Vol. 173, No. 16
JOURNAL OF BACTERIOLOGY, Aug. 1991, p. 5181-5187
0021-9193/91/165181-07$02.00/0 Copyright © 1991, American Society for Microbiology
Identification of the Promoter Region of the Ribosome-Releasing Factor Cistron (frr) ICHIRO SHIMIZUt AND AKIRA KAJI* Department of Microbiology, School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104 Received 7 February 1991/Accepted 10 June 1991
Previous studies of the structure and expression of the ribosome-releasing factor (RRF) cistron (frr) have suggested that an efficient promoter region is located in the RRF cistron. We report here on the nucleotide sequence and in vivo function of the RRF promoter. The transcriptional start site was determined by primer extension to be 58 bp upstream of the translational initiation codon offrr. The location of the RRF promoter region was confirmed by means of (i) deletion analysis of the 5' proximal sequences of frr fused to the chloramphenicol acetyltransferase reporter gene, (ii) analysis of RRF produced in vivo from the deletion derivatives offrr cloned into pUC19, and (iii) gel retardation analysis with Escherichia coli RNA polymerase. The -35 and -10 regions were TTacCc and TATAcT, respectively. The strength of the RRF promoter was similar to that of the lac promoter, as determined by in vivo expression of chloramphenicol acetyltransferase activity. However, the RRF promoter was not affected by the intracellular cyclic AMP level despite the presence of a cyclic AMP receptor protein binding site downstream of the RRF promoter.
Ribosome-releasing factor (RRF) is an Escherichia coli protein responsible for the release of ribosomes from mRNA during the termination of protein synthesis (25). It has been demonstrated that the translational initiation site of the RRF gene (frr) is located at 4 min on the E. coli gene map, 1.1 kb downstream of the translational termination site of tsf (28). The DNA sequence offrr has been determined, and it was deduced that RRF consists of 185 amino acids with a calculated molecular weight of 20,639 (27). In addition, when frr was cloned into the vector pUC19 (45), E. coli harboring the resulting plasmid, designated pRR1, expressed RRF efficiently (27). This observation suggested that a site in the cloned fragment of pRR1 can serve as an efficient promoter for the high expression of RRF in combination with the high-copy-number vector (5). However, no information has been reported concerning the promoter for RRF expression, even though Bendiak and Friesen (4) proposed a possible location of a putative promoter for RRF expression downstream of tsf at 4 min on the E. coli gene map. In this communication, we report on the precise location and in vivo function of the RRF promoter. To make this determination, we constructed plasmids containing nested deletions in the upstream region of the RRF cistron by digestion with restriction enzymes and nuclease Bal 31. The deleted promoter regions were fused to a reporter gene encoding chloramphenicol acetyltransferase (CAT) and examined in vivo for expression of CAT activity. The RRF promoter region has been defined by sequencing each of the deletion-containing fragments and by gel retardation analysis of an E. coli RNA polymerase-DNA complex. The transcriptional start site has been determined by primer extension to be 58 bp upstream of the translational initiation codon offrr. The sequences of the -35 and -10 regions of the RRF promoter thus determined were TTacCc and TATAcT, respectively.
