Generation and Characterization of Polyclonal Antibodies Against Mouse T-cell Immunoglobulin and Immunoreceptor Tyrosine-based Inhibitory Domain by DNA-based Immunization Y. Gao, J. Cui, W. He, J. Yue, D. Yu, L. Cai, H. Xu, C. Yang, Z.K. Chen, and H. Zhou ABSTRACT Mouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (TIGIT) is a newly identified surface protein expressed in regulatory, memory, natural killer (NK), and activated T cells. Several studies indicate that mouse TIGIT is a vital immunomodulator that can control the activities of both NK and T cells and plays an important role in transplantation tolerance. In this study, we designed a vector, TIGITpcDNA3.1 (þ), that encodes the complete coding sequence of mouse TIGIT. The vector was intramuscularly injected into rats, and then the specific antisera were harvested and purified using a protein A/G PLUS-agarose affinity column. Western blot and immunohistochemistry analyses revealed that the antibodies generated by DNA immunization can bind with the mouse TIGIT. Using these antibodies in immunoblots, TIGIT was detected in lysates of mouse organs, T cells from mouse lymph nodes, and recombinant mouse fusion protein of TIGIT and Fc fragment. Immunohistochemistry analysis of normal mouse kidney showed that immunoreactivity was located on endothelial cells of glomerular capillary loops and peritubular capillaries. Our results demonstrated that the DNA immunization of rats through intramuscular injection was a simple and easily available method of producing polyclonal antibodies that can be used to detect and analyze mouse TIGIT expression in mouse systems.
T
-CELL IMMUNOGLOBULIN and immunoreceptor tyrosine-based inhibitory domain (TIGIT) is a member of the CD28 family. TIGIT contains an immunoglobulin variable (IgV) domain, a type 1 transmembrane region, and two immunoreceptor tyrosine-based inhibitory motifs (ITIMs) [1e4]. TIGIT is broadly expressed in T-cell subsets (including naive, activated, memory, and regulatory T cells) and natural killer (NK) cells [1e5]. Consistent with the presence of ITIMs, TIGIT reportedly has an inhibitory function in both NK and T cells [3]. TIGIT can inhibit the cytotoxicity of NK cells, as well as the proliferation and cytokine production of CD4 T cells [2,4e6]. However, no effective commercial antibody against TIGIT is currently available. In our previous study, we used a commercially produced polyclonal antibody (PAb) and found that it failed to recognize mouse TIGIT (mTIGIT) protein in its denatured form by Western blot analysis. We repeated the experiments many times, consuming a substantial amount of time and money. Thus, antibodies directed against native mTIGIT must be discovered to 0041-1345/14/$esee front matter http://dx.doi.org/10.1016/j.transproceed.2013.10.039 260
investigate the function and expression of TIGIT in mouse models. In this study, we generated rat anti-mouse PAbs against mTIGIT, identified their reactivity to the native mTIGIT From the Institute of Organ Transplantation (Y.G., W.H., D.Y., L.C., H.X., C.Y., Z.K.C.), Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology (HUST), Key Laboratory of Ministry of Health, Key Laboratory of Ministry of Education, Wuhan, China; Department of Cardio-Thoracic Surgery (J.C.), Zhongshan Hospital of Traditional Chinese Medicine, Guangdong, China; Department of Cardiothoracic Surgery (H.Z.), Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; and Department of General Surgery I (Y.G. and J.Y.), Taihe Hospital Affiliated to Hubei University of Medicine, Shiyan, Hubei, China. Address reprint requests to Hongmin Zhou and Zhonghua Klaus Chen, Department of Cardiacthoracic Surgery, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China. E-mail: amzhmin@126. com; [email protected] ª 2014 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710 Transplantation Proceedings, 46, 260e265 (2014)
POLYCLONAL ANTIBODIES AGAINST MOUSE TIGIT
Fig 1. Target genes were cloned by polymerase chain reaction (PCR). Lane M: DNA ladder; lane 1: positive control of PCR; lane 2: mouse T-cell immunoglobulin and immunoreceptor tyrosinebased inhibitory domain fragments about 800 bp (1% agarose electrophoresis).
molecule, and recommended the fusion protein of mTIGIT and Fc fragment (mTIGIT-Fc) [7]. MATERIALS AND METHODS Subcloning of the cDNA of mTIGIT by Reverse-Transcriptase Polymerase Chain Reaction Total RNA was isolated from C57 mouse spleen by TRIZOL reagent (Invitrogen), and the first cDNA was synthesized using a Rever Tra Ace-a-kit (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. The gene encoding the complete coding sequence (CDS) of mTIGIT (gene ID: 100043314) was cloned from the total cDNA by polymerase chain reaction (PCR) with the sense primer P1: 50 GCCAGTTTCAGTTGGAGGAGAG30 and anti-sense primer P2: 50 CTCGAGAGGGATAGAGAGCTGTCG TTAG30 (underlined bases encode the Xhol I site). The conditions
261
Fig 2. Recombinant mouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT)-pcDNA3.1 (þ) plasmids identified by polymerase chain reaction. Lane M: DNA ladder; lane 1: w800-bp mTIGIT fragments (1% agarose electrophoresis). were as follows: 95 C for 5 minutes; 30 cycles of 95 C for 30 seconds, 58 C for 45 seconds, and 72 C for 1 minute; 72 C for 10 minutes; and 4 C for 10 minutes (Fig. 1).
