. 6). 3.8. In vivo anti-pathogenic microorganism activity of recombinant LvCTL3 To investigate the anti-pathogenic activity of LvCTL3, healthy shrimps were injected with WSSV, or V. alginolyticus together with purified recombinant LvCTL3 or the control pEASY expression protein (as control group), respectively, and the positive and negative infection control shrimps were singly injected with PBS containing or not containing pathogens. Fig. 7 shows one of the triply independently repeated experiments, which exhibited similar results (data not shown). During V. parahemolyticus infection, cumulative mortality of LvCTL3 group was significantly lower than those of the control group, starting at 4 days post infection (dpi) (Kaplan– Meier log-rank v2: 17.39, P < 0.0001). Final mortalities at 9 dpi were 60%, 100% and 90% for the LvCTL3-, pEASY- and PBS-V. alginolyticus challenged groups, respectively. LvCTL3 can significantly reduce the mortality caused by WSSV infection compared with the control group (Kaplan–Meier log-rank v2: 22.31, p < 0.0001), with a final mortality at 11 dpi of 56% for the LvCTL3-treated group

236

M. Li et al. / Developmental and Comparative Immunology 46 (2014) 231–240

Fig. 3. Tissue distribution of LvCTL3 mRNA in healthy L. vannamei and its expression profiles in gills from pathogens or stimulants challenged shrimps. Real-time RT-PCR was performed in triplicate for each sample. Expression values were normalized to those of LvEF-1a using the Livak (244CT) method and the data were provided as the mean fold changes (means ± S.D., n = 3) relative to the control group. (A) Transcription levels of LvCTL3 in tissues of healthy shrimps. Expression level in the hepatopancreas was used as control and set to 1.0. (B–F) Expression profiles of LvCTL3 in hemocytes from PBS, LPS, V. parahemolyticus, poly (I:C), and WSSV challenged shrimps. Expression level at 0 h post injection of each group was set as 1.0. (⁄p < 0.05, ⁄⁄p < 0.01).

as well as 100% and 100% for the PBS- and pEASY groups, respectively. 4. Discussion The term ‘C-type lectin’ refers to the Ca2+-dependent (C-type) carbohydrate-binding lectin, of which the CTLD mediates the carbohydrate- and Ca2+ binding activities (Drickamer, 1999). The newly identified L. vannamei LvCTL3 protein in this study contains a domain homologous to CTLDs from other animals, and has a Ca2+dependent bacterial agglutinating activity which can be abolished by EDTA, suggesting LvCTL3 truly belongs to the CTL family. According to the data from GenBank, since the first CTL was identified from L. vannamei in 2007, more than 28 CTLs from shrimps have been cloned up to now (Wang and Wang, 2013). Their lengths range from 156 to 347 amino acid residues containing one or two CTLD. Besides the CTLD, a few shrimp CTLs also contain an additional domain or motif, such as the low-density lipoprotein receptor class A (LDLA) domain, the leucine-rich

repeats (LRR), or the transmembrane sequence, indicating the variety of the biological functions of shrimp CTLs. Most of the shrimp CTLDs contain the conserved EPN or QPD motif, and others contain mutated motifs, such as EPD, EPK, EPS, EPQ, QPN, and QPT, which have also been found in CTLDs form other animals (Wang and Wang, 2013). Up to now, the bacterial agglutinating activities of many shrimp CTLs have been detected, showing that all of them can agglutinate both Gram-positive and negative bacteria with the exception of L. vannamei LvLec, which can only agglutinate Gram-negative bacteria (Wang and Wang, 2013; Zhang et al., 2009). It has been known that the EPN or the QPD motif is important for mannose or galactose binding, respectively. However, mutation of the EPN or QPD motif in many shrimp CTLs appears not to affect their bacterial agglutinating activity or specificity (Wang and Wang, 2013). In this study, the EPN motif of LvCTL3 is also changed to EPD, and LvCTL3 demonstrates agglutinating activity for both the two detected Gram-negative bacteria. Interestingly, although LvCTL3 can efficiently agglutinate the Gram-postive bacteria B. subtilis, it shows no agglutinating activity

M. Li et al. / Developmental and Comparative Immunology 46 (2014) 231–240

Fig. 4. Activation of the LvCTL3 promoter by LvDorsal. (A) Schematic diagram of the LvCTL3 promoter regions in the luciferase reporter gene constructs. The deletion mutant of the NF-jB (Dorsal) binding motif site of the LvCTL3 promoter is shown in absolute value sign, the wild type is shown in black rectangle and TATA box is shown in elliptical shape. 1 denotes indicates 1 bp before the translation initiation site. LUC denotes the firefly luciferase reporter gene. (B) Relative luciferase activity in S2 cells. The bars indicate mean values ± S.D. of the luciferase activity (n = 3). Statistical significance was determined by student T-test (⁄p < 0.05, ⁄⁄p < 0.01).

