ORIGINAL ARTICLE
Establishment of a novel human papillomavirus–negative and radiosensitive head and neck squamous cell carcinoma cell line Kyung-Min Kim, MSc,1 Eun-Ji Park, MSc,2 Jiyoung Yeo,3 Young-Hoon Joo, MD,4 Kwang-Jae Cho, MD,4 Min-Sik Kim, MD, PhD4* 1
Department of Biomedicine and Health Science, College of Medicine, Seoul St. Mary’s Hospital, The Catholic University of Korea, Seoul, Republic of Korea, 2Department of POSTEC-Catholic BM Institute, College of Medicine, Seoul St. Mary’s Hospital, The Catholic University of Korea, Seoul, Republic of Korea, 3Department of Anatomy, School of Medicine, Pusan National University, Yangsan City, Gyengsangnam-Do, Seoul, Republic of Korea, 4Department of Otolaryngology–Head and Neck Surgery, College of Medicine, Seoul St. Mary’s Hospital, The Catholic University of Korea, Seoul, Republic of Korea.
Accepted 6 March 2015 Published online 27 July 2015 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/hed.24037
ABSTRACT: Background. The purpose of this study was to develop a CMCSCC21 cell line for head and neck cancer research into new therapies for head and neck squamous cell carcinoma (HNSCC). Methods. The CMCSCC-1 cell line was isolated from a primary oral tongue tumor specimen of a female patient. Tumor cells were evaluated for biomarkers expression by Western blots, reverse transcriptasepolymerase chain reaction (RT-PCR), fluorescence activated cell sorter, and immunostaining. Cell proliferation in response to radiation was measured by the WST-8 assay. Results. The characterization analyses revealed a typical epithelial morphology; a doubling time of approximately 24 hours, high tumorigenicity
INTRODUCTION Head and neck squamous cell carcinoma (HNSCC) is the sixth most prevalent cancer worldwide, with approximately 600,000 new cases diagnosed every year.1 HNSCC is associated with excessive alcohol consumption, history of tobacco use, and human papillomavirus (HPV) infection.2 The combination of smoking and drinking is well known to increase the risk of this cancer. Although HPV has been long known to be a major cause of cervical and most other anogenital cancers, it recently was also identified as an etiology of a subset of HNSCC.3,4 Increased incidence of HPV-related HNSCC represents a new viral epidemic of cancer. HPV has been shown to be of prognostic significance, particularly in HNSCC.5 A recent report showed that patients with HPVpositive HNSCC have a better prognosis compared with patients with virus-negative tumors.6 Not all patients with HPV-negative tumors have a good response to chemotherapy and radiotherapy, and the reasons for this are not
*Corresponding author: M.-S. Kim, Department of Otolaryngology–Head and Neck Surgery, 505 Banpodong Seochogu, Seoul St. Mary’s Hospital, The Catholic University of Korea, Seoul, Republic of Korea 137-040. E-mail: [email protected] Contract grant sponsor: Korean Health Technology R&D Project, Ministry of Health & Welfare; contract grant number: A091205; Korea government; contract grant number: No. 2012–0004140
E542
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
in immunodeficient mice, and upregulated biomarkers. CMCSCC-1 cells were negative for human papillomavirus (HPV) infection, but more sensitive to radiation compared with those FaDu cell lines. Conclusion. CMCSCC-1, a novel oral tongue SCC cell line, was established. It will help in the elucidation of the molecular pathogenesis of C 2015 Wiley Periodicals, Inc. Head HPV-negative radiosensitive tumors. V Neck 38: E542–E551, 2015
KEY WORDS: head and neck neoplasms, squamous cell carcinoma, tumor cell line, human papillomavirus, radiotherapy
known. HPV-positive cells have markedly higher radiosensitivity than that of HPV-negative cells, and HPVnegative cells are more resistant to radiation.7,8 Malignant transformation and maintenance of phenotype in head and neck cancer has been attributed mainly to the E6 and E7 oncoproteins. The biology of HPV-positive HNSCC was distinct with tumor suppressor protein p53 degradation and inactivation of retinoblastoma Rb pathways.4 Recent studies indicated that the E6 and E7 proteins have multiple binding partners that exerted oncogenic effects besides degradation of p53 and pRb, and have complementary effects on transforming activity.9 The HPVinfected HNSCC cell lines enhanced the ability to study the role of HPV in the development of sensitivity or resistance to therapy in HNSCC.10 The purpose of this study was to develop the background for research on a new HNSCC target therapy by establishing an HPV-negative and radiosensitive HNSCC cell line. We describe the establishment and characteristics of a novel cell line named “CMCSCC-1,” which was obtained from a female tongue SCC. Various HNSCC cell lines with known characteristics are used in research, such as the FaDu and the SCC cell lines. These cell lines are HPV-negative and are radiation resistant.8,11–13 Most studies with these cells have focused on oncogenic mechanisms; however, the mechanisms of tumorigenesis and tumor progression are unknown.2 Permanent HNSCC tumors cell lines are important tools for research into the
NOVEL
molecular, biochemical, and genetic properties of head and neck cancer.14 Likewise, our newly established cancer cell line can be used as a powerful tool for various head and neck cancer research, new therapies, and preclinical studies on cancer progression.15 In this article, we describe the development and characterization of a new radio-sensitive HPV-negative HNSCC cell line.
MATERIALS AND METHODS Establishment of cell line The patient provided written informed consent for the use of her tissue and medical records in this study. The Institutional Review Board of the Catholic Medical Center (IRB No. KC11SISI0558) reviewed and approved the study and the consent form. Surgically resected tumor tissue was placed in a 15 mL conical tube filled with approximately 5 mL of serum-free Dulbecco modified Eagle’s medium (DMEM)/F12 (GenDEPOT, Barker, TX). The tissue was immediately transported on ice (within 1 hour) to the laboratory for tissue dissociation. The tissue was then mechanically divided into small fragments using scissors and forceps and subsequently washed 2 to 3 times in Dulbecco’s phosphate-buffered saline (GenDEPOT). Tissue fragments were further enzymatically dissociated in 10 mL of serum-free DMEM/F12 (GenDEPOT) containing collagenase type IV (300 U/mL), DNase (125 U/mL), and 1% antibiotic/antimycotic for 60 minutes in a 37 C shaking water bath. After dissociation, the isolated cells were filtered through a 0.7 mm strainer and then centrifuged at 1500 rpm for 5 minutes. The cells were seeded in serum-free medium containing various growth factors, such as epidermal growth factor, basic fibroblast growth factor, N-2 Supplement (Gibco, Grand Island, NY), B-27 Serum-Free supplement (Gibco), and antibiotic/antimycotic in a humidified incubator at 37 C with 5% CO2. Normal fibroblasts were removed 2 to 3 days after seeding by differential trypsinization to enrich the malignant cell population.
Cell lines The FaDu cell line, well-known as HNSCC, and the HeLa cell line were purchased from the American Tissuetype Cell Collection (ATCC). FaDu and HeLa cells were grown in DMEM (GenDEPOT). All the cell lines’ media were supplemented with 10% fetal bovine serum (Multicell; Wisent, St. Bruno, Quebec, Canada), and 1% penicillin/streptomycin (Gibco) in a humidified incubator at 37 C with 5% CO2.
Heterotransplantation in Balb/c-nude mice Four-week-old female BALB-c/nude mice were purchased from Central Laboratory Animal (Seoul, Korea). The mice were injected with cultured CMCSCC-1 cells for heterotopic (subcutaneously in the flank, 3 3 106 cells in 100 mL phosphate-buffered saline [PBS]) and orthotopic (base of the tongue, 1 3 105 cells in 20 mL PBS) heterotransplantation studies. Tumor volume (n 5 3) was measured once a week for 5 weeks after cell inoculation (calculation formula: V 5 length 3 width2 3 0.5). All
HPV-RADIOSENSITIVE HNSCC
CELL LINE
procedures were approved by the Animal Ethics Committee of the Catholic University (2014-0007-04). For tissue morphology, tumor tissues were stained with standard hematoxylin-eosin staining procedure. After the mice were euthanized, some parts of the primary tumors were fixed in 10% paraformaldehyde for 24 hours at 4 C. Fixed tumor tissue was prepared as a paraffin-embedded tissue block, and 3-mm thick sections were placed on glass slides. The slides were warmed for 1 hour at 60 C, deparaffinized in xylene, and rehydrated in serially diluted ethanol (100%, 95%, 80%, and 70%). The sections were stained with hematoxylin for 3 to 5 minutes followed by washing with tap water until clear. The sections were then immersed 2 to 3 times in acid alcohol (1% HCL in 70% EtOH) until they turned pink and were washed with tap water for 3 to 5 minutes. The sections were immersed in ammonia water (1 mL NH4OH in 1 L H2O) for 3 to 5 times. After washing in tap water, the sections were stained with eosin for 1 minute. Cell morphology was visualized with the Panoramic Viewer Software System and a digital slide scanner (Panoramic MIDI, 3DHISTECH, Budapest, Hungary).
Western blot Total protein was separated by 8% and 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany), and blocked in 5% skim milk. Primary antibody solutions were incubated for 1 hour according to the manufacturer’s instructions, as follows: monoclonal anti-actin (1:1000; Sigma–Aldrich, St. Louis, MO), p53 (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA), and epidermal growth factor receptor (EGFR; 1:1000; Cell Signaling Technologies, Danvers, MA). Blots were incubated with the primary antibody solutions overnight at 4 C. Membranes were washed with Tris-buffered saline containing 0.05% Tween20 and probed with horseradish peroxidase-conjugated anti-rabbit secondary antibody solution (Thermo Scientific, Rockford, IL). Proteins were visualized using an enhanced chemiluminescence system (Thermo Scientific), in accord with the manufacturer’s instructions.
Reverse transcription–polymerase chain reaction Total RNAs were extracted from the samples using Trizol reagent (Invitrogen, Carlsbad, CA), in accord with the manufacturer’s instructions. The cDNA was synthesized with an M-MLV Reverse Transcriptase Kit & Recombinant RNasin Ribonuclease inhibitor (PromegaBiotec, Madison, WI), in accord with the manufacturer’s protocol. Detection of HPV16 and HPV18 by polymerase chain reaction (PCR) was performed using primers for HPV16 forward: ATGTTTCAGGACCCACAGGA, reverse: CCTCACGTCGCAGTAACTGT; and HPV18 forward: ATGGCGCGCTTTGAGGATCC, reverse: GCATGCGGTATACTGTCTCT. The initial denaturation of DNA was performed at 95 C for 2 minutes, and 30 cycles PCR (including annealing) were performed as follows: 95 C for 20 seconds, 55 C for 40 seconds, and 72 C for 1 minute, and its final extension was at 72 C for 5 minutes, HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E543
KIM ET AL.
and 4 C for infinity. The PCR products were run on a 1% agarose gel. The HeLa cell line was used as a positive control and the known HPV-negative cell line FaDu was used as a negative control for HPV16 and HPV18 (amplicon sizes of 188 and 124, respectively). Total RNA concentrations were measured with a NanoDrop ND-1000 Spectrophotometer (Peqlab, Erlangen, Germany) and quality was determined with the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA).