Vector Construction and Purification The mTIGIT sequence was inserted into the multiple clone sites of pGM-T using a pGM-T clone kit (Tiangen, Beijing, China). The corresponding ligated products were digested with EcorI and XhoI, and then cloned into the commercially available mammalian expression vector pcDNA3.1 (þ) [8e10]. The recombinant plasmids were transformed into Escherichia coli TOP10 cells (Tiangen, Beijing, China) to screen out the positive clone on LB agar with ampicillin resistance (100 mg/mL). The recombinant plasmids were identified by PCR and restrictive endonuclease (Figs 2 and 3). The complete sequence of the inserts was verified by DNA sequence analysis (data not shown). For large-scale preparation, plasmid DNAs were amplified in E coli TOP10 cells and purified using a Fastfilter Plasmid Maxi Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The obtained plasmid DNA was subsequently dissolved in sterilized water. The concentration and
262
GAO, CUI, HE ET AL
Enzyme-linked Immunosorbent Assay mTIGIT-Fc protein was obtained from Novoprotein Corp, Shanghai, China. About 5 mg/mL purified recombinant mTIGIT-Fc protein in 0.05 mol/L Na2CO3 buffer (pH 9.6) were coated at 4 C overnight onto 96-well flat-bottomed plates (Millipore, Mass, United States) at 100 mL/well. After washing 3 times with phosphate-buffered saline (PBS) with Tween20 (PBST), the plates were blocked with confining solution consisting of 1% bovine serum albumin (BSA) and 2% nonfat dried milk. After washing 3 times, the diluted rat serum samples were added and the plates were incubated for 1 hour at 37 C. The second antibody was horseradish peroxidase (HRP)-conjugated goat anti-rat immunoglobulin G (IgG) (1:3000 in PBST; ProteinTech). After incubation at 37 C for 1 hour and washing 3 times, 100 mL of tetramethylbenzidine substrate (R&D, Minneapolis, Minn, United States) was added to each well, and the absorbance at 450 nm was measured using a microplate reader (GENios, TECAN, Switzerland).
Purification of Antibody by Affinity Chromatography
Fig 3. Recombinant mouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT)-pcDNA3.1 (þ) plasmids identified by restrictive endonuclease. Lane M: DNA ladder; lane 1: 5.3- and 0.8-kb fragments of mTIGITpcDNA3.1(þ) plasmids digested by combined EcoRI and XhoI. purity of each DNA preparation was determined by Gene Spec (Hitachi, Tokyo, Japan). DNAs were stored at 20 C before injection into rats [11].
Rats and Immunization Female SpragueeDawley rats (10 weeks old) were obtained from the Department of Experimental Animals, Tongji Medical College, Huazhong University of Science and Technology. The hind legs of rats were intramuscularly injected with mTIGIT-pcDNA3.1 (þ) vectors (100 mg DNA/dose) on day 0 [8,10e12]. Rats immunized with the empty vector pcDNA3.1 (þ) served as negative controls. After 24 hours, we injected 100 mL of complete Freund’s adjuvant (Santa Cruz Biotechnology, Santa Cruz, Calif, United States) into the same site. The rats were subsequently immunized twice at 2week intervals in the same manner. Ten days after the last immunization, blood from the rat abdominal aorta was extracted [7], and sera were separated and stored at 20 C. Needle injections and serum collection were performed in accordance with the guidelines of the Tongji Animal Use Regulation and with approval from the Institutional Animal Care and Use Committee of Tongji Medical College.
A Protein A/G PLUS-Agarose Affinity Column (Millipore) was set up according to the manufacturer’s instructions [13]. All subsequent purification steps were carried out at 4 C. We adjusted the antiserum pH to 8.0 by adding Tris-HCl (pH 9.0). The antiserum was then added to the column at a flow rate of 0.5 mL/min. In case the antibody failed to bind with the column, the antiserum was passed through the column twice, and the flow was saved. The column was washed with 100 mmol/L citric acid (pH 3.0) at a rate of 1 mL/min until all protein had been eluted from the column. The eluted antibody was then collected into 50 mL centrifuge tubes containing 20 mL of 1 mmol/L citric acid (pH 9.0). The tubes were immediately mixed and placed on ice to prevent the denaturation of IgG. Finally, the pH of the combined fractions was adjusted to approximately 8.0 and the eluted antibody was concentrated twice by MWCO30000 (Millipore). Finally, almost 6 mL of anti-mTIGIT PAb solution was obtained.
Western Blot Analysis Western blot analyses were performed to determine whether the serum samples recognized protein bands of the predicted size. RIPA Lysis Buffer (Beyotime, Jiangsu, China) extracts from mouse heart, liver, spleen, kidney, native T cells, and T cells upon activation 3 days from lymph nodes stimulated with plate-bound anti-CD3 (2 mg/mL) and anti-CD28 (2 mg/mL) [6]. The protein concentration was detected using a bicinchoninic acid kit (Beyotime). After boiling for 5 minutes and cooling at 4 C for 5 minutes, 35 mg of tissue proteins and 2 mg of purified mTIGIT-Fc proteins (as described previously under Enzyme-linked immunoassay) were electrophoresed with 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The protein was transferred onto an Immobilon-P polyvinylidene fluoride membrane (Millipore), which was then blocked for 3 hours at room temperature with 5% BSA in Tris-buffered saline (TBS) with Tween 20 (TBST). The blots were incubated with the primary rat anti-mTIGIT antibodies (1:500 in TBST) at 4 C overnight with gentle agitation. After washing 4 times, the membranes were reacted with HRP-labeled anti-rat IgG second antibody (1:5000 in TBST; ProteinTech) at room temperature for 1.5 hours. Finally, enhanced chemiluminescence reagent (Beyotime, China) was applied to the membranes, which were then exposed to an X-ray film (Kodak, Rochester, NY, United States) [7].
POLYCLONAL ANTIBODIES AGAINST MOUSE TIGIT
263
Fig 4. Antiemouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT) antibody titer of antiserum: eCe denotes the specific antibody titer of sera from rat immunized with mTIGIT-pcDNA3.1 (þ) plasmids, and e-e denotes the specific antibody titer of sera from rat immunized with pcDNA3.1 (þ).