Fig. 5. Analysis of the recombinant LvCTL3 protein. LvCTL3 was recombinantly expressed in Escherichia coli strain Rosetta (DE3) cells and purified by Ni-affinity chromatography. (A) SDS–PAGE analysis of the expression of LvCTL3 in E. coli. Line 1: uninduced E. coli cells; Line 2: E. coli cells induced with IPTG; Line 3: purified LvCTL3 protein by Ni-affinity chromatography. (B) Western-blot analysis of the purified LvCTL3 protein using anti-6His antibody. Black arrow: band of the recombinant LvCTL3 protein (18 KDa).

for the Gram-postive bacteria S. agalactiae. Peptidoglycan serves a structural role in the Gram-positive bacterial cell wall component (90%, w/w) and consists of N-acetylmuramic acid (MurNAc) and

237

N-acetylglucosamine (GlcNAc) Smith, 2006; Salton, 1967. In Gram-positive bacteria there are at least eight different types of peptidoglycan and numerous different peptide arrangements among peptidoglycans (Smith, 2006; Salton, 1967). In the Gram-positive bacteria, the cell wall consists of several layers of peptidoglycan (Smith, 2006; Salton, 1967). It is reported that peptidoglycans are used as ligands for pathogen-associated patternrecognition proteins (e.g. Lectin), for example, mannose-binding lectin recognizes peptidoglycan via the N-acetyl glucosamine moiety (Nadesalingam et al., 2005; Sharma et al., 2011). The agglutinating specificity of LvCTL3 for Gram-postive bacteria B. subtilis but not S. agalactiae might be caused by the different peptidoglycan type of two Gram-positive bacteria. This suggests that the agglutinating specificity of CTLs may not always relate to the Gram-stain classification of bacteria and should be further investigated. Moreover, the structural and evolutional characteristics for the agglutinating specificity of CTLs are worthy of further studies. Most shrimp CTLs have a particular tissue distribution (Wang and Wang, 2013). FcLec1 and FcLec2 from F. chinensis, and LvCTL1 from L. vannamei are mainly expressed in the hepatopancreas, stomach and intestines, while FcLec3 and FcLec5 from F. chinensis, PmAV and PmLT from P. monodon, and LvLT from L. vannamei can only be detected in the hepatopancreas, and Fclectin from F. chinensis is exclusively expressed in hemocytes (Wang and Wang, 2013; Zhao et al., 2009; Sun et al., 2008; Zhang et al., 2009; Wang et al., 2009; Xu et al., 2010; Ma et al., 2008, 2007; Luo et al., 2003). The LvLec protein from L vannamei is distributed in the brain, hepatopancreas and hemocytes, with the highest expression level in the brain (Wang and Wang, 2013; Zhang et al., 2009). The tissue distribution profiles of these CTLs may coordinate to their functions. The hepatopancreas is an important immune organ of shrimps, the stomach and intestines are among the main tissues that directly face challenge of pathogen invasion, and hemocytes play important roles in immune recognition, response and regulation. Expression of CTLs in these tissues may indicate their important roles in anti-pathogen immunity. The high expression of LvLec in brain also suggests that LvLec may be involved in the development of neural system and the maintenance of brain homeostasis (Zhang et al., 2009). In this study, LvCTL3 mRNA can be ubiquitously detected in all tissues of shrimp, maybe because of the higher detection sensitivity of real-time PCR than semi-quantitative RT-PCR, which was mainly used in previous studies for detecting the tissue distribution of shrimp CTLs. LvCTL3 is highly expressed in hemocytes and gills, suggesting LvCTL3 could be involved in pathogen recognition and immune responses. CTLs may serve as a PRR to recognize pathogens and eliminate invading pathogens through a series of processes including directly agglutinating or killing microorganisms, stimulating Phenol oxidase cascade or hemocyte phagocytosis and encapsulation (Akira et al., 2006; Medzhitov, 2007; Beutler, 2004; Wang and Wang, 2013). Upon binding to their ligand, some CTLs could promote signal transduction to activate Ca2+–calcineurin–NFAT pathway, NFjB signaling pathway, NLRP3 inflammasome activation pathway and MAPK signaling pathway and so on (Wang and Wang, 2013; Goodridge et al., 2007; Gringhuis et al., 2007; den Dunnen et al., 2009). In spite of extensive studies have been focused on the antibacterial and antiviral mechanism of CTLs, however, there are few studies on the signaling pathways related to expression of CTLs. It has been reported that the promoter of FcCTL, a C-type lectin-like protein in F. chinensis, contained several transcriptional regulatory elements, such as CF1, CF2-II and HSEs, and the FcCTL promoter activity could be activated by heat shock and WSSV induction in Drosophila S2 cell, indicating that expression of FcCTL could relate to environmental stress and viral challenge (Lai et al., 2013). In this study, the 50 flanking promoter sequence of LvCTL3 as obtained by Genome walking technology, in which there is a converse NF-jB