In situ hybridization of human papillomavirus Tissue sections (4-mm thick) were prepared from formalin-fixed, paraffin-embedded tissues and mounted on 3-aminopropylmethoxysilane-coated slides. In situ hybridization was performed on an automated Benchmark system from Ventana Medical Systems (Tucson, AZ) utilizing the INFORMH HPV III Family 16 Probe (cocktail of HPV subtypes 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, and 66, Ventana Medical Systems), as described previously. This system enabled removal or the paraffin wax from the tissue, protease digestion, and then hybridization with a probe. The probe-target complex was detected by the action of alkaline phosphatase on the chromogen nitroblue tetrazolium and bromochloroindolylphosphate, which yielded a dark blue color with a pink counter stain for the HPV-negative cells because of nuclear fast red. Evaluation of the nuclear hybridization was performed by a pathologist who had specialized in head and neck pathology.5
Flow cytometry CMCSCC-1 cells were harvested with 0.05% trypsinEDTA (Gibco) and incubated at 4 C with fluorescein isothiocyanate-conjugated anti-CD44 (BD Biosciences, San Jose, CA) without fixation. CD44 cells were detected using the fluorescence activated cell sorter Calibur flow cytometer (BD Biosciences).
Tissue specimens were fixed in 10% formalin for 24 hours at 4 C and embedded in paraffin. The 3-mm thick sections were placed on glass slides and stained using the Polink-2 horseradish peroxidase-conjugated diaminobenzidine Detection System. The slides were warmed for 1 hour at 60 C, deparaffinized in xylene, and rehydrated in serially diluted ethanol (100%, 95%, 80%, and 70%). Antigen retrieval was performed by heating the sample in 0.01 M citrate buffer at pH 6.0 for 20 minutes using a microwave. The slides were treated with 3% hydrogen peroxide (H2O2) in methanol for 10 minutes to quench endogenous peroxidase activity and then blocked with 1% bovine serum albumin in PBS. The slides were incubated with primary antibodies overnight at 4 C. Primary antibodies and concentrations are as follows: EGFR (1:50; Cell Signaling Technologies), CD44 (1:50; Cell Signaling Technologies), Ki-67 (1:50; Abcam, Cambridge, MA), keratin (1:25; Cell Signaling Technologies), and Ecadherin (1:100; Cell Signaling Technologies). The slides were washed with Tris-buffered saline-T buffer, and the peroxidase EnVision System (HPR Rabbit/Mouse Envision System, DakoCytomation, Glostrup, Denmark) was HEAD & NECK—DOI 10.1002/HED
Immunocytochemistry Cells were seeded in 8-well chamber slides. Media were removed and the cells were washed with 13 PBS. Cells on chamber slides were fixed in 10% formaldehyde for 15 minutes at room temperature. The cells were rinsed 3 times with 13 PBS. Blocking was performed with 10% goat serum diluted in blocking buffer (5% bovine serum albumin and 0.5% Tween20 in 13 PBS). The blocking solution was removed and the cells were incubated in primary antibody in blocking buffer overnight at 4 C with gentle rocking. The primary antibody dilutions were: EGFR (1:200), CD44 (1:200), Ki-67 (1:100), keratin (1:200), and E-cadherin (1:400). Subsequent steps were the same as those for the immunohistochemistry method. The stained areas in the slides were confirmed by fluorescence microscopy (Olympus AX70; Olympus Optical, Tokyo, Japan).
Cytogenetics We added 30 mL Chromosome Resolution Additive (Genial Genetic Solutions, Runcorn, UK) to each 6-well plate. After 1 hour of incubation, colcemid was treated for 30 minutes. Cells were harvested using trypsin and treated by prewarmed hypotonic solution (KCl). The cells were fixed in a 1:3 acetic acid:methanol solution, and slides were prepared for chromosome analysis. The chromosome analysis was performed using a trypsin-Giemsa banding technique. At least 20 metaphase plates were analyzed.
Cell viability assay
Immunohistochemistry
E544
applied for 5 to 10 minutes at room temperature. Peroxidase activity was detected with 3,3-diaminobenzidine tetrachloride and counterstained with hematoxylin. The stained area was scanned and measured as a percentage using the Panoramic Viewer Software System and a digital slide scanner (Panoramic MIDI).
APRIL 2016
Cells initially treated with 2 Gy radiation were grown to 80% confluence after seeding in another dish. Aliquots accumulated a dose of 20 Gy after 10 repetitions. The cells were seeded in triplicate at 3 3 103 cells/well in 96well plates. After overnight growth, the cells were observed for 24 hours, 48 hours, and 72 hours at 37 C with a radiation dose 20 Gy. Cell viability was assessed using a WST-8 assay [2-(2-methoxy-4-nitrophenyl)23-(4nitrophenyl)25-(2,4-disulfophenyl)22H-tetrazolium, monosodium salt] (Cell Counting Kit, DOJINDO, Kumamaoto, Japan). The plates were measured at an absorbance of 450㎚ using a microplate reader.
Ionizing irradiation of mice Mice were injected subcutaneously in the flank, with a 0.1 mL inoculum of viable 3 3 106 CMCSCC-1 cells. Locoregional irradiation was applied in a single dose of 2 Gy using a g-irradiator (MDS Nordion, Ottawa, Ontario, Canada) when the volume of tumors had reached approximately 100 mm3. Fractionated doses were administered at 48-hour intervals. Aliquots accumulated a dose of 20 Gy after 10 repetitions. Tumor volume (n 5 3) was measured
NOVEL
HPV-RADIOSENSITIVE HNSCC
CELL LINE
FIGURE 1. Establishing CMCSCC-1 cells from squamous cell carcinoma of the oral cavity. (A) Hematoxylin-eosin stained malignant cells with large nuclei and an abundance of cytoplasm typical of squamous cells. (B) Phase-contrast microphotograph of growing CMCSCC-1 cells (passage 4) showing numerous mitotic cells with tightly adherent squamous cell morphology. Over 90% seem to be multinucleated cells in the phase contrast panel (left, original magnification 3200; right, original magnification 3400).
when 20 Gy radiation was expose (calculation formula; V 5 length 3 width2 3 0.5).
Cell authentication testing by the Korea Cell Line Bank The cell lines were authenticated by DNA fingerprinting of short tandem repeats (STRs) at the Korea Cell Line Bank (Seoul, Korea) using the AmplFLSTR identifier PCR Amplification kit (Applied Biosystems, Foster City, CA). Data were analyzed using the 3730 DNA Analyzer (Applied Biosystems) and GeneMapper ID v 3.2 software (Applied Biosystems).
Statistical analysis Results are presented as means and SDs of at least 3 independent experiments. Statistical comparisons were made by analysis of variance using SPSS 13.0 software (SPSS, Chicago, IL). A p value < .05 or < .001 was considered as statistically significant.
The CMCSCC-1 cell line was established from the primary tumor specimen after approximately 4 weeks in culture. The majority of fibroblasts were removed by light trypsinization without disturbing the more securely attached tumor cells. The cells were tightly adherent to the bottom of the culture plate. The cells demonstrated typical squamous cell morphology that maintained a persistent shape as they were isolated and cultured. Hematoxylin-eosin staining showed the histological characteristics of poorly differentiated SCC and a few keratin pearls (Figure 1A), which is a positive test for a cancerous tumor mass. Single cultured cells from the tumor tissue were initially small and round, and then started to change to form branches in multiple directions. These cells tended to form a monolayer with epithelial features. CMCSSC-1 had a doubling time of 24 hours. Distinctive cell morphology was found, such as multiple nuclei and polygonal and spindle-shaped cells. These cells retained similar morphology for over 50 passages (Figure 1B).
RESULTS Histopathology and morphology
Human papillomavirus
CMCSCC-1 was derived from a 57-year-old woman with a left lateral mobile tongue squamous cell carcinoma (SCC; T2N0M0).The patient had partial glossectomy via the pull-through approach, and reconstruction procedures with radial forearm free flap were performed with bilateral neck dissections. The patient was treated by surgical excision without irradiation and/or chemotherapy. No recurrence was detected 14 months after surgery. The patient’s social history was 10 packs of cigarettes per day for 20 years and no alcoholic drinking.
HPV is associated with HNSCC carcinogenesis. The CMCSCC-1 cell line was screened for this oncogenic virus by PCR. Expression of HPV16 and HPV18 were tested by reverse transcriptase-polymerase chain reaction (RT-PCR) in CMCSCC-1 and in the HPV-positive control, HeLa cell line. The HPV-negative control was the FaDu cell line. The result showed that CMCSCC-1 was negative for HPV infection, using primers specific for HPV16 and HPV18 (see Figure 2). In situ hybridization was also negative for HPV (data not shown). HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E545
KIM ET AL.
FIGURE 2. Reverse transcriptasepolymerase chain reaction (RT-PCR) detection showed absence of human papillomavirus (HPV) infection of CMCSCC-1 cells compared with HeLa and FaDu. HPV detection using HPV16 and HPV18 primers demonstrated that CMCSCC-1 cells were HPV-negative. HeLa, positive control; FaDu, negative control; GAPDH, glyceraldehyde 3phosphate dehydrogenase.
Heterotransplantation in BALB-c/nude mice Transplant of cultured CMCSCC-1 to nude mice was performed. Cultured CMCSCC-1 cells were heterotransplanted subcutaneously in nude mice and produced expanding tumors in 3/3 mice. This result further confirmed malignancy of the cell line (see Figure 3). Suspended CMCSCC-1 cells (3 3 106 cells/100 mL) were injected subcutaneously in the right hind leg in three 5-
week-old female nude mice. The mice were carefully observed for 5 weeks postinjection, and tumor sizes were measured once weekly (Figure 3A and 3B). At this time, tumor sizes had exceeded 300 mm3 and the injected mice were euthanized for histopathological analysis. The morphology of the subcutaneous tumors was confirmed by hematoxylin-eosin staining. Hematoxylin-eosin–stained histological sections of the heterotransplanted tumors showed poorly differentiated SCC. The tumors were
FIGURE 3. Heterotransplantation of CMCSCC-1 cells into BALB-c/nude mice. Xenografted tumor and histopathology of a tumor derived from CMCSCC-1 cells. (A) Appearance of CMCSCC-1 tumors (subcutaneous) in nude mice. (B) Tumor volumes were measured for 5 weeks after injecting tumor cells. Calculation formula; V 5 length 3 width2 3 0.5. (C) Histology of xenograft tissue showing tumor cell heterogeneity (hematoxylineosin; C 5 original magnification 3200; D 5 original magnification 3400).