MATERIALS AND METHODS Bacterial strains and plasmids. E. coli DH5a (Bethesda Research Laboratories) was used as a host for plasmids containing frr. Plasmid pRR1 was constructed as described previously (27). Briefly, the 2.2-kb EcoRI fragment isolated from the Clarke-Carbon plasmid pLC6-32 (15) was inserted into the EcoRI site downstream of the lac promoter (18) in pUC19. Southern hybridization of the EcoRI digest revealed no differences between the cloned gene and frr from wildtype E. coli genomic DNA (27). pKK232-8 (10) containing the promoterless gene for chloramphenicol resistance (Camr) was a generous gift from Jurgen Brosius. This plasmid vector has been used to identify and measure the relative activities of various promoters (14). Culture conditions and DNA manipulations. Culture conditions and methods for cloning, ligation, and transformation were as described elsewhere (27, 28), essentially according to the methods of Maniatis et al. (33). Plasmid DNA was prepared by equilibrium centrifugation in CsCl gradients (16) or by the alkaline extraction procedure (7). E. coli transformants were selected by plating on Trypticase soy agar (BBL Microbiology Systems) containing 50 jig of ampicillin per ml and 50 ,ul of 2% 5-bromo-4-chloro-3-indolyl-p-D-galactopyranoside for the pRR series plasmids or 50 ,ug of ampicillin per ml for the pKK series plasmids. Restriction enzymes and T4 DNA ligase were obtained from Bethesda Research Laboratories and used under reaction conditions recommended by the supplier. Vectors were routinely treated with calf intestinal alkaline phosphatase (Boehringer Mannheim) to increase the insertion frequency. When blunt ends were required, DNA fragments were treated with the Klenow fragment of E. coli DNA polymerase I (Bethesda Research Laboratories). In experiments in which cyclic AMP (cAMP)deficient mutant CA7902 (44) was used, bacteria were grown on a MacConkey agar plate, and a single red colony which was selected from the region around a disk containing 20 mM cAMP was inoculated into liquid media. Deletion derivatives. For construction of the pRR series plasmids, nuclease Bal 31 (Boehringer Mannheim) was used to make 5'-to-3' deletions in the cloned SmaI-EcoRI fragment of pRR1. To do this, plasmid pRRl was first linearized
Corresponding author. t Present address: Second Department of Internal Medicine, School of Medicine, University of Tokushima, Tokushima 770, Japan. *
5181
5182
SHIMIZU AND KAJI
with SmaI, partially digested on both ends with Bal 31, and cut at the EcoRI site (see Fig. 2). The resulting fragments of various lengths were separated on a 1.2% agarose gel. The fragments were purified from the gel and ligated into the SmaI and EcoRI sites of pUC19. pRRFP- was made by removing the SmaI-EcoRV fragment from pRR1; pRRFPdid not have RRF promoter regions or the transcriptional initiation site. For construction of the pKK series plasmids, the HincIIEcoRV fragment (the HincIl site is located within the multiple cloning site [MCS] of pUC19; see Fig. 2A) derived from each plasmid of the pRR series was inserted into the SmaI site upstream of the promoterless gene for Camr (Cams) in pKK232-8 (see Fig. 4). BamHI enzyme was used to determine the direction of the inserted RRF promoters. For construction of pKKLc and pKKLc-, the HaeII-HindIII fragment containing the lac promoter region (45) was isolated from pUC19. Both ends were filled with Klenow fragment and inserted into the SmaI site of pKK232-8. Detection of RRF in E. coli harboring pRRl or plasmids of the pRR series. Plasmid-carrying cells were grown in 10 ml of Trypticase soy broth containing ampicillin at 50 jig/ml until the A560 reached 0.8. The cells were pelleted and resuspended in 0.1 ml of 50 mM Tris-HCI (pH 6.8) buffer. They were then disrupted by freeze-thawing, and the extract was cleared of cell debris by centrifugation for 10 min at 4°C in a microcentrifuge. The resulting total-celi proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (30). After electrophoresis, the gel was stained with Coomassie brilliant blue R to visualize the protein bands. RRF was purified to homogeneity as described previously (37). Protein was determined by the method of Bradford (9), using bovine serum albumin as a standard. CAT assay and determination of Camr level. The cell extracts were prepared by freeze-thawing as described above except for the use of 100 mM Tris-HCl (pH 7.8) buffer for extraction. Since no inclusion bodies were formed in cells expressing CAT, the soluble fraction was assayed by using [14C]acetyl coenzyme A (4.0 mCi/mmol; DuPont/New England Nuclear) as described previously (34). Specific CAT activity was expressed as enzyme units per milligram of total-cell protein. Camr levels were determined by streaking liquid cultures on Trypticase soy agar plates supplemented with various amounts of chloramphenicol. The plates were incubated for 14 h at 37°C, and the maximum chloramphenicol concentration which allowed visible colonies to form was taken as the Camr level. Assay of the activity of the RRF promoter in the presence and absence of cAMP. A single colony of the cAMP-deficient mutant CA7902 (44) harboring pKKR2 or pKKLc was inoculated into Trypticase soy broth containing 1 mM cAMP and was incubated at 37°C. Log-phase cultures were diluted appropriately and then incubated at 37°C in the presence or absence of exogenous 1 mM cAMP. CAT activities were determined as described above. One CAT unit was equivalent to 13,669 cpm. Each value is the mean of measurements made in triplicate. Primer extension analysis. A synthetic oligonucleotide complementary to the mRNA near the 5' end (40-mer; 5' -GATATCGCTAATCACGTTACGAATCCTTGAAAACT TGTCT-3'; shown in Fig. 2B between positions -25 and + 15 relative to the translational initiation site) was labeled at the 5' end with [oa-32P]ATP (>5,000 Ci/mmol; Amersham) and T4 polynucleotide kinase (Bethesda Research Laboratories)