238

M. Li et al. / Developmental and Comparative Immunology 46 (2014) 231–240

Fig. 6. Aggregation of the microbes by recombinant LvCTL3 protein. FITC-labeled Vibrio alginolyticus (1  106 CFU/ml) and Vibrio parahaemolyticus (1  106 CFU/ml) and Gram-positive bacteria Streptococcus agalactiae (1  106 CFU/ml) and Bacillus subtilis (1  106 CFU/ml) were treated with purified recombinant LvCTL3 protein (2 lg) for 1 h in the presence of 10 mM CaCl2 with or without EDTA at room temperature and examined under fluorescence microscopy. NC, Negative control (the control pEASY expression protein).

(dorsal) binding motif, suggesting that NF-jB may regulate expression of LvCTL3. Dual-Luciferase Reporter Assay showed that over-expression of LvDorsal could significantly increase LvCTL3 promoter activity in a dose-dependent manner. However, LvCTL3 promoter activity can not be up-regulated by LvDorsal protein when the converse NF-jB bing motif in the promoter sequence was deleted. The data suggest that the NF-jB signaling pathway involves in the regulation of LvCTL3 expression, and it will help us to know the relationship between WSSV infection and LvCTL3 expression. As far as we know, this is the first report on signaling pathway involve in shrimp CTLs expression. As gills are important defence tissue of shrimps, we detected the expression profiles of LvCTL3 in gills during immune responses. The level of LvCTL3 mRNA is up-regulated after LPS, poly I:C and V. parahemolyticus challenges, suggesting LvCTL3 may play a role in the immunity of shrimps. In vivo challenge experiments also showed that the recombinant LvCTL3 protein can significantly reduce the mortality of V. parahemolyticus infection. The anti-bacterial infection activity of LvCTL3 could due to its effective agglutinating activity for bacteria that can directly bind bacteria to decrease their pathogenicity. On the other hand, it has been known that shrimp CTLs can resist bacterial infection through not only directly agglutinating bacteria but also inducing a serial of immune responses, such as promotion of opsonization and cellular encapsulation, activation of respiratory burst, and induction of prophenoloxidase activating system to eliminate foreign invaders (Wang and Wang, 2013; Wang et al., 2014; Shi et al., 2014; Wang and

Zhao, 2014). The underlying mechanism for anti-bacterial infection activity of LvCTL3 requires further studies. WSSV is the main viral pathogen for shrimps that causes high mortality and leads to great economic damage to shrimp farming industry (Leu et al., 2009). Several shrimp CTLs have been reported that can bind with WSSV structural proteins (Wang and Wang, 2013). Among them, the L. vannamei LvCTL1 demonstrates an obvious anti-viral activity against WSSV infection through interacting with VP14, VP19, VP24, VP26, VP28, and VP95 proteins from WSSV virions (Zhao et al., 2009). In this study, we found that the level of LvCTL3 mRNA after WSSV infection is sharply up-regulated and reached peaks at 12 hpi with 21.00-fold over the baseline, suggesting that LvCTL3 could play an important role in response to WSSV infection. Moreover, the recombinant LvCTL3 protein can also significantly decrease the mortality caused by WSSV infection. All these results indicated that LvCTL3 could play an important role in the process of shrimp defense against WSSV infection. In spite of many shrimp CTLs were proved to have anti-WSSV activity, the antiviral mechanism is still not clear. So the interactions between LvCTL3 and WSSV are worthy of further investigation, which will help us learn more about the crustacean immune system and the pathogenicity of shrimp viral pathogens. Acknowledgements This research was supported by National Natural Science Foundation of China under Grant No. U1131002; National High