E546
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
NOVEL
HPV-RADIOSENSITIVE HNSCC
CELL LINE
FIGURE 4. Identifying CMCSCC-1 cancer cell biomarkers. (A) Oncogene and cancer marker expression by CMCSCC-1 cells. P53 and Notch1 expression in FaDu and CMCSCC-1 cells. Gene amplification was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression. (B) P53 and epidermal growth factor receptor (EGFR) protein expression as cancer cell markers with that of actin. (C) Expression profile of CD44 as a cancer marker in the CMCSCC-1 and head and neck squamous cell carcinoma (HNSCC) cell lines. CMCSCC-1 cells were stained for CD44, a wellknown cancer marker, using a monoclonal antibody and characterized by flow cytometry (FACs). Cell lines with increased CD44; FaDu was 91.9%, and CMCSCC-1 was 91.6%. Therefore, CMCSCC-1 cells were demonstrated to be cancer cells. CD44 was significantly upregulated in CMCSCC-1 cells compared to that in HNSCC cells. The negative control was no staining with primary antibody.
composed of spindle-like cells exhibiting frequent mitotic figures. As expected, the tumors from transplanted CMCSCC-1 cells had a histopathological appearance similar to that of the original surgical specimen (Figure 3C and 3D). These findings demonstrate that the cell line was suitable for transplant into a xenograft model and that the heterotransplanted tumors closely resembled the original tumor.
Head and neck cancer biomarkers The cell line was also tested by RT-PCR for expression of pertinent tumor suppressor genes. Among HNSCC markers, the representative p53 protein showed similar expression with that by FaDu cells. Notch1 was also expressed similarly (Figure 4A). Western blot revealed the protein expression levels of p53 and EGFR in CMCSCC-1, compared to FaDu. EGFR, an oncogene marker, was higher than the control. FaDu (positive control) and CMCSCC-1 cells showed higher or similar expression levels of the cancer markers (Figure 4B). The CMCSCC-1 cell line was characterized for cell surface and cancer stem cell marker (common HNSCC biomarkers) by flow cytometry (Figure 4C). CMCSCC-1 cells had significantly increased staining of CD44 compared to controls. Immunophenotypic characterization of cultured CMCSCC-1 and its heterotransplants were similarly shown for the original tumor and thus confirmed as a SCC. Original tumor, the heterotransplanted tumor, and
CMCSCC-1 cells were confirmed by expression of keratin, EGFR, CD44, Ki-67, and E-cadherin on immunohistochemistry (see Figure 5). CMCSCC-1 cells positively expressed all related markers. Our EGFR, CD44, Ki-67, and E-cadherin expression results were consistent with those of previous reports.16–18 Thus, CMCSCC-1 cells have many characteristics of the HNSCC phenotype.
Cytogenetic analysis A cytogenetic analysis of CMCSCC-1 cells was performed to confirm the unique identity of this cell line and its origin from the original tumor sample. All mitotic cells analyzed from the CMCSCC-1 cell line were clonally abnormal. The complex near-triploid clone was characterized by 59 to approximately 74 modal chromosomes with deletions involving chromosome 14; additional material of unknown origin on chromosomes 7, 11, 12, and 20; a derivative of chromosomes 1, 3, 4, 10, and 15; gains on chromosomes X, 1, 3, 5, 6, 7, 9, 10, 11, 16, 17, and 20; and losses of chromosomes 14, 21, and Y. A representative karyotype is shown in Figure 6.
Cell proliferation Radiation response effect on FaDu and CMCSCC-1 cells was measured by the WST-8 assay. After being exposed to time-dependent g-irradiation (20 Gy), the CMCSCC-1 cell showed significantly lower proliferative HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E547
KIM ET AL.
FIGURE 5. Characterization of the patient’s tumor, heterotransplanted tumor, and CMCSCC-1 cells. Photomicrographs of immunoperoxidase staining of the original tumor (top), formalin-fixed paraffin-embedded tissue sections of the CMCSCC-1 nude mouse subcutaneous heterotransplanted (middle), and cultured CMCSCC-1 cells in cytospin preparations (bottom) for keratin, epidermal growth factor receptor (EGFR), CD44, Ki-67, and Ecadherin. EGFR and Ki-67 expression increased in both CMCSCC-1 cells and heterotransplanted tumors compared with that in the original tumor. Keratin expression decreased in the original tumor compared with that in CMCSCC-1 and the heterotransplanted tumor. Both CD44 and E-cadherin were strongly expressed in the original tumor and in CMCSCC-1 compared with that in the heterotransplanted tumor (original magnification 3400).
response versus the FaDu cell line and was therefore more radiosensitive (see Figure 7).
Radiation sensitivity FaDu and CMCSCC-1 xenografts were established in BALB/c nude mice to validate the radiosensitizing effect
FIGURE 6. CMCSCC-1 karyotype (features). Representative karyotype of one CMCSCC-1 cell at passage 50: 59 to approximately 74, X, add (X) (p22.3), 1 der (1;13) (q10;10) x 2, 1 der (1;11) (q10; q10), der (4) t (1;4) (p22; q35) x 2, 1 5, 1 5, add (7) (p22) x 2, I (8) (q10), der (10; 22) (q10; q10) x 2, add (11) (q23), add (12) (q24.1), del (14) (q11.2q13), der (15; 15) (q10; q10), add (20) (p12) [cp35].
E548
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
in vivo. The mice were exposed to total radiation of 20 Gy when the mouse tumors were approximately 100 mm3. Tumor sizes were measured after radiation, and the mice were euthanized for histopathological analysis. The morphology of the subcutaneous tumors was confirmed by hematoxylin-eosin staining (Figure 8A). The results were similar to those observed in vitro. The FaDu group tumors did not decrease in size, whereas the
FIGURE 7. Proliferation of FaDu and CMCSCC-1 cells after girradiation exposure. Cells were treated time dependently (at 24, 48, and 72 hours) with a single 20 Gy radiation dose. Cell viability was measured by the WST-8 assay. Data are given as mean obtained from 3 independent experiments.
NOVEL
HPV-RADIOSENSITIVE HNSCC
CELL LINE
FIGURE 8. In vivo, radiation response. (A) FaDu and CMCSCC-1 xenograft model tumors were observed by hematoxylin-eosin staining after radiation. (B) Tumor sizes were measured after the 20 Gy radiation dose. Graphs showing the tumor size endpoint. A value of p < .05 was considered statistically significant.
CMCSCC-1 group tumors did decrease in size (Figure 8B). Thus, the CMCSCC-1 cells were radiosensitive.
Orthotopic mice with oral squamous cell carcinoma We confirmed the invasive and metastatic potential of this tumor. Suspended CMCSCC-1 cells (1 3 105 cells/ 20 mL) were implanted into the right lateral portion of the tongue of mice. We confirmed tumors in the mouse tongue (Figure 9A). The mice were euthanized and images were taken using a microscope on the tongue and tumor tissue. However, no invasion or metastasis to lymph nodes was detected. Tongue tissue histology was histologically similar to that of human CMCSCC-1 (Figure 9B).
Short tandem repeat profile testing The submitted sample (CMCSCC-1) profile was human and did not match any cell lines in the Korean Cell Line Bank database.
DISCUSSION HPV has been known to cause all cases of cervical cancer and it has a reported role in HNSCC as well.16 Recent epidemiological and experimental data has implicated infection with HPV in the pathogenesis of HNSCC.19 HPV status is related to the treatment response, progression-free survival, and overall survival.4 HPVrelated tumors have very different genetic patterns than those of HPV-negative tumors, suggesting a distinct mechanism of pathogenesis.20 HPV-negative cancer had a poorer response to chemotherapy and radiotherapy compared to that of HPV-positive cancer. All results after chemotherapy and radiation therapy are better in patients with HPV-positive than those with HPV-negative cancer (2-year overall survival 87.9% vs 65.8%; progression-free
survival 71.8% vs 50.4%; and locoregional failure 13.6% vs 24.8%).4,9 In addition, patients with HPV-associated cancers tend to be younger and more likely to be nondrinkers and nonsmokers.16 Radiation sensitivity is associated with prolonged radiation-induced G2 cell-cycle arrest in HPV-positive cells and with increased apoptosismediated through activation of p53 signaling.7 Additionally, radiation therapy increases E6 and E7 protein expression; thus, the increased immune surveillance could contribute to improved survival.4 Increased survival of patients with HPV-positive cancer was also possibly attributable in part to the absence of field effects related to tobacco and alcohol exposure.6 Among HPV types, HPV16 and HPV18 are the most widely known and the most common types in HPV-positive HNSCC. We have experimentally confirmed the presence/absence of HPV infection and clearly demonstrated that the CMCSCC-1 cell line was HPV-negative. In the present study, we described the establishment and characterization of the new CMCSCC-1 cell line from the tongue of an untreated 57-year-old female patient (T2N0M0). Of note, she had a history of tobacco use but did not receive any preoperative radiotherapy or chemotherapy. An original tumor specimen was characterized for its morphological features, which were consistent with a malignant tumor. The CMCSCC-1 cell was established afresh in culture for 1 to 2 months through seeding after isolating from fibroblasts. The CMCSCC-1 cells were detached with 0.25% trypsin/EDTA for 3 minutes. The cell was unchanged in morphology or proliferation for 14 months, by the time when we reached experimental and empirical determination. The cells were multinuclear and polygonal, typical features of cancer cells. These cells grew on a monolayer as SCC. Most SCCs are tightly adherent, as it is important for epithelial organization. The doubling time of the CMCSCC-1 cell line was short HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E549
KIM ET AL.