J. BACTERIOL.
A
B
RRF
I 1
kDa
2
3
4
5
fr
66.0-
3688--N-ow 29.024.0
20.1
.1
-
d_
W.
As,
14.2~~~~
2 29.0 24.0
20.1
KDa FIG. 1. Expression of RRF by E. coli DH5a harboring pRR1. (A) Detection of RRF by SDS-PAGE. The cell extracts were prepared as described in Materials and Methods. The resulting total-cell proteins were separated by 15% SDS-PAGE. Lanes: 1 and 5, molecular weight marker proteins; 2, cell extracts of DH5a/pUC19 (6 ,ug); 3, cell extracts of DH5a/pRR1 (6 ,ug); 4, partially purified RRF (920 ng). The arrow indicates P-lactamase. (B) Densitometric analysis of the RRF bands. For quantification of the relative amounts of RRF expression, the Coomassie-stained gels were scanned with a densitometer (Shimadzu model CS-930 scanner). The solid and broken lines indicate the tracings originating from DH5a/pRR1 (lane 3) and DH5a/pUC19 (lane 2), respectively.
as described previously (33). Total E. coli RNA was purified by the method of Gilman and Chamberlin (22). Extension of a 32P-labeled 40-mer primer (50,000 cpm), hybridized to 30 ,ug of E. coli RNA obtained from log-phase cultures, was performed with 200 U of Moloney reverse transcriptase (Bethesda Research Laboratories) by the previously described method (33). Gel retardation assay. RNA polymerase holoenzyme (EC 2.7.7.6) from E. coli was obtained from Boehringer Mannheim. Nonradioactive DNA was quantitated by measuring the density of each band stained with ethidium bromide. Binding reaction mixtures (30 ,ul) contained approximately 1 ng of 32P-end-labeled DNA probe, 20 mM Tris-HCl (pH 8.0), 100 mM KCl, 3 mM MgCl2, 0.1 mM EDTA, 0.1 mM dithiothreitol, 5% (vol/vol) glycerol, and competitor DNA fragments as described in the legend to Fig. 6. Reactions were begun by the addition of RNA polymerase followed by incubation at 37°C for 10 min. One-tenth volume of 25% Ficoll containing xylene cyanol and bromphenol blue was added, and the entire reaction was subjected to 4% polyacrylamide gel (29:1, acrylamide/bisacrylamide) electrophoresis at 10 V/cm with constant recirculation of TBE buffer (89 mM Tris-borate, 2.5 mM EDTA, pH 8.3). Gels were dried onto Whatman 3MM paper and subjected to autoradiography. Nucleotide sequence determination. The DNA sequence was determined by M13 dideoxy sequencing (38) with deoxyadenosine 5'-[a-35Slthiotriphosphate (>1,000 Ci/mmol; Amersham) and the Sequenase sequence kit (United States Biochemical). DNA clones to be sequenced were prepared by subcloning restriction enzyme digests into M13mpl8 or M13mpl9 (45).