M. Li et al. / Developmental and Comparative Immunology 46 (2014) 231–240

Fig. 7. In vivo anti-pathogen activity of LvCTL3. Healthy shrimps (average 5 g and n = 30 in each group) were injected with 50 ll solutions of LvCTL3 (40 lg/ml) or the control pEASY expression protein (40 lg/ml, as control) mixed with WSSV (1  105 copies/ml) or V. alginolyticus (1  105 CFU/ml), respectively. (A) Mortalities of V. parahemolyticus challenged groups; (B) Mortalities of WSSV challenged groups. Statistical significances between LvCTL3 treated and BSA treated control groups were calculated using the Kaplan–Meier plot (log-rank v2 test, ⁄⁄⁄p < 0.001). Experiments were performed in three times with similar results.

Technology Research and Development Program of China (973 Program) 2012CB114401; China Agriculture Research System (47); Special Fund for Agro-scientific Research in the Public Interest 201103034; Foundation from Science and Technology Bureau of Guangdong Province 2011A020102002 and 2009A020102002; Foundation from Administration of Ocean and Fisheries of Guangdong Province A201101B02; and the Open Project of the State Key Laboratory of Biocontrol (SKLBC09K04). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References Akira, S., 2009. Pathogen recognition by innate immunity and its signaling. Proc. Jpn. Acad. B, Phys. Biol. Sci. 85, 143–156. Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity. Cell 124, 783–801. Medzhitov, R., 2007. Recognition of microorganisms and activation of the immune response. Nature 449, 819–826. Iwanaga, S., Lee, B.L., 2005. Recent advances in the innate immunity of invertebrate animals. J. Biochem. Mol. Biol. 38, 128–150. Kim, T., Kim, Y.J., 2005. Overview of innate immunity in Drosophila. J. Biochem. Mol. Biol. 38, 121–127. Beutler, B., 2004. Innate immunity: an overview. Mol. Immunol. 40, 845–859. Robinson, M.J., Sancho, D., Slack, E.C., LeibundGut-Landmann, S., Reis e Sousa, C., 2006. Myeloid C-type lectins in innate immunity. Nat. Immunol. 7, 1258–1265.