FIGURE 9. Tongue tumors in CMCSCC-1 orthotopic xenografts. (A) Primary tumor in the tongue of a nude mouse induced by inoculation with CMCSCC-1 cells. (B) Hematoxylin-eosin slides of the CMCSCC1 tongue tumor revealed squamous cell carcinoma. Representative hematoxylin-eosin staining in paraffin sections of the tongue.
in approximately 24 hours compared with other HNSCCs.14 Primary cell lines have the characteristics of the original tissue, therefore, they are important tools for gene discovery, drug tests, and development of biomarker(s). To demonstrate this further, the CMCSCC-1 cells were also heterotransplanted in nude mice and, because the tumors successfully grew, heterotransplantation demonstrated the malignant potential of the cell line. Many studies have described cancer markers. HNSCC has several specific markers, such as p53, EGFR, erbB-2, and Ki-67. Among these, we confirmed expression of the tumor suppressor genes p16 and p53, and the oncogenes ras, myc, EGFR, erbB-2, and cyclin D1.15,21,22 Genetic alterations, such as deletion of tumor suppressor genes and amplification of oncogenes, have been identified.21 Notch, an HNSCC-associated protein, is an important tumor suppressor protein. Our results support a similar previous claim23 that notch is a possible HNSCC cancer marker. P53 is commonly altered in tobacco-related cancers,21 and the EGFR protein is altered in HNSCC and other malignant cancers; thus, forming a well-known therapeutic target.15 CD44 plays a significant role in tumor progression, poor prognosis, and metastasis of various cancers.18,24 CD44 is a glycoprotein with a role in proliferation, cell adhesion, and migration.24 CD133 is not as well-known as CD44, but is a cancer stem cell marker in various cancers.24 CD44 expression has been reported as a cancer stem cell surface marker in colon cancer, lung cancer, and breast cancer.24 In the present study, we confirmed CD44 and CD133 expression in HNSCC and the CMCSCC-1 cell line using fluorescence activated cell sorter. CMCSCC-1 cells had significantly increased CD44 expression, strongly suggestive of cancer cells. Various studies have reported expression of markers (keratin, EGFR, CD44, Ki-67, and E-cadherin) in many cancers; and we found that these markers were highly expressed in HSNCC.2 Keratin (cytokeratins) promotes E550
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
epithelial proliferation and tumor growth, and intermediate filament proteins are mainly expressed in epithelial cells.18 CD44 is a cell surface protein, and is expressed mainly on the cell surface.24,25 Ki-67 is a cell proliferation-associated protein, and stains in the nucleus stain.18 E-cadherin is an important epithelial cell-cell adhesion molecule related to carcinoma invasion and metastasis.18,26 These results indicate that CMCSCC-1 cells have typical characteristics of HNSCC. HNSCC karyotypes are complex, comprising multiple numerical and structural abnormalities.17 In this study, the karyotype of the CMCSCC-1 cell line was near-triploid, with both numeric and structural aberrations. Whole gains in chromosomes X, 1, 3, 5, 6, 7, 9, 10, 11, 16, 17, and 20 and whole losses in chromosomes 14, 21, and Y were observed, indicating different cytogenetic alterations. Loss of the Y chromosome has been observed in several HNSCC cell lines. Radiotherapy is a cancer treatment method generally used in combination with surgery or chemotherapy. HNSCC cell lines (such as FaDu and SCC cells) have been grown for radiation resistance despite their HPV negativity. We determined experimentally the resistance to radiation in the newly established cell line. It was found to express sensitivity to radiation, despite being HPV-negative. Thus, HNSCC is radiation resistant, whereas the CMCSCC-1 cell line was susceptible to radiation. We subsequently investigated the biological behavior of xenografts for radiation sensitivity. The therapeutic data presented is from in vivo studies comparing the radiosensitivity of this tumor volume to FaDu tumor volume. Thus, CMCSCC-1 tumors were radiation sensitive and exhibited reduced tumor volume. We established a mouse model for an orthotopic CMCSCC-1 xenograft tumor in the tongue to mimic clinical patients with head and neck cancer.27,28 The orthotopic CMCSCC-1 xenograft hindered mice from eating
NOVEL
within 3 weeks of injecting the cells, and lead to body weight loss.28 It was difficult to monitor tumor growth and metastatic spread in the orthotopic model.29 We used a bright light to visualize tumor growth and metastasis of orthotopic CMCSCC-1 in vivo. Orthotopic tumor growth in the buccal pouch was measured using calipers (data not shown). There are limitations for using cell line behavior as a reflection of original tumor biology. It is still a speculation that cell lines truly reflect the behavior of primary tumors. Nevertheless, we produced a new cancer cell line potentially important for preclinical disease progression studies and the development of new therapies in the most efficient and cost-effective way.10
CONCLUSIONS This study showed the successful establishment of a useful primary human HNSCC cell line. The CMCSCC-1 cell line was derived from the tongue of a SCC, HPVnegative, in a female patient (T2N0M0) with a history of tobacco but not alcohol use. This cell line is a new HPVnegative cell line that has demonstrated radiation sensitivity compared with established HNSCC cell lines. The CMCSCC-1 cell line could be an excellent model to develop advanced and expanded public research. It will facilitate further head and neck cancer investigation to develop new molecular target therapies.
REFERENCES 1. Leemans CR, Braakhuis BJ, Brakenhoff RH. The molecular biology of head and neck cancer. Nat Rev Cancer 2011;11:9–22. 2. Han J, Kioi M, Chu WS, Kasperbauer JL, Strome SE, Puri RK. Identification of potential therapeutic targets in human head & neck squamous cell carcinoma. Head Neck Oncol 2009;1:27. 3. Strati K, Pitot HC, Lambert PF. Identification of biomarkers that distinguish human papillomavirus (HPV)-positive versus HPV-negative head and neck cancers in a mouse model. Proc Natl Acad Sci U S A 2006;103: 14152–14157. 4. Marur S, D’Souza G, Westra WH, Forastiere AA. HPV-associated head and neck cancer: a virus-related cancer epidemic. Lancet Oncol 2010;11: 781–789. 5. Joo YH, Lee YS, Cho KJ, et al. Characteristics and prognostic implications of high-risk HPV-associated hypopharyngeal cancers. PLoS One 2013;8: e78718. 6. Lassen P, Eriksen JG, Hamilton–Dutoit S, et al. HPV-associated p16expression and response to hypoxic modification of radiotherapy in head and neck cancer. Radiother Oncol 2010;94:30–35. 7. Kimple RJ, Smith MA, Blitzer GC, et al. Enhanced radiation sensitivity in HPV-positive head and neck cancer. Cancer Res 2013;73:4791–4800. 8. Sorensen BS, Busk M, Olthof N, et al. Radiosensitivity and effect of hypoxia in HPV positive head and neck cancer cells. Radiother Oncol 2013;108:500–505.
HPV-RADIOSENSITIVE HNSCC
CELL LINE
9. Chung CH, Gillison ML. Human papillomavirus in head and neck cancer: its role in pathogenesis and clinical implications. Clin Cancer Res 2009;15: 6758–6762. 10. Tang AL, Hauff SJ, Owen JH, et al. UM-SCC-104: a new human papillomavirus-16-positive cancer stem cell-containing head and neck squamous cell carcinoma cell line. Head Neck 2012;34:1480–1491. 11. Nagel R, Martens–de Kemp SR, Buijze M, Jacobs G, Braakhuis BJ, Brakenhoff RH. Treatment response of HPV-positive and HPV-negative head and neck squamous cell carcinoma cell lines. Oral Oncol 2013;49: 560–566. 12. Skvortsov S, Jimenez CR, Knol JC, et al. Radioresistant head and neck squamous cell carcinoma cells: intracellular signaling, putative biomarkers for tumor recurrences and possible therapeutic targets. Radiother Oncol 2011;101:177–182. 13. Lee SY, Park HR, Cho NH, et al. Identifying genes related to radiation resistance in oral squamous cell carcinoma cell lines. Int J Oral Maxillofac Surg 2013;42:169–176. 14. Lin CJ, Grandis JR, Carey TE, et al. Head and neck squamous cell carcinoma cell lines: established models and rationale for selection. Head Neck 2007;29:163–188. 15. Lee DH, Lee JK. Establishment of a cell line (CNUH-HNSCC-1) derived from an advanced laryngeal squamous cell carcinoma. Chonnam Med J 2011;47:85–89. 16. Gold KA, Kim ES. Role of molecular markers and gene profiling in head and neck cancers. Curr Opin Oncol 2009;21:206–211. 17. Liebertz DJ, Lechner MG, Masood R, et al. Establishment and characterization of a novel head and neck squamous cell carcinoma cell line USCHN1. Head Neck Oncol 2010;2:5. 18. Lan, YJ, Chen H, Chen JQ, Lei QH, Zheng M, Shao ZR. Immunolocalization of vimentin, keratin 17, Ki-67, involucrin, b-catenin and E-cadherin in cutaneous squamous cell carcinoma. Pathol Oncol Res 2013. [Epub ahead of print]. 19. Cole L, Polfus L, Peters ES. Examining the incidence of human papillomavirus-associated head and neck cancers by race and ethnicity in the U.S., 1995–2005. PLoS One 2012;7:e32657. 20. Braakhuis BJ, Snijders PJ, Keune WJ, et al. Genetic patterns in head and neck cancers that contain or lack transcriptionally active human papillomavirus. J Natl Cancer Inst 2004;96:998–1006. 21. Nagai MA. Genetic alterations in head and neck squamous cell carcinomas. Braz J Med Biol Res 1999;32:897–904. 22. Smilek P, Dusek L, Vesel y K, Rottenberg J, Kostrica R. Correlation of expression of Ki-67, EGFR, c-erbB-2, MMP-9, p53, bcl-2, CD34 and cell cycle analysis with survival in head and neck squamous cell cancer. J Exp Clin Cancer Res 2006;25:549–555. 23. Brakenhoff RH. Cancer. Another NOTCH for cancer. Science 2011;333: 1102–1103. 24. Margaritescu C, Pirici D, Simionescu C, Stepan A. The utility of CD44, CD117 and CD133 in identification of cancer stem cells (CSC) in oral squamous cell carcinomas (OSCC). Rom J Morphol Embryol 2011;52(3 Suppl):985–993. 25. Kokko LL, Hurme S, Maula SM, et al. Significance of site-specific prognosis of cancer stem cell marker CD44 in head and neck squamous-cell carcinoma. Oral Oncol 2011;47:510–516. 26. Kawano T, Nakamura Y, Yanoma S, et al. Expression of E-cadherin, and CD44s and CD44v6 and its association with prognosis in head and neck cancer. Auris Nasus Larynx 2004;31:35–41. 27. Masood R, Hochstim C, Cervenka B, et al. A novel orthotopic mouse model of head and neck cancer and lymph node metastasis. Oncogenesis 2013;2:e68. 28. Wu CY, Chan PC, Chou LS, et al. Pulsed-focused ultrasound enhances boron drug accumulation in a human head and neck cancer xenograftbearing mouse model. Mol Imaging Biol 2014;16:95–101. 29. Sano D, Myers JN. Xenograft models of head and neck cancers. Head Neck Oncol 2009;1:32.