VOL. 173 1991 ,
A
-S
~ ~ ~ ~-,
RRF PROMOTER
I
t_3-138
_
9
-116 I
-100
5183
2 9pRR1
_-V pRR2 558
755
9 pRR52B
_
rn-9
pRR35B
_
~9
pRR36B
_.
3
pRR55B
x
-85
-80
_n-2 pRR49B
-71
_-2Q pRR41B
-54
-7-
_- 9 pRR6OB
-44
in-5
pRR58B
-29
r9
-
rn29 pRR39B
Mm _ B
-100
-120
5
GGGGCCAAAATGGCAAATAAAATAGCC
-60
-80
TAATAATCCAGACGA
+1
-40
TAGCACACT TCCACTGTGTGTGACTG
TAATATGTTTAATCAGGGC
-35 -20 1~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Q pRRFP-
-10 560
10
580
TGTGGTCTGACTGAGACAAGTTTTCAAQGATTCGTAACGTGATTAGCGATATC ......... TGATTTCTTGAACGACAAAAACGCCGCTCAGTAGATCT Mel Ile Ser Asp Ile Stop 3 c g t caaaag t t cc t aagca t gcac aa t cgc t a t ag 5'
600
740
620
TGCGGATCGGCTGGCGGCGTTTTGCTTTTTATT ......... GCGTAGTTGCGCTGGTGGCAGG
3'
FIG. 2. Structures of plasmids constructed from various DNA fragments of the RRF gene. (A) Restriction maps of pRR1 (27) and its deletion derivatives (pRR series plasmids). Closed boxes indicate the open reading frame of RRF; open boxes represent the deletions in plasmids of the pRR series which were generated by digesting the 893-bp SmaI-EcoRI fragment of pRR1 from left to right with Bal 31 or with EcoRV followed by cloning into the SmaI-EcoRI sites of pUC19. Nucleotide numbers correspond to those shown in panel B. Restriction sites: A, HincIl; 0, EcoRI; A, PstI; FI, SmaI; EcoRV. MCS of pUC19. (B) Nucleotide sequence and deduced amino acid sequence of the SmaI-EcoRI region of the RRF gene. Nucleotide positions are numbered from the translational initiation site (GTG) of the RRF gene. The nucleotide sequence shown in lowercase letters indicates the primer synthesized complementary to the mRNA near the 5' end. The wavy line indicates the presumed Shine-Dalgarno sequence (39). The broken line shows the EcoRV site. The underlined region represents the sequence for rho-independent termination of transcription (1). ---,
RESULTS RRF expression from the RRF promoter cloned into the vector pUC19. As shown in Fig. 1, when total-protein extracts of E. coli harboring pRR1 were analyzed by SDSPAGE, a large amount of RRF was detected. This finding is consistent with the previously reported result that RRF is a predominant protein in cell lysate of E. coli harboring pRR1
prepared by lysozyme digestion and streptomycin precipitation (27). This SDS-PAGE analysis further revealed that pRR1 enhanced the production of an additional protein to some extent. This protein had the characteristics of ,-lactamase (2). However, plasmid pRR1 allowed a relative increase in production of RRF to levels in excess of approximately fivefold that found for ,B-lactamase (Fig. 1B). This result suggests that a possible promoter in the RRF cistron is functioning in the system. To localize the promoter region of the RRF cistron, we generated within it a nested set of deletions and examined the RRF expression from each construct. Figure 2A represents the structures of these deletion mutants, designated the pRR series. pRR2 was made by ligating the SmaI-EcoRI fragment from pRR1 into the SmaI and EcoRI sites of pUC19. The precise end point of each deletion plasmid was confirmed by nucleotide sequencing. We determined in this work the 62-nucleotide sequence
(positions -138 to -77) extending upstream of the previously published RRF sequence (27) as shown in Fig. 2B. In the experiment represented in Fig. 3, relative amounts of RRF expression in cells containing the deletion derivatives of the promoter region of frr were calculated from densitometry of the electrophoretic RRF bands and shown as a percentage of the amount of RRF expression from pRR1. Our pRR series plasmids demonstrate that some portion of the DNA sequence within 100 nucleotides upstream of the translational initiation site is required for full in vivo expression of RRF (Fig. 2 and 3). The region required for full RRF expression is defined by plasmids pRR52B and pRR35B, containing deletions from position -138 to positions -116 and -100, respectively. RRF expression data using these plasmids indicated that deletions in this region had little effect on RRF expression (Fig. 3). In further attempts to define the RRF promoter, we looked for regions showing homology to the conserved -35 (TTGACA) and -10 (TATAAT) regions of E. coli promoters (24, 36, 40). The positions with the highest homology to these promoter consensus sequences were positions -96 to -91 (TTacCc), corresponding to the -35 region, and positions -70 to -65 (TATAcT), corresponding to the -10 region. The capital letters indicate homology to the consensus, and the lower-