Immunohistochemistry The kidney of C57 mice were removed and fixed in 10% formalin over 24 hours, dehydrated in gradient ethanol, and embedded in paraffin. Then, 5-mm-thick sections were cut and mounted onto 3-aminopropyltriethoxysilane-coated slides. Before proceeding with the staining protocol, the slides were deparaffinized and rehydrated as usual. Sodium citrate buffer (10 mmol/L, pH 6.0) was used for heat-mediated antigen retrieval. Nonspecific binding was blocked in 10% normal serum with 1% BSA in TBS for 2 hours at room temperature, and endogenous peroxides activity was suppressed with methanol containing 3% H2O2 for 15 minutes. The slices were dipped into rat anti-mTIGIT antibody (diluted 1:100 in PBS) for over 2 hours at room temperature. Antibody from rats that received only pcDNA3.1 (þ) vector served as a negative control. After rinsing 3 times in PBS, the slices were incubated with HRPconjugated goat anti-rat IgG (diluted 1:1000 in PBS, ProteinTech) for 1 hour at room temperature. The antibody complexes were then visualized by incubation with diaminobenzidine chromogen (Beyotime). Sections were counterstained with Mayer’s hematoxylin for 10 seconds, dehydrated through gradient ethanol, cleared in dimethyl benzene, mounted, and examined under light microscopy [7].
RESULTS Construction of TIGIT-pcDNA3.1 (þ) Vector
The CDS of mTIGIT gene was cloned from the total cDNA by PCR from mouse spleen (Fig 1). The methods and information are detailed in the Materials and methods section. The recombinant plasmids were identified by PCR and restrictive endonuclease. The mTIGIT-pcDNA3.1 (þ) vectors were amplified by PCR, digested by combined EcoRI and XhoI, and subjected to 1% agarose electrophoresis. The expected 800-bp fragment (ie, TIGIT gene) can be observed in Fig 2. Similarly, mTIGIT-pcDNA3.1 (þ) was identified by restrictive endonuclease. All expected fragments were observed, including the 5.3- and 0.8-kb fragments digested by combined EcoRI and XhoI (Fig 3) [14].
Fig 5. Western immunoblots that were reacted with antiserum generated against native and recombinant mouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT) protein. MW, molecular weight (in kilodalton). (A) K, mouse kidney; S, spleen; L, liver; H, heart. (C) T0, protein extracted from native T cells; Ta3, protein extracted from T cells activated for 3 days. TF, w45 kDa purified mTIGIT-Fc protein. (B,D) Control anti-pcDNA3.1 (þ) vector rat immunoglobulin G.
Antiserum Specifically Recognizes mTIGIT as Shown by Enzyme-linked Immunosorbent Assay
To demonstrate the degrees of specificity and reactivity, the sera of experimental and negative control rats were used in an enzyme-linked immunosorbent assay against recombinant mTIGIT-Fc protein. The sera were serially diluted from 1:1000 to 1:20,000 and assayed in duplicate on the same enzyme-linked immunosorbent assay plate. The sera obtained from rat immunized with mTIGIT-pcDNA3.1 (þ) demonstrated a valid titer of 1:20,000. Meanwhile, the sera obtained from rat immunized with pcDNA3.1 (þ) consistently showed a low optical density of 0.089, which approximated a blank well (Fig 4). These enzyme-linked immunosorbent assay results demonstrated that the serum of the rat immunized with mTIGIT-pcDNA3.1 (þ) plasmid was highly specific for mTIGIT protein. Anti-mTIGIT Antibodies Recognize Appropriately Sized Proteins (26 kDa) by Western Blot Analysis
To verify the specificity of the antibodies, we assayed the protein extracts from mouse heart, liver, spleen, kidney, native T cells, T cells activated upon activation 3 days from lymph nodes, and recombinant mTIGIT-FC protein. These products were approximately the same size as the predicted band size of mTIGIT (w26 kDa). The 34-kDa protein band probably represented different glycosylated forms of mTIGIT [5]. We found that these bands were distributed in the organs of normal mice, with high expression in kidney,
264
heart, and liver and low expression in spleen (Fig 5A). The finding that the expression of TIGIT from T cells activated for 3 days was higher than that of TIGIT from native T cells agreed with previous studies [2,8] (Fig. 5C). No specific signal was detected in the rat IgG from control rats that received only empty pcDNA3.1 (þ) vector (Fig 5B and D). Recognition Ability of the PAbs for mTIGIT in Kidney Tissue by Immunohistochemistry
The purified PAbs can recognize in mouse kidney tissue. Anti-pcDNA3.1 (þ) rat IgG was used as a negative control. Antibodies from rat immunized with mTIGIT-pcDNA3.1 (þ) showed strongly positive staining (Fig 6A and B), whereas anti-pcDNA3.1 (þ) rat IgG showed negative staining (Fig 6C and D). Immunohistochemical staining of mTIGIT was mainly located on endothelial cells of glomerular capillary loops and peritubular capillaries (Fig 6B). DISCUSSION
Specific antibodies are essential tools for demonstrating the function and expression of cellular proteins. Nowadays, the reactivity of most antibodies is obtained by conventional immunization strategies that usually depend on the immunizing peptide, purified native protein, or recombinant protein antigen. However, these methods are difficult to implement because obtaining large quantities of correctly folded proteins as immunogens and purified recombinant protein technology have high costs and are time-consuming, and their immunogenicity is unpredictable [8,10,15,16]. On the other hand, DNA immunization offers significant advantages over conventional immunization strategies using peptides or recombinant protein because the synthesis and purification of plasmid DNA expression vectors are easy and not laborious [8,17]. Theoretically, DNA immunization
Fig 6. Immunohistochemical staining of mouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT) in normal mouse kidney tissue. Immunohistochemical localization of mTIGIT was observed throughout the endothelial cells of glomerular capillary loops and peritubular capillaries (/). (A, C) 200 magnification; negative controls do not show specific staining in the same site of mouse kidney. (B, D) 400 magnification. (E) 1000 magnification.