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E551
Establishment of a novel human papillomavirus–negative and radiosensitive head and neck squamous cell carcinoma cell line Kyung-Min Kim, MSc,1 Eun-Ji Park, MSc,2 Jiyoung Yeo,3 Young-Hoon Joo, MD,4 Kwang-Jae Cho, MD,4 Min-Sik Kim, MD, PhD4* 1
Department of Biomedicine and Health Science, College of Medicine, Seoul St. Mary’s Hospital, The Catholic University of Korea, Seoul, Republic of Korea, 2Department of POSTEC-Catholic BM Institute, College of Medicine, Seoul St. Mary’s Hospital, The Catholic University of Korea, Seoul, Republic of Korea, 3Department of Anatomy, School of Medicine, Pusan National University, Yangsan City, Gyengsangnam-Do, Seoul, Republic of Korea, 4Department of Otolaryngology–Head and Neck Surgery, College of Medicine, Seoul St. Mary’s Hospital, The Catholic University of Korea, Seoul, Republic of Korea.
Accepted 6 March 2015 Published online 27 July 2015 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/hed.24037
ABSTRACT: Background. The purpose of this study was to develop a CMCSCC21 cell line for head and neck cancer research into new therapies for head and neck squamous cell carcinoma (HNSCC). Methods. The CMCSCC-1 cell line was isolated from a primary oral tongue tumor specimen of a female patient. Tumor cells were evaluated for biomarkers expression by Western blots, reverse transcriptasepolymerase chain reaction (RT-PCR), fluorescence activated cell sorter, and immunostaining. Cell proliferation in response to radiation was measured by the WST-8 assay. Results. The characterization analyses revealed a typical epithelial morphology; a doubling time of approximately 24 hours, high tumorigenicity
INTRODUCTION Head and neck squamous cell carcinoma (HNSCC) is the sixth most prevalent cancer worldwide, with approximately 600,000 new cases diagnosed every year.1 HNSCC is associated with excessive alcohol consumption, history of tobacco use, and human papillomavirus (HPV) infection.2 The combination of smoking and drinking is well known to increase the risk of this cancer. Although HPV has been long known to be a major cause of cervical and most other anogenital cancers, it recently was also identified as an etiology of a subset of HNSCC.3,4 Increased incidence of HPV-related HNSCC represents a new viral epidemic of cancer. HPV has been shown to be of prognostic significance, particularly in HNSCC.5 A recent report showed that patients with HPVpositive HNSCC have a better prognosis compared with patients with virus-negative tumors.6 Not all patients with HPV-negative tumors have a good response to chemotherapy and radiotherapy, and the reasons for this are not
*Corresponding author: M.-S. Kim, Department of Otolaryngology–Head and Neck Surgery, 505 Banpodong Seochogu, Seoul St. Mary’s Hospital, The Catholic University of Korea, Seoul, Republic of Korea 137-040. E-mail: [email protected] Contract grant sponsor: Korean Health Technology R&D Project, Ministry of Health & Welfare; contract grant number: A091205; Korea government; contract grant number: No. 2012–0004140
E542
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
in immunodeficient mice, and upregulated biomarkers. CMCSCC-1 cells were negative for human papillomavirus (HPV) infection, but more sensitive to radiation compared with those FaDu cell lines. Conclusion. CMCSCC-1, a novel oral tongue SCC cell line, was established. It will help in the elucidation of the molecular pathogenesis of C 2015 Wiley Periodicals, Inc. Head HPV-negative radiosensitive tumors. V Neck 38: E542–E551, 2015
KEY WORDS: head and neck neoplasms, squamous cell carcinoma, tumor cell line, human papillomavirus, radiotherapy
known. HPV-positive cells have markedly higher radiosensitivity than that of HPV-negative cells, and HPVnegative cells are more resistant to radiation.7,8 Malignant transformation and maintenance of phenotype in head and neck cancer has been attributed mainly to the E6 and E7 oncoproteins. The biology of HPV-positive HNSCC was distinct with tumor suppressor protein p53 degradation and inactivation of retinoblastoma Rb pathways.4 Recent studies indicated that the E6 and E7 proteins have multiple binding partners that exerted oncogenic effects besides degradation of p53 and pRb, and have complementary effects on transforming activity.9 The HPVinfected HNSCC cell lines enhanced the ability to study the role of HPV in the development of sensitivity or resistance to therapy in HNSCC.10 The purpose of this study was to develop the background for research on a new HNSCC target therapy by establishing an HPV-negative and radiosensitive HNSCC cell line. We describe the establishment and characteristics of a novel cell line named “CMCSCC-1,” which was obtained from a female tongue SCC. Various HNSCC cell lines with known characteristics are used in research, such as the FaDu and the SCC cell lines. These cell lines are HPV-negative and are radiation resistant.8,11–13 Most studies with these cells have focused on oncogenic mechanisms; however, the mechanisms of tumorigenesis and tumor progression are unknown.2 Permanent HNSCC tumors cell lines are important tools for research into the
NOVEL
molecular, biochemical, and genetic properties of head and neck cancer.14 Likewise, our newly established cancer cell line can be used as a powerful tool for various head and neck cancer research, new therapies, and preclinical studies on cancer progression.15 In this article, we describe the development and characterization of a new radio-sensitive HPV-negative HNSCC cell line.
MATERIALS AND METHODS Establishment of cell line The patient provided written informed consent for the use of her tissue and medical records in this study. The Institutional Review Board of the Catholic Medical Center (IRB No. KC11SISI0558) reviewed and approved the study and the consent form. Surgically resected tumor tissue was placed in a 15 mL conical tube filled with approximately 5 mL of serum-free Dulbecco modified Eagle’s medium (DMEM)/F12 (GenDEPOT, Barker, TX). The tissue was immediately transported on ice (within 1 hour) to the laboratory for tissue dissociation. The tissue was then mechanically divided into small fragments using scissors and forceps and subsequently washed 2 to 3 times in Dulbecco’s phosphate-buffered saline (GenDEPOT). Tissue fragments were further enzymatically dissociated in 10 mL of serum-free DMEM/F12 (GenDEPOT) containing collagenase type IV (300 U/mL), DNase (125 U/mL), and 1% antibiotic/antimycotic for 60 minutes in a 37 C shaking water bath. After dissociation, the isolated cells were filtered through a 0.7 mm strainer and then centrifuged at 1500 rpm for 5 minutes. The cells were seeded in serum-free medium containing various growth factors, such as epidermal growth factor, basic fibroblast growth factor, N-2 Supplement (Gibco, Grand Island, NY), B-27 Serum-Free supplement (Gibco), and antibiotic/antimycotic in a humidified incubator at 37 C with 5% CO2. Normal fibroblasts were removed 2 to 3 days after seeding by differential trypsinization to enrich the malignant cell population.
Cell lines The FaDu cell line, well-known as HNSCC, and the HeLa cell line were purchased from the American Tissuetype Cell Collection (ATCC). FaDu and HeLa cells were grown in DMEM (GenDEPOT). All the cell lines’ media were supplemented with 10% fetal bovine serum (Multicell; Wisent, St. Bruno, Quebec, Canada), and 1% penicillin/streptomycin (Gibco) in a humidified incubator at 37 C with 5% CO2.
Heterotransplantation in Balb/c-nude mice Four-week-old female BALB-c/nude mice were purchased from Central Laboratory Animal (Seoul, Korea). The mice were injected with cultured CMCSCC-1 cells for heterotopic (subcutaneously in the flank, 3 3 106 cells in 100 mL phosphate-buffered saline [PBS]) and orthotopic (base of the tongue, 1 3 105 cells in 20 mL PBS) heterotransplantation studies. Tumor volume (n 5 3) was measured once a week for 5 weeks after cell inoculation (calculation formula: V 5 length 3 width2 3 0.5). All
HPV-RADIOSENSITIVE HNSCC
CELL LINE
procedures were approved by the Animal Ethics Committee of the Catholic University (2014-0007-04). For tissue morphology, tumor tissues were stained with standard hematoxylin-eosin staining procedure. After the mice were euthanized, some parts of the primary tumors were fixed in 10% paraformaldehyde for 24 hours at 4 C. Fixed tumor tissue was prepared as a paraffin-embedded tissue block, and 3-mm thick sections were placed on glass slides. The slides were warmed for 1 hour at 60 C, deparaffinized in xylene, and rehydrated in serially diluted ethanol (100%, 95%, 80%, and 70%). The sections were stained with hematoxylin for 3 to 5 minutes followed by washing with tap water until clear. The sections were then immersed 2 to 3 times in acid alcohol (1% HCL in 70% EtOH) until they turned pink and were washed with tap water for 3 to 5 minutes. The sections were immersed in ammonia water (1 mL NH4OH in 1 L H2O) for 3 to 5 times. After washing in tap water, the sections were stained with eosin for 1 minute. Cell morphology was visualized with the Panoramic Viewer Software System and a digital slide scanner (Panoramic MIDI, 3DHISTECH, Budapest, Hungary).
Western blot Total protein was separated by 8% and 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany), and blocked in 5% skim milk. Primary antibody solutions were incubated for 1 hour according to the manufacturer’s instructions, as follows: monoclonal anti-actin (1:1000; Sigma–Aldrich, St. Louis, MO), p53 (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA), and epidermal growth factor receptor (EGFR; 1:1000; Cell Signaling Technologies, Danvers, MA). Blots were incubated with the primary antibody solutions overnight at 4 C. Membranes were washed with Tris-buffered saline containing 0.05% Tween20 and probed with horseradish peroxidase-conjugated anti-rabbit secondary antibody solution (Thermo Scientific, Rockford, IL). Proteins were visualized using an enhanced chemiluminescence system (Thermo Scientific), in accord with the manufacturer’s instructions.
Reverse transcription–polymerase chain reaction Total RNAs were extracted from the samples using Trizol reagent (Invitrogen, Carlsbad, CA), in accord with the manufacturer’s instructions. The cDNA was synthesized with an M-MLV Reverse Transcriptase Kit & Recombinant RNasin Ribonuclease inhibitor (PromegaBiotec, Madison, WI), in accord with the manufacturer’s protocol. Detection of HPV16 and HPV18 by polymerase chain reaction (PCR) was performed using primers for HPV16 forward: ATGTTTCAGGACCCACAGGA, reverse: CCTCACGTCGCAGTAACTGT; and HPV18 forward: ATGGCGCGCTTTGAGGATCC, reverse: GCATGCGGTATACTGTCTCT. The initial denaturation of DNA was performed at 95 C for 2 minutes, and 30 cycles PCR (including annealing) were performed as follows: 95 C for 20 seconds, 55 C for 40 seconds, and 72 C for 1 minute, and its final extension was at 72 C for 5 minutes, HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E543
KIM ET AL.
and 4 C for infinity. The PCR products were run on a 1% agarose gel. The HeLa cell line was used as a positive control and the known HPV-negative cell line FaDu was used as a negative control for HPV16 and HPV18 (amplicon sizes of 188 and 124, respectively). Total RNA concentrations were measured with a NanoDrop ND-1000 Spectrophotometer (Peqlab, Erlangen, Germany) and quality was determined with the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA).