5184
J. BACTERIOL.
SHIMIZU AND KAJI Plasmid pRR 1
Relative amount of RRF, %
-
pRR2 pRR52BpRR35BpRR36BpRR55B-
Specific CAT Activity units/mg total cell proteins
Insertions
pRR49B pRR41B pRR60B-
JOURNAL OF BACTERIOLOGY, Aug. 1991, p. 5181-5187
0021-9193/91/165181-07$02.00/0 Copyright © 1991, American Society for Microbiology
Identification of the Promoter Region of the Ribosome-Releasing Factor Cistron (frr) ICHIRO SHIMIZUt AND AKIRA KAJI* Department of Microbiology, School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104 Received 7 February 1991/Accepted 10 June 1991
Previous studies of the structure and expression of the ribosome-releasing factor (RRF) cistron (frr) have suggested that an efficient promoter region is located in the RRF cistron. We report here on the nucleotide sequence and in vivo function of the RRF promoter. The transcriptional start site was determined by primer extension to be 58 bp upstream of the translational initiation codon offrr. The location of the RRF promoter region was confirmed by means of (i) deletion analysis of the 5' proximal sequences of frr fused to the chloramphenicol acetyltransferase reporter gene, (ii) analysis of RRF produced in vivo from the deletion derivatives offrr cloned into pUC19, and (iii) gel retardation analysis with Escherichia coli RNA polymerase. The -35 and -10 regions were TTacCc and TATAcT, respectively. The strength of the RRF promoter was similar to that of the lac promoter, as determined by in vivo expression of chloramphenicol acetyltransferase activity. However, the RRF promoter was not affected by the intracellular cyclic AMP level despite the presence of a cyclic AMP receptor protein binding site downstream of the RRF promoter.
Ribosome-releasing factor (RRF) is an Escherichia coli protein responsible for the release of ribosomes from mRNA during the termination of protein synthesis (25). It has been demonstrated that the translational initiation site of the RRF gene (frr) is located at 4 min on the E. coli gene map, 1.1 kb downstream of the translational termination site of tsf (28). The DNA sequence offrr has been determined, and it was deduced that RRF consists of 185 amino acids with a calculated molecular weight of 20,639 (27). In addition, when frr was cloned into the vector pUC19 (45), E. coli harboring the resulting plasmid, designated pRR1, expressed RRF efficiently (27). This observation suggested that a site in the cloned fragment of pRR1 can serve as an efficient promoter for the high expression of RRF in combination with the high-copy-number vector (5). However, no information has been reported concerning the promoter for RRF expression, even though Bendiak and Friesen (4) proposed a possible location of a putative promoter for RRF expression downstream of tsf at 4 min on the E. coli gene map. In this communication, we report on the precise location and in vivo function of the RRF promoter. To make this determination, we constructed plasmids containing nested deletions in the upstream region of the RRF cistron by digestion with restriction enzymes and nuclease Bal 31. The deleted promoter regions were fused to a reporter gene encoding chloramphenicol acetyltransferase (CAT) and examined in vivo for expression of CAT activity. The RRF promoter region has been defined by sequencing each of the deletion-containing fragments and by gel retardation analysis of an E. coli RNA polymerase-DNA complex. The transcriptional start site has been determined by primer extension to be 58 bp upstream of the translational initiation codon offrr. The sequences of the -35 and -10 regions of the RRF promoter thus determined were TTacCc and TATAcT, respectively.