GAO, CUI, HE ET AL
is a significant source of specific antibodies against different antigens [18]. Previous studies have demonstrated the feasibility of using direct injection of plasmid DNA to produce a specific antibody [11,18e20]. TIGIT is a newly discovered surface protein containing an immunoglobulin variable domain, a transmembrane domain, and an IMIT motif expressed in regulatory, memory, and activated T cells [1]. Several studies have indicated that (1) TIGIT is highly constitutively expressed in regulatory T cells, lowly expressed in memory T cells, and absent in naive CD4þCD25 T cells, while it is upregulated after the activation of all these cells; (2) TIGIT-Fc protein induces interleukin-10 production by dendritic cells and decreases the secretion of proinflammatory cytokine interleukin-12; and (3) TIGIT-Fc inhibits delayed-type hypersensitivity reactions, a function similar to that of CTLA-4 protein [1]. An increasing amount of evidence indicates that TIGIT, as a vital immunomodulator protein, can control the activities of both NK and T cells. In this study, we found that the DNA immunization of rat with a plasmid that encodes mTIGIT generated a strong and specific anti-mTIGIT PAbs. The PAbs elicited by this approach showed specificity for mTIGIT, as demonstrated by Western blot analysis of native and recombinant mTIGIT. Then, we identified the expression of mTIGIT in different vital organs. The expression of mTIGIT was higher in kidney, heart, and liver but lower in spleen of normal mice. TIGIT was also mainly localized on endothelial cells of glomerular capillary and peritubular capillaries of normal mouse kidney. Interestingly, in our previous experiments, we have found that the antibody elicited by plasmid immunization has a blocking function (unpublished observation). This finding may be because our strategy involves the physical delivery of an antigen-encoding expression vector in vivo for the induction of antigen expression and the elicitation of specific immune responses [12]. Thus, we can
POLYCLONAL ANTIBODIES AGAINST MOUSE TIGIT
easily obtain the agonistic antibody. However, further research may be needed. In conclusion, our findings indicated that DNA immunization was a powerful technique of generating antibodies for surface proteins and that this method has great potential use in the future. ACKNOWLEDGMENTS The authors would like to thank Dr Liao of the Laboratory of Molecular and Biology, Tongji Medical College for providing the plasmid pcDNA3.1 (þ) vector. This work was financially supported by the National Natural Science Foundation of China (No. 30972794, 81102260) and the “973” Program of China (No. 2009CB522407).
REFERENCES [1] Yu X, Harden K, Gonzalez LC, Francesco M, Chiang E, Irving B, et al. The surface protein TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. Nat Immunol 2009;10(1):48e57. [2] Levin SD, Taft DW, Brandt CS, Bucher C, Howard ED, Chadwick EM, et al. Vstm3 is a member of the CD28 family and an important modulator of T-cell function. Eur J Immunol 2011;41(4): 902e15. [3] Stanietsky N, Mandelboim O. Paired NK cell receptors controlling NK cytotoxicity. FEBS Lett 2010;584(24):4895e900. [4] Chan CJ, Andrews DM, Smyth MJ. Receptors that interact with nectin and nectin-like proteins in the immunosurveillance and immunotherapy of cancer. Curr Opin Immunol 2012;24(2): 246e51. [5] Stanietsky N, Simic H, Arapovic J, Toporik A, Levy O, Novik A, et al. The interaction of TIGIT with PVR and PVRL2 inhibits human NK cell cytotoxicity. Proc Natl Acad Sci U S A 2009;106(42):17858e63. [6] Joller N, Hafler JP, Brynedal B, Kassam N, Spoerl S, Levin SD, et al. Cutting edge: TIGIT has T cell-intrinsic inhibitory functions. J Immunol 2011;186(3):1338e42. [7] Wang CY, Zhang Y, Wang DL, Song CJ, Han WN, Yang K, et al. Generation of rat monoclonal antibodies against murine LAIR-1. Hybridoma (Larchmt) 2007;26(5):316e21.
265 [8] Mumford AD, Dorling A, Kemball-Cook G, McVey JH. Generation of a polyclonal rabbit anti-mouse tissue factor antibody by nucleic acid immunisation. Thromb Haemost 2005;93(1):160e4. [9] Krasemann S, Groschup M, Hunsmann G, Bodemer W. Induction of antibodies against human prion proteins (PrP) by DNAmediated immunization of PrP0/0 mice. J Immunol Methods 1996;199(2):109e18. [10] Alexandrenne C, Wijkhuisen A, Dkhissi F, Hanoux V, Creminon C, Boquet D, et al. Generating antibodies against the native form of the human prion protein (hPrP) in wild-type animals: a comparison between DNA and protein immunizations. J Immunol Methods 2009;341(1-2):41e9. [11] Kasinrerk W, Moonsom S, Chawansuntati K. Production of antibodies by single DNA immunization: comparison of various immunization routes. Hybrid Hybridomics 2002;21(4):287e93. [12] Kasinrerk W, Tokrasinwit N, Piluk Y. Production of mouse anti-CD4 antibodies by DNA-based immunization. Asian Pac J Allergy Immunol 1996;14(2):99e105. [13] Grodzki AC, Berenstein E. Antibody purification: affinity chromatographydprotein A and protein G Sepharose. Methods Mol Biol 2010;588:33e41. [14] Jin JF, Yuan LD, Liu L, Zhao ZJ, Xie W. Preparation and characterization of polyclonal antibodies against ARL-1 protein. World J Gastroenterol 2003;9(7):1455e9. [15] Chow MK, Amin AA, Fulton KF, Fernando T, Kamau L, Batty C, et al. The REFOLD database: a tool for the optimization of protein expression and refolding. Nucleic Acids Res 2006;34(Database issue):D207e12. [16] Jungbauer A, Kaar W. Current status of technical protein refolding. J Biotechnol 2007;128(3):587e96. [17] Gardsvoll H, Solberg H, Dano K, Hoyer-Hansen G. Generation of high-affinity rabbit polyclonal antibodies to the murine urokinase receptor using DNA immunization. J Immunol Methods 2000;234(1-2):107e16. [18] Moonsom S, Khunkeawla P, Kasinrerk W. Production of polyclonal and monoclonal antibodies against CD54 molecules by intrasplenic immunization of plasmid DNA encoding CD54 protein. Immunol Lett 2001;76(1):25e30. [19] Tang DC, DeVit M, Johnston SA. Genetic immunization is a simple method for eliciting an immune response. Nature 1992;356(6365):152e4. [20] Barry MA, Barry ME, Johnston SA. Production of monoclonal antibodies by genetic immunization. Biotechniques 1994;16: 616e8. 620.