In situ hybridization of human papillomavirus Tissue sections (4-mm thick) were prepared from formalin-fixed, paraffin-embedded tissues and mounted on 3-aminopropylmethoxysilane-coated slides. In situ hybridization was performed on an automated Benchmark system from Ventana Medical Systems (Tucson, AZ) utilizing the INFORMH HPV III Family 16 Probe (cocktail of HPV subtypes 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, and 66, Ventana Medical Systems), as described previously. This system enabled removal or the paraffin wax from the tissue, protease digestion, and then hybridization with a probe. The probe-target complex was detected by the action of alkaline phosphatase on the chromogen nitroblue tetrazolium and bromochloroindolylphosphate, which yielded a dark blue color with a pink counter stain for the HPV-negative cells because of nuclear fast red. Evaluation of the nuclear hybridization was performed by a pathologist who had specialized in head and neck pathology.5
Flow cytometry CMCSCC-1 cells were harvested with 0.05% trypsinEDTA (Gibco) and incubated at 4 C with fluorescein isothiocyanate-conjugated anti-CD44 (BD Biosciences, San Jose, CA) without fixation. CD44 cells were detected using the fluorescence activated cell sorter Calibur flow cytometer (BD Biosciences).
Tissue specimens were fixed in 10% formalin for 24 hours at 4 C and embedded in paraffin. The 3-mm thick sections were placed on glass slides and stained using the Polink-2 horseradish peroxidase-conjugated diaminobenzidine Detection System. The slides were warmed for 1 hour at 60 C, deparaffinized in xylene, and rehydrated in serially diluted ethanol (100%, 95%, 80%, and 70%). Antigen retrieval was performed by heating the sample in 0.01 M citrate buffer at pH 6.0 for 20 minutes using a microwave. The slides were treated with 3% hydrogen peroxide (H2O2) in methanol for 10 minutes to quench endogenous peroxidase activity and then blocked with 1% bovine serum albumin in PBS. The slides were incubated with primary antibodies overnight at 4 C. Primary antibodies and concentrations are as follows: EGFR (1:50; Cell Signaling Technologies), CD44 (1:50; Cell Signaling Technologies), Ki-67 (1:50; Abcam, Cambridge, MA), keratin (1:25; Cell Signaling Technologies), and Ecadherin (1:100; Cell Signaling Technologies). The slides were washed with Tris-buffered saline-T buffer, and the peroxidase EnVision System (HPR Rabbit/Mouse Envision System, DakoCytomation, Glostrup, Denmark) was HEAD & NECK—DOI 10.1002/HED
Immunocytochemistry Cells were seeded in 8-well chamber slides. Media were removed and the cells were washed with 13 PBS. Cells on chamber slides were fixed in 10% formaldehyde for 15 minutes at room temperature. The cells were rinsed 3 times with 13 PBS. Blocking was performed with 10% goat serum diluted in blocking buffer (5% bovine serum albumin and 0.5% Tween20 in 13 PBS). The blocking solution was removed and the cells were incubated in primary antibody in blocking buffer overnight at 4 C with gentle rocking. The primary antibody dilutions were: EGFR (1:200), CD44 (1:200), Ki-67 (1:100), keratin (1:200), and E-cadherin (1:400). Subsequent steps were the same as those for the immunohistochemistry method. The stained areas in the slides were confirmed by fluorescence microscopy (Olympus AX70; Olympus Optical, Tokyo, Japan).
Cytogenetics We added 30 mL Chromosome Resolution Additive (Genial Genetic Solutions, Runcorn, UK) to each 6-well plate. After 1 hour of incubation, colcemid was treated for 30 minutes. Cells were harvested using trypsin and treated by prewarmed hypotonic solution (KCl). The cells were fixed in a 1:3 acetic acid:methanol solution, and slides were prepared for chromosome analysis. The chromosome analysis was performed using a trypsin-Giemsa banding technique. At least 20 metaphase plates were analyzed.
Cell viability assay
Immunohistochemistry
E544
applied for 5 to 10 minutes at room temperature. Peroxidase activity was detected with 3,3-diaminobenzidine tetrachloride and counterstained with hematoxylin. The stained area was scanned and measured as a percentage using the Panoramic Viewer Software System and a digital slide scanner (Panoramic MIDI).
APRIL 2016
Cells initially treated with 2 Gy radiation were grown to 80% confluence after seeding in another dish. Aliquots accumulated a dose of 20 Gy after 10 repetitions. The cells were seeded in triplicate at 3 3 103 cells/well in 96well plates. After overnight growth, the cells were observed for 24 hours, 48 hours, and 72 hours at 37 C with a radiation dose 20 Gy. Cell viability was assessed using a WST-8 assay [2-(2-methoxy-4-nitrophenyl)23-(4nitrophenyl)25-(2,4-disulfophenyl)22H-tetrazolium, monosodium salt] (Cell Counting Kit, DOJINDO, Kumamaoto, Japan). The plates were measured at an absorbance of 450㎚ using a microplate reader.
Ionizing irradiation of mice Mice were injected subcutaneously in the flank, with a 0.1 mL inoculum of viable 3 3 106 CMCSCC-1 cells. Locoregional irradiation was applied in a single dose of 2 Gy using a g-irradiator (MDS Nordion, Ottawa, Ontario, Canada) when the volume of tumors had reached approximately 100 mm3. Fractionated doses were administered at 48-hour intervals. Aliquots accumulated a dose of 20 Gy after 10 repetitions. Tumor volume (n 5 3) was measured
NOVEL
HPV-RADIOSENSITIVE HNSCC
CELL LINE
FIGURE 1. Establishing CMCSCC-1 cells from squamous cell carcinoma of the oral cavity. (A) Hematoxylin-eosin stained malignant cells with large nuclei and an abundance of cytoplasm typical of squamous cells. (B) Phase-contrast microphotograph of growing CMCSCC-1 cells (passage 4) showing numerous mitotic cells with tightly adherent squamous cell morphology. Over 90% seem to be multinucleated cells in the phase contrast panel (left, original magnification 3200; right, original magnification 3400).
when 20 Gy radiation was expose (calculation formula; V 5 length 3 width2 3 0.5).
Cell authentication testing by the Korea Cell Line Bank The cell lines were authenticated by DNA fingerprinting of short tandem repeats (STRs) at the Korea Cell Line Bank (Seoul, Korea) using the AmplFLSTR identifier PCR Amplification kit (Applied Biosystems, Foster City, CA). Data were analyzed using the 3730 DNA Analyzer (Applied Biosystems) and GeneMapper ID v 3.2 software (Applied Biosystems).
Statistical analysis Results are presented as means and SDs of at least 3 independent experiments. Statistical comparisons were made by analysis of variance using SPSS 13.0 software (SPSS, Chicago, IL). A p value < .05 or < .001 was considered as statistically significant.
The CMCSCC-1 cell line was established from the primary tumor specimen after approximately 4 weeks in culture. The majority of fibroblasts were removed by light trypsinization without disturbing the more securely attached tumor cells. The cells were tightly adherent to the bottom of the culture plate. The cells demonstrated typical squamous cell morphology that maintained a persistent shape as they were isolated and cultured. Hematoxylin-eosin staining showed the histological characteristics of poorly differentiated SCC and a few keratin pearls (Figure 1A), which is a positive test for a cancerous tumor mass. Single cultured cells from the tumor tissue were initially small and round, and then started to change to form branches in multiple directions. These cells tended to form a monolayer with epithelial features. CMCSSC-1 had a doubling time of 24 hours. Distinctive cell morphology was found, such as multiple nuclei and polygonal and spindle-shaped cells. These cells retained similar morphology for over 50 passages (Figure 1B).
RESULTS Histopathology and morphology
Human papillomavirus
CMCSCC-1 was derived from a 57-year-old woman with a left lateral mobile tongue squamous cell carcinoma (SCC; T2N0M0).The patient had partial glossectomy via the pull-through approach, and reconstruction procedures with radial forearm free flap were performed with bilateral neck dissections. The patient was treated by surgical excision without irradiation and/or chemotherapy. No recurrence was detected 14 months after surgery. The patient’s social history was 10 packs of cigarettes per day for 20 years and no alcoholic drinking.
HPV is associated with HNSCC carcinogenesis. The CMCSCC-1 cell line was screened for this oncogenic virus by PCR. Expression of HPV16 and HPV18 were tested by reverse transcriptase-polymerase chain reaction (RT-PCR) in CMCSCC-1 and in the HPV-positive control, HeLa cell line. The HPV-negative control was the FaDu cell line. The result showed that CMCSCC-1 was negative for HPV infection, using primers specific for HPV16 and HPV18 (see Figure 2). In situ hybridization was also negative for HPV (data not shown). HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E545
KIM ET AL.
FIGURE 2. Reverse transcriptasepolymerase chain reaction (RT-PCR) detection showed absence of human papillomavirus (HPV) infection of CMCSCC-1 cells compared with HeLa and FaDu. HPV detection using HPV16 and HPV18 primers demonstrated that CMCSCC-1 cells were HPV-negative. HeLa, positive control; FaDu, negative control; GAPDH, glyceraldehyde 3phosphate dehydrogenase.
Heterotransplantation in BALB-c/nude mice Transplant of cultured CMCSCC-1 to nude mice was performed. Cultured CMCSCC-1 cells were heterotransplanted subcutaneously in nude mice and produced expanding tumors in 3/3 mice. This result further confirmed malignancy of the cell line (see Figure 3). Suspended CMCSCC-1 cells (3 3 106 cells/100 mL) were injected subcutaneously in the right hind leg in three 5-
week-old female nude mice. The mice were carefully observed for 5 weeks postinjection, and tumor sizes were measured once weekly (Figure 3A and 3B). At this time, tumor sizes had exceeded 300 mm3 and the injected mice were euthanized for histopathological analysis. The morphology of the subcutaneous tumors was confirmed by hematoxylin-eosin staining. Hematoxylin-eosin–stained histological sections of the heterotransplanted tumors showed poorly differentiated SCC. The tumors were
FIGURE 3. Heterotransplantation of CMCSCC-1 cells into BALB-c/nude mice. Xenografted tumor and histopathology of a tumor derived from CMCSCC-1 cells. (A) Appearance of CMCSCC-1 tumors (subcutaneous) in nude mice. (B) Tumor volumes were measured for 5 weeks after injecting tumor cells. Calculation formula; V 5 length 3 width2 3 0.5. (C) Histology of xenograft tissue showing tumor cell heterogeneity (hematoxylineosin; C 5 original magnification 3200; D 5 original magnification 3400).