MATERIALS AND METHODS Bacterial strains and plasmids. E. coli DH5a (Bethesda Research Laboratories) was used as a host for plasmids containing frr. Plasmid pRR1 was constructed as described previously (27). Briefly, the 2.2-kb EcoRI fragment isolated from the Clarke-Carbon plasmid pLC6-32 (15) was inserted into the EcoRI site downstream of the lac promoter (18) in pUC19. Southern hybridization of the EcoRI digest revealed no differences between the cloned gene and frr from wildtype E. coli genomic DNA (27). pKK232-8 (10) containing the promoterless gene for chloramphenicol resistance (Camr) was a generous gift from Jurgen Brosius. This plasmid vector has been used to identify and measure the relative activities of various promoters (14). Culture conditions and DNA manipulations. Culture conditions and methods for cloning, ligation, and transformation were as described elsewhere (27, 28), essentially according to the methods of Maniatis et al. (33). Plasmid DNA was prepared by equilibrium centrifugation in CsCl gradients (16) or by the alkaline extraction procedure (7). E. coli transformants were selected by plating on Trypticase soy agar (BBL Microbiology Systems) containing 50 jig of ampicillin per ml and 50 ,ul of 2% 5-bromo-4-chloro-3-indolyl-p-D-galactopyranoside for the pRR series plasmids or 50 ,ug of ampicillin per ml for the pKK series plasmids. Restriction enzymes and T4 DNA ligase were obtained from Bethesda Research Laboratories and used under reaction conditions recommended by the supplier. Vectors were routinely treated with calf intestinal alkaline phosphatase (Boehringer Mannheim) to increase the insertion frequency. When blunt ends were required, DNA fragments were treated with the Klenow fragment of E. coli DNA polymerase I (Bethesda Research Laboratories). In experiments in which cyclic AMP (cAMP)deficient mutant CA7902 (44) was used, bacteria were grown on a MacConkey agar plate, and a single red colony which was selected from the region around a disk containing 20 mM cAMP was inoculated into liquid media. Deletion derivatives. For construction of the pRR series plasmids, nuclease Bal 31 (Boehringer Mannheim) was used to make 5'-to-3' deletions in the cloned SmaI-EcoRI fragment of pRR1. To do this, plasmid pRRl was first linearized
Corresponding author. t Present address: Second Department of Internal Medicine, School of Medicine, University of Tokushima, Tokushima 770, Japan. *
5181
5182
SHIMIZU AND KAJI
with SmaI, partially digested on both ends with Bal 31, and cut at the EcoRI site (see Fig. 2). The resulting fragments of various lengths were separated on a 1.2% agarose gel. The fragments were purified from the gel and ligated into the SmaI and EcoRI sites of pUC19. pRRFP- was made by removing the SmaI-EcoRV fragment from pRR1; pRRFPdid not have RRF promoter regions or the transcriptional initiation site. For construction of the pKK series plasmids, the HincIIEcoRV fragment (the HincIl site is located within the multiple cloning site [MCS] of pUC19; see Fig. 2A) derived from each plasmid of the pRR series was inserted into the SmaI site upstream of the promoterless gene for Camr (Cams) in pKK232-8 (see Fig. 4). BamHI enzyme was used to determine the direction of the inserted RRF promoters. For construction of pKKLc and pKKLc-, the HaeII-HindIII fragment containing the lac promoter region (45) was isolated from pUC19. Both ends