T
-CELL IMMUNOGLOBULIN and immunoreceptor tyrosine-based inhibitory domain (TIGIT) is a member of the CD28 family. TIGIT contains an immunoglobulin variable (IgV) domain, a type 1 transmembrane region, and two immunoreceptor tyrosine-based inhibitory motifs (ITIMs) [1e4]. TIGIT is broadly expressed in T-cell subsets (including naive, activated, memory, and regulatory T cells) and natural killer (NK) cells [1e5]. Consistent with the presence of ITIMs, TIGIT reportedly has an inhibitory function in both NK and T cells [3]. TIGIT can inhibit the cytotoxicity of NK cells, as well as the proliferation and cytokine production of CD4 T cells [2,4e6]. However, no effective commercial antibody against TIGIT is currently available. In our previous study, we used a commercially produced polyclonal antibody (PAb) and found that it failed to recognize mouse TIGIT (mTIGIT) protein in its denatured form by Western blot analysis. We repeated the experiments many times, consuming a substantial amount of time and money. Thus, antibodies directed against native mTIGIT must be discovered to 0041-1345/14/$esee front matter http://dx.doi.org/10.1016/j.transproceed.2013.10.039 260
investigate the function and expression of TIGIT in mouse models. In this study, we generated rat anti-mouse PAbs against mTIGIT, identified their reactivity to the native mTIGIT From the Institute of Organ Transplantation (Y.G., W.H., D.Y., L.C., H.X., C.Y., Z.K.C.), Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology (HUST), Key Laboratory of Ministry of Health, Key Laboratory of Ministry of Education, Wuhan, China; Department of Cardio-Thoracic Surgery (J.C.), Zhongshan Hospital of Traditional Chinese Medicine, Guangdong, China; Department of Cardiothoracic Surgery (H.Z.), Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; and Department of General Surgery I (Y.G. and J.Y.), Taihe Hospital Affiliated to Hubei University of Medicine, Shiyan, Hubei, China. Address reprint requests to Hongmin Zhou and Zhonghua Klaus Chen, Department of Cardiacthoracic Surgery, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China. E-mail: amzhmin@126. com; [email protected] ª 2014 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710 Transplantation Proceedings, 46, 260e265 (2014)
POLYCLONAL ANTIBODIES AGAINST MOUSE TIGIT
Fig 1. Target genes were cloned by polymerase chain reaction (PCR). Lane M: DNA ladder; lane 1: positive control of PCR; lane 2: mouse T-cell immunoglobulin and immunoreceptor tyrosinebased inhibitory domain fragments about 800 bp (1% agarose electrophoresis).
molecule, and recommended the fusion protein of mTIGIT and Fc fragment (mTIGIT-Fc) [7]. MATERIALS AND METHODS Subcloning of the cDNA of mTIGIT by Reverse-Transcriptase Polymerase Chain Reaction Total RNA was isolated from C57 mouse spleen by TRIZOL reagent (Invitrogen), and the first cDNA was synthesized using a Rever Tra Ace-a-kit (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. The gene encoding the complete coding sequence (CDS) of mTIGIT (gene ID: 100043314) was cloned from the total cDNA by polymerase chain reaction (PCR) with the sense primer P1: 50 GCCAGTTTCAGTTGGAGGAGAG30 and anti-sense primer P2: 50 CTCGAGAGGGATAGAGAGCTGTCG TTAG30 (underlined bases encode the Xhol I site). The conditions
261
Fig 2. Recombinant mouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT)-pcDNA3.1 (þ) plasmids identified by polymerase chain reaction. Lane M: DNA ladder; lane 1: w800-bp mTIGIT fragments (1% agarose electrophoresis). were as follows: 95 C for 5 minutes; 30 cycles of 95 C for 30 seconds, 58 C for 45 seconds, and 72 C for 1 minute; 72 C for 10 minutes; and 4 C for 10 minutes (Fig. 1).
Vector Construction and Purification The mTIGIT sequence was inserted into the multiple clone sites of pGM-T using a pGM-T clone kit (Tiangen, Beijing, China). The corresponding ligated products were digested with EcorI and XhoI, and then cloned into the commercially available mammalian expression vector pcDNA3.1 (þ) [8e10]. The recombinant plasmids were transformed into Escherichia coli TOP10 cells (Tiangen, Beijing, China) to screen out the positive clone on LB agar with ampicillin resistance (100 mg/mL). The recombinant plasmids were identified by PCR and restrictive endonuclease (Figs 2 and 3). The complete sequence of the inserts was verified by DNA sequence analysis (data not shown). For large-scale preparation, plasmid DNAs were amplified in E coli TOP10 cells and purified using a Fastfilter Plasmid Maxi Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The obtained plasmid DNA was subsequently dissolved in sterilized water. The concentration and
262
GAO, CUI, HE ET AL
Enzyme-linked Immunosorbent Assay mTIGIT-Fc protein was obtained from Novoprotein Corp, Shanghai, China. About 5 mg/mL purified recombinant mTIGIT-Fc protein in 0.05 mol/L Na2CO3 buffer (pH 9.6) were coated at 4 C overnight onto 96-well flat-bottomed plates (Millipore, Mass, United States) at 100 mL/well. After washing 3 times with phosphate-buffered saline (PBS) with Tween20 (PBST), the plates were blocked with confining solution consisting of 1% bovine serum albumin (BSA) and 2% nonfat dried milk. After washing 3 times, the diluted rat serum samples were added and the plates were incubated for 1 hour at 37 C. The second antibody was horseradish peroxidase (HRP)-conjugated goat anti-rat immunoglobulin G (IgG) (1:3000 in PBST; ProteinTech). After incubation at 37 C for 1 hour and washing 3 times, 100 mL of tetramethylbenzidine substrate (R&D, Minneapolis, Minn, United States) was added to each well, and the absorbance at 450 nm was measured using a microplate reader (GENios, TECAN, Switzerland).