239

Ofek, I., Crouch, E., Keisari, Y., 2000. The role of C-type lectins in the innate immunity against pulmonary pathogens. Adv. Exp. Med. Biol. 479, 27–36. Vasta, G.R., Quesenberry, M., Ahmed, H., O’Leary, N., 1999. C-type lectins and galectins mediate innate and adaptive immune functions: their roles in the complement activation pathway. Dev. Comp. Immunol. 23, 401–420. Drickamer, K., 1999. C-type lectin-like domains. Curr. Opin. Struct. Biol. 9, 585–590. Wang, L., Qiu, L., Zhou, Z., Song, L., 2013. Research progress on the mollusc immunity in China. Dev. Comp. Immunol. 39, 2–10. Boman, H.G., Hultmark, D., 1987. Cell-free immunity in insects. Annu. Rev. Microbiol. 41, 103–126. Wang, X.W., Wang, J.X., 2013. Diversity and multiple functions of lectins in shrimp immunity. Dev. Comp. Immunol. 39, 27–38. Schulenburg, H., Hoeppner, M.P., Weiner 3rd, J., Bornberg-Bauer, E., 2008. Specificity of the innate immune system and diversity of C-type lectin domain (CTLD) proteins in the nematode Caenorhabditis elegans. Immunobiology 213, 237–250. Zhang, Y., Qiu, L., Song, L., Zhang, H., Zhao, J., Wang, L., et al., 2009. Cloning and characterization of a novel C-type lectin gene from shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 26, 183–192. Zhao, Z.Y., Yin, Z.X., Xu, X.P., Weng, S.P., Rao, X.Y., Dai, Z.X., et al., 2009. A novel Ctype lectin from the shrimp Litopenaeus vannamei possesses anti-white spot syndrome virus activity. J. Virol. 83, 347–356. Junkunlo, K., Prachumwat, A., Tangprasittipap, A., Senapin, S., Borwornpinyo, S., Flegel, T.W., et al., 2012. A novel lectin domain-containing protein (LvCTLD) associated with response of the whiteleg shrimp Penaeus (Litopenaeus) vannamei to yellow head virus (YHV). Dev. Comp. Immunol. 37, 334–341. Lai, X., Gao, H., Kong, J., Wang, Q., Meng, X., Yan, B., et al., 2013. Genomic organization and promoter characterization of FcCTL, a C-type lectin-like protein in Fenneropenaeus chinensis. Gene 518, 376–380. Liu, Y.C., Li, F.H., Dong, B., Wang, B., Luan, W., Zhang, X.J., et al., 2007. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol. Immunol. 44, 598–607. Rattanaporn, O., Utarabhand, P., 2011. Molecular cloning of a C-type lectin with two CRD domains from the banana shrimp Fenneropenaeus merguiensis: early gene up-regulation after Vibrio harveyi infection. J. Invertebr. Pathol. 106, 196–204. Rittidach, W., Paijit, N., Utarabhand, P., 2007. Purification and characterization of a lectin from the banana shrimp Fenneropenaeus merguiensis hemolymph. Biochim. Biophys. Acta 1770, 106–114. Mine, S., Boopathy, R., 2011. Effect of organic acids on shrimp pathogen, Vibrio harveyi. Curr. Microbiol. 63, 1–7. Wei, X., Liu, X., Yang, J., Fang, J., Qiao, H., Zhang, Y., 2012. Two C-type lectins from shrimp Litopenaeus vannamei that might be involved in immune response against bacteria and virus. Fish Shellfish Immunol. 32, 132–140. Li, C., Weng, S., Chen, Y., Yu, X., Lu, L., Zhang, H., et al., 2012. Analysis of Litopenaeus vannamei transcriptome using the next-generation DNA sequencing technique. PLoS ONE 7, e47442. Olivarius, S., Plessy, C., Carninci, P., 2009. High-throughput verification of transcriptional starting sites by Deep-RACE. Biotechniques 46, 130–132. Scotto-Lavino, E., Du, G., Frohman, M.A., 2006. 50 end cDNA amplification using classic RACE. Nat. Protoc. 1, 2555–2562. Leoni, C., Gallerani, R., Ceci, L.R., 2008. A genome walking strategy for the identification of eukaryotic nucleotide sequences adjacent to known regions. Biotechniques 44 (229), 32–35. Koyama, T., Asakawa, S., Katagiri, T., Shimizu, A., Fagutao, F.F., Mavichak, R., et al., 2010. Hyper-expansion of large DNA segments in the genome of kuruma shrimp, Marsupenaeus japonicus. BMC Genom. 11, 141. Aiyar, A., 2000. The use of CLUSTAL W and CLUSTAL X for multiple sequence alignment. Methods Mol. Biol. 132, 221–241. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Wingender, E., 2008. The TRANSFAC project as an example of framework technology that supports the analysis of genomic regulation. Briefings Bioinform. 9, 326–332. Ai, H.S., Huang, Y.C., Li, S.D., Weng, S.P., Yu, X.Q., He, J.G., 2008. Characterization of a prophenoloxidase from hemocytes of the shrimp Litopenaeus vannamei that is down-regulated by white spot syndrome virus. Fish Shellfish Immunol. 25, 28– 39. Huang, X.D., Yin, Z.X., Jia, X.T., Liang, J.P., Ai, H.S., Yang, L.S., et al., 2010. Identification and functional study of a shrimp Dorsal homologue. Dev. Comp. Immunol. 34, 107–113. Schoonjans, F., Zalata, A., Depuydt, C.E., Comhaire, F.H., 1995. MedCalc: a new computer program for medical statistics. Comput. Methods Programs Biomed. 48, 257–262. Smith, C.A., 2006. Structure, function and dynamics in the mur family of bacterial cell wall ligases. J. Mol. Biol. 362, 640–655. Salton, M.R., 1967. Structure and function of bacterial cell membranes. Annu. Rev. Microbiol. 21, 417–442. Nadesalingam, J., Dodds, A.W., Reid, K.B., Palaniyar, N., 2005. Mannose-binding lectin recognizes peptidoglycan via the N-acetyl glucosamine moiety, and inhibits ligand-induced proinflammatory effect and promotes chemokine production by macrophages. J. Immunol. 175, 1785–1794. Sharma, P., Dube, D., Sinha, M., Mishra, B., Dey, S., Mal, G., et al., 2011. Multiligand specificity of pathogen-associated molecular pattern-binding site in peptidoglycan recognition protein. J. Biol. Chem. 286, 31723–31730.