E546
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
NOVEL
HPV-RADIOSENSITIVE HNSCC
CELL LINE
FIGURE 4. Identifying CMCSCC-1 cancer cell biomarkers. (A) Oncogene and cancer marker expression by CMCSCC-1 cells. P53 and Notch1 expression in FaDu and CMCSCC-1 cells. Gene amplification was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression. (B) P53 and epidermal growth factor receptor (EGFR) protein expression as cancer cell markers with that of actin. (C) Expression profile of CD44 as a cancer marker in the CMCSCC-1 and head and neck squamous cell carcinoma (HNSCC) cell lines. CMCSCC-1 cells were stained for CD44, a wellknown cancer marker, using a monoclonal antibody and characterized by flow cytometry (FACs). Cell lines with increased CD44; FaDu was 91.9%, and CMCSCC-1 was 91.6%. Therefore, CMCSCC-1 cells were demonstrated to be cancer cells. CD44 was significantly upregulated in CMCSCC-1 cells compared to that in HNSCC cells. The negative control was no staining with primary antibody.
composed of spindle-like cells exhibiting frequent mitotic figures. As expected, the tumors from transplanted CMCSCC-1 cells had a histopathological appearance similar to that of the original surgical specimen (Figure 3C and 3D). These findings demonstrate that the cell line was suitable for transplant into a xenograft model and that the heterotransplanted tumors closely resembled the original tumor.
Head and neck cancer biomarkers The cell line was also tested by RT-PCR for expression of pertinent tumor suppressor genes. Among HNSCC markers, the representative p53 protein showed similar expression with that by FaDu cells. Notch1 was also expressed similarly (Figure 4A). Western blot revealed the protein expression levels of p53 and EGFR in CMCSCC-1, compared to FaDu. EGFR, an oncogene marker, was higher than the control. FaDu (positive control) and CMCSCC-1 cells showed higher or similar expression levels of the cancer markers (Figure 4B). The CMCSCC-1 cell line was characterized for cell surface and cancer stem cell marker (common HNSCC biomarkers) by flow cytometry (Figure 4C). CMCSCC-1 cells had significantly increased staining of CD44 compared to controls. Immunophenotypic characterization of cultured CMCSCC-1 and its heterotransplants were similarly shown for the original tumor and thus confirmed as a SCC. Original tumor, the heterotransplanted tumor, and
CMCSCC-1 cells were confirmed by expression of keratin, EGFR, CD44, Ki-67, and E-cadherin on immunohistochemistry (see Figure 5). CMCSCC-1 cells positively expressed all related markers. Our EGFR, CD44, Ki-67, and E-cadherin expression results were consistent with those of previous reports.16–18 Thus, CMCSCC-1 cells have many characteristics of the HNSCC phenotype.
Cytogenetic analysis A cytogenetic analysis of CMCSCC-1 cells was performed to confirm the unique identity of this cell line and its origin from the original tumor sample. All mitotic cells analyzed from the CMCSCC-1 cell line were clonally abnormal. The complex near-triploid clone was characterized by 59 to approximately 74 modal chromosomes with deletions involving chromosome 14; additional material of unknown origin on chromosomes 7, 11, 12, and 20; a derivative of chromosomes 1, 3, 4, 10, and 15; gains on chromosomes X, 1, 3, 5, 6, 7, 9, 10, 11, 16, 17, and 20; and losses of chromosomes 14, 21, and Y. A representative karyotype is shown in Figure 6.
Cell proliferation Radiation response effect on FaDu and CMCSCC-1 cells was measured by the WST-8 assay. After being exposed to time-dependent g-irradiation (20 Gy), the CMCSCC-1 cell showed significantly lower proliferative HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E547
KIM ET AL.
FIGURE 5. Characterization of the patient’s tumor, heterotransplanted tumor, and CMCSCC-1 cells. Photomicrographs of immunoperoxidase staining of the original tumor (top), formalin-fixed paraffin-embedded tissue sections of the CMCSCC-1 nude mouse subcutaneous heterotransplanted (middle), and cultured CMCSCC-1 cells in cytospin preparations (bottom) for keratin, epidermal growth factor receptor (EGFR), CD44, Ki-67, and Ecadherin. EGFR and Ki-67 expression increased in both CMCSCC-1 cells and heterotransplanted tumors compared with that in the original tumor. Keratin expression decreased in the original tumor compared with that in CMCSCC-1 and the heterotransplanted tumor. Both CD44 and E-cadherin were strongly expressed in the original tumor and in CMCSCC-1 compared with that in the heterotransplanted tumor (original magnification 3400).
response versus the FaDu cell line and was therefore more radiosensitive (see Figure 7).
Radiation sensitivity FaDu and CMCSCC-1 xenografts were established in BALB/c nude mice to validate the radiosensitizing effect
FIGURE 6. CMCSCC-1 karyotype (features). Representative karyotype of one CMCSCC-1 cell at passage 50: 59 to approximately 74, X, add (X) (p22.3), 1 der (1;13) (q10;10) x 2, 1 der (1;11) (q10; q10), der (4) t (1;4) (p22; q35) x 2, 1 5, 1 5, add (7) (p22) x 2, I (8) (q10), der (10; 22) (q10; q10) x 2, add (11) (q23), add (12) (q24.1), del (14) (q11.2q13), der (15; 15) (q10; q10), add (20) (p12) [cp35].
E548
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
in vivo. The mice were exposed to total radiation of 20 Gy when the mouse tumors were approximately 100 mm3. Tumor sizes were measured after radiation, and the mice were euthanized for histopathological analysis. The morphology of the subcutaneous tumors was confirmed by hematoxylin-eosin staining (Figure 8A). The results were similar to those observed in vitro. The FaDu group tumors did not decrease in size, whereas the
FIGURE 7. Proliferation of FaDu and CMCSCC-1 cells after girradiation exposure. Cells were treated time dependently (at 24, 48, and 72 hours) with a single 20 Gy radiation dose. Cell viability was measured by the WST-8 assay. Data are given as mean obtained from 3 independent experiments.
NOVEL
HPV-RADIOSENSITIVE HNSCC
CELL LINE
FIGURE 8. In vivo, radiation response. (A) FaDu and CMCSCC-1 xenograft model tumors were observed by hematoxylin-eosin staining after radiation. (B) Tumor sizes were measured after the 20 Gy radiation dose. Graphs showing the tumor size endpoint. A value of p < .05 was considered statistically significant.
CMCSCC-1 group tumors did decrease in size (Figure 8B). Thus, the CMCSCC-1 cells were radiosensitive.
Orthotopic mice with oral squamous cell carcinoma We confirmed the invasive and metastatic potential of this tumor. Suspended CMCSCC-1 cells (1 3 105 cells/ 20 mL) were implanted into the right lateral portion of the tongue of mice. We confirmed tumors in the mouse tongue (Figure 9A). The mice were euthanized and images were taken using a microscope on the tongue and tumor tissue. However, no invasion or metastasis to lymph nodes was detected. Tongue tissue histology was histologically similar to that of human CMCSCC-1 (Figure 9B).
Short tandem repeat profile testing The submitted sample (CMCSCC-1) profile was human and did not match any cell lines in the Korean Cell Line Bank database.
DISCUSSION HPV has been known to cause all cases of cervical cancer and it has a reported role in HNSCC as well.16 Recent epidemiological and experimental data has implicated infection with HPV in the pathogenesis of HNSCC.19 HPV status is related to the treatment response, progression-free survival, and overall survival.4 HPVrelated tumors have very different genetic patterns than those of HPV-negative tumors, suggesting a distinct mechanism of pathogenesis.20 HPV-negative cancer had a poorer response to chemotherapy and radiotherapy compared to that of HPV-positive cancer. All results after chemotherapy and radiation therapy are better in patients with HPV-positive than those with HPV-negative cancer (2-year overall survival 87.9% vs 65.8%; progression-free
survival 71.8% vs 50.4%; and locoregional failure 13.6% vs 24.8%).4,9 In addition, patients with HPV-associated cancers tend to be younger and more likely to be nondrinkers and nonsmokers.16 Radiation sensitivity is associated with prolonged radiation-induced G2 cell-cycle arrest in HPV-positive cells and with increased apoptosismediated through activation of p53 signaling.7 Additionally, radiation therapy increases E6 and E7 protein expression; thus, the increased immune surveillance could contribute to improved survival.4 Increased survival of patients with HPV-positive cancer was also possibly attributable in part to the absence of field effects related to tobacco and alcohol exposure.6 Among HPV types, HPV16 and HPV18 are the most widely known and the most common types in HPV-positive HNSCC. We have experimentally confirmed the presence/absence of HPV infection and clearly demonstrated that the CMCSCC-1 cell line was HPV-negative. In the present study, we described the establishment and characterization of the new CMCSCC-1 cell line from the tongue of an untreated 57-year-old female patient (T2N0M0). Of note, she had a history of tobacco use but did not receive any preoperative radiotherapy or chemotherapy. An original tumor specimen was characterized for its morphological features, which were consistent with a malignant tumor. The CMCSCC-1 cell was established afresh in culture for 1 to 2 months through seeding after isolating from fibroblasts. The CMCSCC-1 cells were detached with 0.25% trypsin/EDTA for 3 minutes. The cell was unchanged in morphology or proliferation for 14 months, by the time when we reached experimental and empirical determination. The cells were multinuclear and polygonal, typical features of cancer cells. These cells grew on a monolayer as SCC. Most SCCs are tightly adherent, as it is important for epithelial organization. The doubling time of the CMCSCC-1 cell line was short HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E549
KIM ET AL.