Purification of Antibody by Affinity Chromatography
Fig 3. Recombinant mouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT)-pcDNA3.1 (þ) plasmids identified by restrictive endonuclease. Lane M: DNA ladder; lane 1: 5.3- and 0.8-kb fragments of mTIGITpcDNA3.1(þ) plasmids digested by combined EcoRI and XhoI. purity of each DNA preparation was determined by Gene Spec (Hitachi, Tokyo, Japan). DNAs were stored at 20 C before injection into rats [11].
Rats and Immunization Female SpragueeDawley rats (10 weeks old) were obtained from the Department of Experimental Animals, Tongji Medical College, Huazhong University of Science and Technology. The hind legs of rats were intramuscularly injected with mTIGIT-pcDNA3.1 (þ) vectors (100 mg DNA/dose) on day 0 [8,10e12]. Rats immunized with the empty vector pcDNA3.1 (þ) served as negative controls. After 24 hours, we injected 100 mL of complete Freund’s adjuvant (Santa Cruz Biotechnology, Santa Cruz, Calif, United States) into the same site. The rats were subsequently immunized twice at 2week intervals in the same manner. Ten days after the last immunization, blood from the rat abdominal aorta was extracted [7], and sera were separated and stored at 20 C. Needle injections and serum collection were performed in accordance with the guidelines of the Tongji Animal Use Regulation and with approval from the Institutional Animal Care and Use Committee of Tongji Medical College.
A Protein A/G PLUS-Agarose Affinity Column (Millipore) was set up according to the manufacturer’s instructions [13]. All subsequent purification steps were carried out at 4 C. We adjusted the antiserum pH to 8.0 by adding Tris-HCl (pH 9.0). The antiserum was then added to the column at a flow rate of 0.5 mL/min. In case the antibody failed to bind with the column, the antiserum was passed through the column twice, and the flow was saved. The column was washed with 100 mmol/L citric acid (pH 3.0) at a rate of 1 mL/min until all protein had been eluted from the column. The eluted antibody was then collected into 50 mL centrifuge tubes containing 20 mL of 1 mmol/L citric acid (pH 9.0). The tubes were immediately mixed and placed on ice to prevent the denaturation of IgG. Finally, the pH of the combined fractions was adjusted to approximately 8.0 and the eluted antibody was concentrated twice by MWCO30000 (Millipore). Finally, almost 6 mL of anti-mTIGIT PAb solution was obtained.
Western Blot Analysis Western blot analyses were performed to determine whether the serum samples recognized protein bands of the predicted size. RIPA Lysis Buffer (Beyotime, Jiangsu, China) extracts from mouse heart, liver, spleen, kidney, native T cells, and T cells upon activation 3 days from lymph nodes stimulated with plate-bound anti-CD3 (2 mg/mL) and anti-CD28 (2 mg/mL) [6]. The protein concentration was detected using a bicinchoninic acid kit (Beyotime). After boiling for 5 minutes and cooling at 4 C for 5 minutes, 35 mg of tissue proteins and 2 mg of purified mTIGIT-Fc proteins (as described previously under Enzyme-linked immunoassay) were electrophoresed with 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The protein was transferred onto an Immobilon-P polyvinylidene fluoride membrane (Millipore), which was then blocked for 3 hours at room temperature with 5% BSA in Tris-buffered saline (TBS) with Tween 20 (TBST). The blots were incubated with the primary rat anti-mTIGIT antibodies (1:500 in TBST) at 4 C overnight with gentle agitation. After washing 4 times, the membranes were reacted with HRP-labeled anti-rat IgG second antibody (1:5000 in TBST; ProteinTech) at room temperature for 1.5 hours. Finally, enhanced chemiluminescence reagent (Beyotime, China) was applied to the membranes, which were then exposed to an X-ray film (Kodak, Rochester, NY, United States) [7].
POLYCLONAL ANTIBODIES AGAINST MOUSE TIGIT
263
Fig 4. Antiemouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT) antibody titer of antiserum: eCe denotes the specific antibody titer of sera from rat immunized with mTIGIT-pcDNA3.1 (þ) plasmids, and e-e denotes the specific antibody titer of sera from rat immunized with pcDNA3.1 (þ).
Immunohistochemistry The kidney of C57 mice were removed and fixed in 10% formalin over 24 hours, dehydrated in gradient ethanol, and embedded in paraffin. Then, 5-mm-thick sections were cut and mounted onto 3-aminopropyltriethoxysilane-coated slides. Before proceeding with the staining protocol, the slides were deparaffinized and rehydrated as usual. Sodium citrate buffer (10 mmol/L, pH 6.0) was used for heat-mediated antigen retrieval. Nonspecific binding was blocked in 10% normal serum with 1% BSA in TBS for 2 hours at room temperature, and endogenous peroxides activity was suppressed with methanol containing 3% H2O2 for 15 minutes. The slices were dipped into rat anti-mTIGIT antibody (diluted 1:100 in PBS) for over 2 hours at room temperature. Antibody from rats that received only pcDNA3.1 (þ) vector served as a negative control. After rinsing 3 times in PBS, the slices were incubated with HRPconjugated goat anti-rat IgG (diluted 1:1000 in PBS, ProteinTech) for 1 hour at room temperature. The antibody complexes were then visualized by incubation with diaminobenzidine chromogen (Beyotime). Sections were counterstained with Mayer’s hematoxylin for 10 seconds, dehydrated through gradient ethanol, cleared in dimethyl benzene, mounted, and examined under light microscopy [7].