were filled with Klenow fragment and inserted into the SmaI site of pKK232-8. Detection of RRF in E. coli harboring pRRl or plasmids of the pRR series. Plasmid-carrying cells were grown in 10 ml of Trypticase soy broth containing ampicillin at 50 jig/ml until the A560 reached 0.8. The cells were pelleted and resuspended in 0.1 ml of 50 mM Tris-HCI (pH 6.8) buffer. They were then disrupted by freeze-thawing, and the extract was cleared of cell debris by centrifugation for 10 min at 4°C in a microcentrifuge. The resulting total-celi proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (30). After electrophoresis, the gel was stained with Coomassie brilliant blue R to visualize the protein bands. RRF was purified to homogeneity as described previously (37). Protein was determined by the method of Bradford (9), using bovine serum albumin as a standard. CAT assay and determination of Camr level. The cell extracts were prepared by freeze-thawing as described above except for the use of 100 mM Tris-HCl (pH 7.8) buffer for extraction. Since no inclusion bodies were formed in cells expressing CAT, the soluble fraction was assayed by using [14C]acetyl coenzyme A (4.0 mCi/mmol; DuPont/New England Nuclear) as described previously (34). Specific CAT activity was expressed as enzyme units per milligram of total-cell protein. Camr levels were determined by streaking liquid cultures on Trypticase soy agar plates supplemented with various amounts of chloramphenicol. The plates were incubated for 14 h at 37°C, and the maximum chloramphenicol concentration which allowed visible colonies to form was taken as the Camr level. Assay of the activity of the RRF promoter in the presence and absence of cAMP. A single colony of the cAMP-deficient mutant CA7902 (44) harboring pKKR2 or pKKLc was inoculated into Trypticase soy broth containing 1 mM cAMP and was incubated at 37°C. Log-phase cultures were diluted appropriately and then incubated at 37°C in the presence or absence of exogenous 1 mM cAMP. CAT activities were determined as described above. One CAT unit was equivalent to 13,669 cpm. Each value is the mean of measurements made in triplicate. Primer extension analysis. A synthetic oligonucleotide complementary to the mRNA near the 5' end (40-mer; 5' -GATATCGCTAATCACGTTACGAATCCTTGAAAACT TGTCT-3'; shown in Fig. 2B between positions -25 and + 15 relative to the translational initiation site) was labeled at the 5' end with [oa-32P]ATP (>5,000 Ci/mmol; Amersham) and T4 polynucleotide kinase (Bethesda Research Laboratories)
J. BACTERIOL.
A
B
RRF
I 1
kDa
2
3
4
5
fr
66.0-
3688--N-ow 29.024.0
20.1
.1
-
d_
W.
As,
14.2~~~~
2 29.0 24.0
20.1
KDa FIG. 1. Expression of RRF by E. coli DH5a harboring pRR1. (A) Detection of RRF by SDS-PAGE. The cell extracts were prepared as described in Materials and Methods. The resulting total-cell proteins were separated by 15% SDS-PAGE. Lanes: 1 and 5, molecular weight marker proteins; 2, cell extracts of DH5a/pUC19 (6 ,ug); 3, cell extracts of DH5a/pRR1 (6 ,ug); 4, partially purified RRF (920 ng). The arrow indicates P-lactamase. (B) Densitometric analysis of the RRF bands. For quantification of the relative amounts of RRF expression, the Coomassie-stained gels were scanned with a densitometer (Shimadzu model CS-930 scanner). The solid and broken lines indicate the tracings originating from DH5a/pRR1 (lane 3) and DH5a/pUC19 (lane 2), respectively.