240

M. Li et al. / Developmental and Comparative Immunology 46 (2014) 231–240

Sun, Y.D., Fu, L.D., Jia, Y.P., Du, X.J., Wang, Q., Wang, Y.H., et al., 2008. A hepatopancreas-specific C-type lectin from the Chinese shrimp Fenneropenaeus chinensis exhibits antimicrobial activity. Mol. Immunol. 45, 348–361. Zhang, X.W., Xu, W.T., Wang, X.W., Mu, Y., Zhao, X.F., Yu, X.Q., et al., 2009. A novel Ctype lectin with two CRD domains from Chinese shrimp Fenneropenaeus chinensis functions as a pattern recognition protein. Mol. Immunol. 46, 1626– 1637. Wang, X.W., Xu, W.T., Zhang, X.W., Zhao, X.F., Yu, X.Q., Wang, J.X., 2009. A C-type lectin is involved in the innate immune response of Chinese white shrimp. Fish Shellfish Immunol. 27, 556–562. Xu, W.T., Wang, X.W., Zhang, X.W., Zhao, X.F., Yu, X.Q., Wang, J.X., 2010. A new Ctype lectin (FcLec5) from the Chinese white shrimp Fenneropenaeus chinensis. Amino Acids 39, 1227–1239. Ma, T.H., Benzie, J.A., He, J.G., Chan, S.M., 2008. PmLT, a C-type lectin specific to hepatopancreas is involved in the innate defense of the shrimp Penaeus monodon. J. Invertebr. Pathol. 99, 332–341. Luo, T., Zhang, X., Shao, Z., Xu, X., 2003. PmAV, a novel gene involved in virus resistance of shrimp Penaeus monodon. FEBS Lett. 551, 53–57. Ma, T.H., Tiu, S.H., He, J.G., Chan, S.M., 2007. Molecular cloning of a C-type lectin (LvLT) from the shrimp Litopenaeus vannamei: early gene down-regulation after WSSV infection. Fish Shellfish Immunol. 23, 430–437.

Goodridge, H.S., Simmons, R.M., Underhill, D.M., 2007. Dectin-1 stimulation by Candida albicans yeast or zymosan triggers NFAT activation in macrophages and dendritic cells. J. Immunol. 178, 3107–3115. Gringhuis, S.I., den Dunnen, J., Litjens, M., van Het Hof, B., van Kooyk, Y., Geijtenbeek, T.B., 2007. C-type lectin DC-SIGN modulates Toll-like receptor signaling via Raf-1 kinase-dependent acetylation of transcription factor NFkappaB. Immunity 26, 605–616. den Dunnen, J., Gringhuis, S.I., Geijtenbeek, T.B., 2009. Innate signaling by the Ctype lectin DC-SIGN dictates immune responses. Cancer Immunol. Immunother.: CII. 58, 1149–1157. Wang, X.W., Xu, J.D., Zhao, X.F., Vasta, G.R., Wang, J.X., 2014. A shrimp C-type lectin inhibits proliferation of the hemolymph microbiota by maintaining the expression of antimicrobial peptides. J. Biol. Chem. Shi, X.Z., Wang, L., Xu, S., Zhang, X.W., Zhao, X.F., Vasta, G.R., et al., 2014. A galectin from the kuruma shrimp (Marsupenaeus japonicus) functions as an opsonin and promotes bacterial clearance from hemolymph. PLoS ONE 9, e91794. Wang, X.W., Zhao, X.F., Wang, J.X., 2014. C-type lectin binds to beta-integrin to promote hemocytic phagocytosis in an invertebrate. J. Biol. Chem. 289, 2405– 2414. Leu, J.H., Yang, F., Zhang, X., Xu, X., Kou, G.H., Lo, C.F., 2009. Whispovirus. Curr. Top. Microbiol. Immunol. 328, 197–227.