RESULTS Construction of TIGIT-pcDNA3.1 (þ) Vector
The CDS of mTIGIT gene was cloned from the total cDNA by PCR from mouse spleen (Fig 1). The methods and information are detailed in the Materials and methods section. The recombinant plasmids were identified by PCR and restrictive endonuclease. The mTIGIT-pcDNA3.1 (þ) vectors were amplified by PCR, digested by combined EcoRI and XhoI, and subjected to 1% agarose electrophoresis. The expected 800-bp fragment (ie, TIGIT gene) can be observed in Fig 2. Similarly, mTIGIT-pcDNA3.1 (þ) was identified by restrictive endonuclease. All expected fragments were observed, including the 5.3- and 0.8-kb fragments digested by combined EcoRI and XhoI (Fig 3) [14].
Fig 5. Western immunoblots that were reacted with antiserum generated against native and recombinant mouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT) protein. MW, molecular weight (in kilodalton). (A) K, mouse kidney; S, spleen; L, liver; H, heart. (C) T0, protein extracted from native T cells; Ta3, protein extracted from T cells activated for 3 days. TF, w45 kDa purified mTIGIT-Fc protein. (B,D) Control anti-pcDNA3.1 (þ) vector rat immunoglobulin G.
Antiserum Specifically Recognizes mTIGIT as Shown by Enzyme-linked Immunosorbent Assay
To demonstrate the degrees of specificity and reactivity, the sera of experimental and negative control rats were used in an enzyme-linked immunosorbent assay against recombinant mTIGIT-Fc protein. The sera were serially diluted from 1:1000 to 1:20,000 and assayed in duplicate on the same enzyme-linked immunosorbent assay plate. The sera obtained from rat immunized with mTIGIT-pcDNA3.1 (þ) demonstrated a valid titer of 1:20,000. Meanwhile, the sera obtained from rat immunized with pcDNA3.1 (þ) consistently showed a low optical density of 0.089, which approximated a blank well (Fig 4). These enzyme-linked immunosorbent assay results demonstrated that the serum of the rat immunized with mTIGIT-pcDNA3.1 (þ) plasmid was highly specific for mTIGIT protein. Anti-mTIGIT Antibodies Recognize Appropriately Sized Proteins (26 kDa) by Western Blot Analysis
To verify the specificity of the antibodies, we assayed the protein extracts from mouse heart, liver, spleen, kidney, native T cells, T cells activated upon activation 3 days from lymph nodes, and recombinant mTIGIT-FC protein. These products were approximately the same size as the predicted band size of mTIGIT (w26 kDa). The 34-kDa protein band probably represented different glycosylated forms of mTIGIT [5]. We found that these bands were distributed in the organs of normal mice, with high expression in kidney,
264
heart, and liver and low expression in spleen (Fig 5A). The finding that the expression of TIGIT from T cells activated for 3 days was higher than that of TIGIT from native T cells agreed with previous studies [2,8] (Fig. 5C). No specific signal was detected in the rat IgG from control rats that received only empty pcDNA3.1 (þ) vector (Fig 5B and D). Recognition Ability of the PAbs for mTIGIT in Kidney Tissue by Immunohistochemistry
The purified PAbs can recognize in mouse kidney tissue. Anti-pcDNA3.1 (þ) rat IgG was used as a negative control. Antibodies from rat immunized with mTIGIT-pcDNA3.1 (þ) showed strongly positive staining (Fig 6A and B), whereas anti-pcDNA3.1 (þ) rat IgG showed negative staining (Fig 6C and D). Immunohistochemical staining of mTIGIT was mainly located on endothelial cells of glomerular capillary loops and peritubular capillaries (Fig 6B). DISCUSSION
Specific antibodies are essential tools for demonstrating the function and expression of cellular proteins. Nowadays, the reactivity of most antibodies is obtained by conventional immunization strategies that usually depend on the immunizing peptide, purified native protein, or recombinant protein antigen. However, these methods are difficult to implement because obtaining large quantities of correctly folded proteins as immunogens and purified recombinant protein technology have high costs and are time-consuming, and their immunogenicity is unpredictable [8,10,15,16]. On the other hand, DNA immunization offers significant advantages over conventional immunization strategies using peptides or recombinant protein because the synthesis and purification of plasmid DNA expression vectors are easy and not laborious [8,17]. Theoretically, DNA immunization
Fig 6. Immunohistochemical staining of mouse T-cell immunoglobulin and immunoreceptor tyrosine-based inhibitory domain (mTIGIT) in normal mouse kidney tissue. Immunohistochemical localization of mTIGIT was observed throughout the endothelial cells of glomerular capillary loops and peritubular capillaries (/). (A, C) 200 magnification; negative controls do not show specific staining in the same site of mouse kidney. (B, D) 400 magnification. (E) 1000 magnification.