FIGURE 9. Tongue tumors in CMCSCC-1 orthotopic xenografts. (A) Primary tumor in the tongue of a nude mouse induced by inoculation with CMCSCC-1 cells. (B) Hematoxylin-eosin slides of the CMCSCC1 tongue tumor revealed squamous cell carcinoma. Representative hematoxylin-eosin staining in paraffin sections of the tongue.
in approximately 24 hours compared with other HNSCCs.14 Primary cell lines have the characteristics of the original tissue, therefore, they are important tools for gene discovery, drug tests, and development of biomarker(s). To demonstrate this further, the CMCSCC-1 cells were also heterotransplanted in nude mice and, because the tumors successfully grew, heterotransplantation demonstrated the malignant potential of the cell line. Many studies have described cancer markers. HNSCC has several specific markers, such as p53, EGFR, erbB-2, and Ki-67. Among these, we confirmed expression of the tumor suppressor genes p16 and p53, and the oncogenes ras, myc, EGFR, erbB-2, and cyclin D1.15,21,22 Genetic alterations, such as deletion of tumor suppressor genes and amplification of oncogenes, have been identified.21 Notch, an HNSCC-associated protein, is an important tumor suppressor protein. Our results support a similar previous claim23 that notch is a possible HNSCC cancer marker. P53 is commonly altered in tobacco-related cancers,21 and the EGFR protein is altered in HNSCC and other malignant cancers; thus, forming a well-known therapeutic target.15 CD44 plays a significant role in tumor progression, poor prognosis, and metastasis of various cancers.18,24 CD44 is a glycoprotein with a role in proliferation, cell adhesion, and migration.24 CD133 is not as well-known as CD44, but is a cancer stem cell marker in various cancers.24 CD44 expression has been reported as a cancer stem cell surface marker in colon cancer, lung cancer, and breast cancer.24 In the present study, we confirmed CD44 and CD133 expression in HNSCC and the CMCSCC-1 cell line using fluorescence activated cell sorter. CMCSCC-1 cells had significantly increased CD44 expression, strongly suggestive of cancer cells. Various studies have reported expression of markers (keratin, EGFR, CD44, Ki-67, and E-cadherin) in many cancers; and we found that these markers were highly expressed in HSNCC.2 Keratin (cytokeratins) promotes E550
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
epithelial proliferation and tumor growth, and intermediate filament proteins are mainly expressed in epithelial cells.18 CD44 is a cell surface protein, and is expressed mainly on the cell surface.24,25 Ki-67 is a cell proliferation-associated protein, and stains in the nucleus stain.18 E-cadherin is an important epithelial cell-cell adhesion molecule related to carcinoma invasion and metastasis.18,26 These results indicate that CMCSCC-1 cells have typical characteristics of HNSCC. HNSCC karyotypes are complex, comprising multiple numerical and structural abnormalities.17 In this study, the karyotype of the CMCSCC-1 cell line was near-triploid, with both numeric and structural aberrations. Whole gains in chromosomes X, 1, 3, 5, 6, 7, 9, 10, 11, 16, 17, and 20 and whole losses in chromosomes 14, 21, and Y were observed, indicating different cytogenetic alterations. Loss of the Y chromosome has been observed in several HNSCC cell lines. Radiotherapy is a cancer treatment method generally used in combination with surgery or chemotherapy. HNSCC cell lines (such as FaDu and SCC cells) have been grown for radiation resistance despite their HPV negativity. We determined experimentally the resistance to radiation in the newly established cell line. It was found to express sensitivity to radiation, despite being HPV-negative. Thus, HNSCC is radiation resistant, whereas the CMCSCC-1 cell line was susceptible to radiation. We subsequently investigated the biological behavior of xenografts for radiation sensitivity. The therapeutic data presented is from in vivo studies comparing the radiosensitivity of this tumor volume to FaDu tumor volume. Thus, CMCSCC-1 tumors were radiation sensitive and exhibited reduced tumor volume. We established a mouse model for an orthotopic CMCSCC-1 xenograft tumor in the tongue to mimic clinical patients with head and neck cancer.27,28 The orthotopic CMCSCC-1 xenograft hindered mice from eating
NOVEL
within 3 weeks of injecting the cells, and lead to body weight loss.28 It was difficult to monitor tumor growth and metastatic spread in the orthotopic model.29 We used a bright light to visualize tumor growth and metastasis of orthotopic CMCSCC-1 in vivo. Orthotopic tumor growth in the buccal pouch was measured using calipers (data not shown). There are limitations for using cell line behavior as a reflection of original tumor biology. It is still a speculation that cell lines truly reflect the behavior of primary tumors. Nevertheless, we produced a new cancer cell line potentially important for preclinical disease progression studies and the development of new therapies in the most efficient and cost-effective way.10
CONCLUSIONS This study showed the successful establishment of a useful primary human HNSCC cell line. The CMCSCC-1 cell line was derived from the tongue of a SCC, HPVnegative, in a female patient (T2N0M0) with a history of tobacco but not alcohol use. This cell line is a new HPVnegative cell line that has demonstrated radiation sensitivity compared with established HNSCC cell lines. The CMCSCC-1 cell line could be an excellent model to develop advanced and expanded public research. It will facilitate further head and neck cancer investigation to develop new molecular target therapies.
REFERENCES 1. Leemans CR, Braakhuis BJ, Brakenhoff RH. The molecular biology of head and neck cancer. Nat Rev Cancer 2011;11:9–22. 2. Han J, Kioi M, Chu WS, Kasperbauer JL, Strome SE, Puri RK. Identification of potential therapeutic targets in human head & neck squamous cell carcinoma. Head Neck Oncol 2009;1:27. 3. Strati K, Pitot HC, Lambert PF. Identification of biomarkers that distinguish human papillomavirus (HPV)-positive versus HPV-negative head and neck cancers in a mouse model. Proc Natl Acad Sci U S A 2006;103: 14152–14157. 4. Marur S, D’Souza G, Westra WH, Forastiere AA. HPV-associated head and neck cancer: a virus-related cancer epidemic. Lancet Oncol 2010;11: 781–789. 5. Joo YH, Lee YS, Cho KJ, et al. Characteristics and prognostic implications of high-risk HPV-associated hypopharyngeal cancers. PLoS One 2013;8: e78718. 6. Lassen P, Eriksen JG, Hamilton–Dutoit S, et al. HPV-associated p16expression and response to hypoxic modification of radiotherapy in head and neck cancer. Radiother Oncol 2010;94:30–35. 7. Kimple RJ, Smith MA, Blitzer GC, et al. Enhanced radiation sensitivity in HPV-positive head and neck cancer. Cancer Res 2013;73:4791–4800. 8. Sorensen BS, Busk M, Olthof N, et al. Radiosensitivity and effect of hypoxia in HPV positive head and neck cancer cells. Radiother Oncol 2013;108:500–505.
HPV-RADIOSENSITIVE HNSCC
CELL LINE
9. Chung CH, Gillison ML. Human papillomavirus in head and neck cancer: its role in pathogenesis and clinical implications. Clin Cancer Res 2009;15: 6758–6762. 10. Tang AL, Hauff SJ, Owen JH, et al. UM-SCC-104: a new human papillomavirus-16-positive cancer stem cell-containing head and neck squamous cell carcinoma cell line. Head Neck 2012;34:1480–1491. 11. Nagel R, Martens–de Kemp SR, Buijze M, Jacobs G, Braakhuis BJ, Brakenhoff RH. Treatment response of HPV-positive and HPV-negative head and neck squamous cell carcinoma cell lines. Oral Oncol 2013;49: 560–566. 12. Skvortsov S, Jimenez CR, Knol JC, et al. Radioresistant head and neck squamous cell carcinoma cells: intracellular signaling, putative biomarkers for tumor recurrences and possible therapeutic targets. Radiother Oncol 2011;101:177–182. 13. Lee SY, Park HR, Cho NH, et al. Identifying genes related to radiation resistance in oral squamous cell carcinoma cell lines. Int J Oral Maxillofac Surg 2013;42:169–176. 14. Lin CJ, Grandis JR, Carey TE, et al. Head and neck squamous cell carcinoma cell lines: established models and rationale for selection. Head Neck 2007;29:163–188. 15. Lee DH, Lee JK. Establishment of a cell line (CNUH-HNSCC-1) derived from an advanced laryngeal squamous cell carcinoma. Chonnam Med J 2011;47:85–89. 16. Gold KA, Kim ES. Role of molecular markers and gene profiling in head and neck cancers. Curr Opin Oncol 2009;21:206–211. 17. Liebertz DJ, Lechner MG, Masood R, et al. Establishment and characterization of a novel head and neck squamous cell carcinoma cell line USCHN1. Head Neck Oncol 2010;2:5. 18. Lan, YJ, Chen H, Chen JQ, Lei QH, Zheng M, Shao ZR. Immunolocalization of vimentin, keratin 17, Ki-67, involucrin, b-catenin and E-cadherin in cutaneous squamous cell carcinoma. Pathol Oncol Res 2013. [Epub ahead of print]. 19. Cole L, Polfus L, Peters ES. Examining the incidence of human papillomavirus-associated head and neck cancers by race and ethnicity in the U.S., 1995–2005. PLoS One 2012;7:e32657. 20. Braakhuis BJ, Snijders PJ, Keune WJ, et al. Genetic patterns in head and neck cancers that contain or lack transcriptionally active human papillomavirus. J Natl Cancer Inst 2004;96:998–1006. 21. Nagai MA. Genetic alterations in head and neck squamous cell carcinomas. Braz J Med Biol Res 1999;32:897–904. 22. Smilek P, Dusek L, Vesel y K, Rottenberg J, Kostrica R. Correlation of expression of Ki-67, EGFR, c-erbB-2, MMP-9, p53, bcl-2, CD34 and cell cycle analysis with survival in head and neck squamous cell cancer. J Exp Clin Cancer Res 2006;25:549–555. 23. Brakenhoff RH. Cancer. Another NOTCH for cancer. Science 2011;333: 1102–1103. 24. Margaritescu C, Pirici D, Simionescu C, Stepan A. The utility of CD44, CD117 and CD133 in identification of cancer stem cells (CSC) in oral squamous cell carcinomas (OSCC). Rom J Morphol Embryol 2011;52(3 Suppl):985–993. 25. Kokko LL, Hurme S, Maula SM, et al. Significance of site-specific prognosis of cancer stem cell marker CD44 in head and neck squamous-cell carcinoma. Oral Oncol 2011;47:510–516. 26. Kawano T, Nakamura Y, Yanoma S, et al. Expression of E-cadherin, and CD44s and CD44v6 and its association with prognosis in head and neck cancer. Auris Nasus Larynx 2004;31:35–41. 27. Masood R, Hochstim C, Cervenka B, et al. A novel orthotopic mouse model of head and neck cancer and lymph node metastasis. Oncogenesis 2013;2:e68. 28. Wu CY, Chan PC, Chou LS, et al. Pulsed-focused ultrasound enhances boron drug accumulation in a human head and neck cancer xenograftbearing mouse model. Mol Imaging Biol 2014;16:95–101. 29. Sano D, Myers JN. Xenograft models of head and neck cancers. Head Neck Oncol 2009;1:32.
HEAD & NECK—DOI 10.1002/HED
APRIL 2016
E551