GAO, CUI, HE ET AL
is a significant source of specific antibodies against different antigens [18]. Previous studies have demonstrated the feasibility of using direct injection of plasmid DNA to produce a specific antibody [11,18e20]. TIGIT is a newly discovered surface protein containing an immunoglobulin variable domain, a transmembrane domain, and an IMIT motif expressed in regulatory, memory, and activated T cells [1]. Several studies have indicated that (1) TIGIT is highly constitutively expressed in regulatory T cells, lowly expressed in memory T cells, and absent in naive CD4þCD25 T cells, while it is upregulated after the activation of all these cells; (2) TIGIT-Fc protein induces interleukin-10 production by dendritic cells and decreases the secretion of proinflammatory cytokine interleukin-12; and (3) TIGIT-Fc inhibits delayed-type hypersensitivity reactions, a function similar to that of CTLA-4 protein [1]. An increasing amount of evidence indicates that TIGIT, as a vital immunomodulator protein, can control the activities of both NK and T cells. In this study, we found that the DNA immunization of rat with a plasmid that encodes mTIGIT generated a strong and specific anti-mTIGIT PAbs. The PAbs elicited by this approach showed specificity for mTIGIT, as demonstrated by Western blot analysis of native and recombinant mTIGIT. Then, we identified the expression of mTIGIT in different vital organs. The expression of mTIGIT was higher in kidney, heart, and liver but lower in spleen of normal mice. TIGIT was also mainly localized on endothelial cells of glomerular capillary and peritubular capillaries of normal mouse kidney. Interestingly, in our previous experiments, we have found that the antibody elicited by plasmid immunization has a blocking function (unpublished observation). This finding may be because our strategy involves the physical delivery of an antigen-encoding expression vector in vivo for the induction of antigen expression and the elicitation of specific immune responses [12]. Thus, we can
POLYCLONAL ANTIBODIES AGAINST MOUSE TIGIT
easily obtain the agonistic antibody. However, further research may be needed. In conclusion, our findings indicated that DNA immunization was a powerful technique of generating antibodies for surface proteins and that this method has great potential use in the future. ACKNOWLEDGMENTS The authors would like to thank Dr Liao of the Laboratory of Molecular and Biology, Tongji Medical College for providing the plasmid pcDNA3.1 (þ) vector. This work was financially supported by the National Natural Science Foundation of China (No. 30972794, 81102260) and the “973” Program of China (No. 2009CB522407).
REFERENCES [1] Yu X, Harden K, Gonzalez LC, Francesco M, Chiang E, Irving B, et al. The surface protein TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. Nat Immunol 2009;10(1):48e57. [2] Levin SD, Taft DW, Brandt CS, Bucher C, Howard ED, Chadwick EM, et al. Vstm3 is a member of the CD28 family and an important modulator of T-cell function. Eur J Immunol 2011;41(4): 902e15. [3] Stanietsky N, Mandelboim O. Paired NK cell receptors controlling NK cytotoxicity. FEBS Lett 2010;584(24):4895e900. [4] Chan CJ, Andrews DM, Smyth MJ. Receptors that interact with nectin and nectin-like proteins in the immunosurveillance and immunotherapy of cancer. Curr Opin Immunol 2012;24(2): 246e51. [5] Stanietsky N, Simic H, Arapovic J, Toporik A, Levy O, Novik A, et al. The interaction of TIGIT with PVR and PVRL2 inhibits human NK cell cytotoxicity. Proc Natl Acad Sci U S A 2009;106(42):17858e63. [6] Joller N, Hafler JP, Brynedal B, Kassam N, Spoerl S, Levin SD, et al. Cutting edge: TIGIT has T cell-intrinsic inhibitory functions. J Immunol 2011;186(3):1338e42. [7] Wang CY, Zhang Y, Wang DL, Song CJ, Han WN, Yang K, et al. Generation of rat monoclonal antibodies against murine LAIR-1. Hybridoma (Larchmt) 2007;26(5):316e21.
265 [8] Mumford AD, Dorling A, Kemball-Cook G, McVey JH. Generation of a polyclonal rabbit anti-mouse tissue factor antibody by nucleic acid immunisation. Thromb Haemost 2005;93(1):160e4. [9] Krasemann S, Groschup M, Hunsmann G, Bodemer W. Induction of antibodies against human prion proteins (PrP) by DNAmediated immunization of PrP0/0 mice. J Immunol Methods 1996;199(2):109e18. [10] Alexandrenne C, Wijkhuisen A, Dkhissi F, Hanoux V, Creminon C, Boquet D, et al. Generating antibodies against the native form of the human prion protein (hPrP) in wild-type animals: a comparison between DNA and protein immunizations. J Immunol Methods 2009;341(1-2):41e9. [11] Kasinrerk W, Moonsom S, Chawansuntati K. Production of antibodies by single DNA immunization: comparison of various immunization routes. Hybrid Hybridomics 2002;21(4):287e93. [12] Kasinrerk W, Tokrasinwit N, Piluk Y. Production of mouse anti-CD4 antibodies by DNA-based immunization. Asian Pac J Allergy Immunol 1996;14(2):99e105. [13] Grodzki AC, Berenstein E. Antibody purification: affinity chromatographydprotein A and protein G Sepharose. Methods Mol Biol 2010;588:33e41. [14] Jin JF, Yuan LD, Liu L, Zhao ZJ, Xie W. Preparation and characterization of polyclonal antibodies against ARL-1 protein. World J Gastroenterol 2003;9(7):1455e9. [15] Chow MK, Amin AA, Fulton KF, Fernando T, Kamau L, Batty C, et al. The REFOLD database: a tool for the optimization of protein expression and refolding. Nucleic Acids Res 2006;34(Database issue):D207e12. [16] Jungbauer A, Kaar W. Current status of technical protein refolding. J Biotechnol 2007;128(3):587e96. [17] Gardsvoll H, Solberg H, Dano K, Hoyer-Hansen G. Generation of high-affinity rabbit polyclonal antibodies to the murine urokinase receptor using DNA immunization. J Immunol Methods 2000;234(1-2):107e16. [18] Moonsom S, Khunkeawla P, Kasinrerk W. Production of polyclonal and monoclonal antibodies against CD54 molecules by intrasplenic immunization of plasmid DNA encoding CD54 protein. Immunol Lett 2001;76(1):25e30. [19] Tang DC, DeVit M, Johnston SA. Genetic immunization is a simple method for eliciting an immune response. Nature 1992;356(6365):152e4. [20] Barry MA, Barry ME, Johnston SA. Production of monoclonal antibodies by genetic immunization. Biotechniques 1994;16: 616e8. 620.