as described previously (33). Total E. coli RNA was purified by the method of Gilman and Chamberlin (22). Extension of a 32P-labeled 40-mer primer (50,000 cpm), hybridized to 30 ,ug of E. coli RNA obtained from log-phase cultures, was performed with 200 U of Moloney reverse transcriptase (Bethesda Research Laboratories) by the previously described method (33). Gel retardation assay. RNA polymerase holoenzyme (EC 2.7.7.6) from E. coli was obtained from Boehringer Mannheim. Nonradioactive DNA was quantitated by measuring the density of each band stained with ethidium bromide. Binding reaction mixtures (30 ,ul) contained approximately 1 ng of 32P-end-labeled DNA probe, 20 mM Tris-HCl (pH 8.0), 100 mM KCl, 3 mM MgCl2, 0.1 mM EDTA, 0.1 mM dithiothreitol, 5% (vol/vol) glycerol, and competitor DNA fragments as described in the legend to Fig. 6. Reactions were begun by the addition of RNA polymerase followed by incubation at 37°C for 10 min. One-tenth volume of 25% Ficoll containing xylene cyanol and bromphenol blue was added, and the entire reaction was subjected to 4% polyacrylamide gel (29:1, acrylamide/bisacrylamide) electrophoresis at 10 V/cm with constant recirculation of TBE buffer (89 mM Tris-borate, 2.5 mM EDTA, pH 8.3). Gels were dried onto Whatman 3MM paper and subjected to autoradiography. Nucleotide sequence determination. The DNA sequence was determined by M13 dideoxy sequencing (38) with deoxyadenosine 5'-[a-35Slthiotriphosphate (>1,000 Ci/mmol; Amersham) and the Sequenase sequence kit (United States Biochemical). DNA clones to be sequenced were prepared by subcloning restriction enzyme digests into M13mpl8 or M13mpl9 (45).
VOL. 173 1991 ,
A
-S
~ ~ ~ ~-,
RRF PROMOTER
I
t_3-138
_
9
-116 I
-100
5183
2 9pRR1
_-V pRR2 558
755
9 pRR52B
_
rn-9
pRR35B
_
~9
pRR36B
_.
3
pRR55B
x
-85
-80
_n-2 pRR49B
-71
_-2Q pRR41B
-54
-7-
_- 9 pRR6OB
-44
in-5
pRR58B
-29
r9
-
rn29 pRR39B
Mm _ B
-100
-120
5
GGGGCCAAAATGGCAAATAAAATAGCC
-60
-80
TAATAATCCAGACGA
+1
-40
TAGCACACT TCCACTGTGTGTGACTG
TAATATGTTTAATCAGGGC
-35 -20 1~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Q pRRFP-
-10 560
10
580
TGTGGTCTGACTGAGACAAGTTTTCAAQGATTCGTAACGTGATTAGCGATATC ......... TGATTTCTTGAACGACAAAAACGCCGCTCAGTAGATCT Mel Ile Ser Asp Ile Stop 3 c g t caaaag t t cc t aagca t gcac aa t cgc t a t ag 5'
600
740
620
TGCGGATCGGCTGGCGGCGTTTTGCTTTTTATT ......... GCGTAGTTGCGCTGGTGGCAGG
3'
FIG. 2. Structures of plasmids constructed from various DNA fragments of the RRF gene. (A) Restriction maps of pRR1 (27) and its deletion derivatives (pRR series plasmids). Closed boxes indicate the open reading frame of RRF; open boxes represent the deletions in plasmids of the pRR series which were generated by digesting the 893-bp SmaI-EcoRI fragment of pRR1 from left to right with Bal 31 or with EcoRV followed by cloning into the SmaI-EcoRI sites of pUC19. Nucleotide numbers correspond to those shown in panel B. Restriction sites: A, HincIl; 0, EcoRI; A, PstI; FI, SmaI; EcoRV. MCS of pUC19. (B) Nucleotide sequence and deduced amino acid sequence of the SmaI-EcoRI region of the RRF gene. Nucleotide positions are numbered from the translational initiation site (GTG) of the RRF gene. The nucleotide sequence shown in lowercase letters indicates the primer synthesized complementary to the mRNA near the 5' end. The wavy line indicates the presumed Shine-Dalgarno sequence (39). The broken line shows the EcoRV site. The underlined region represents the sequence for rho-independent termination of transcription (1). ---,
RESULTS RRF expression from the RRF promoter cloned into the vector pUC19. As shown in Fig. 1, when total-protein extracts of E. coli harboring pRR1 were analyzed by SDSPAGE, a large amount of RRF was detected. This finding is consistent with the previously reported result that RRF is a predominant protein in cell lysate of E. coli harboring pRR1
prepared by lysozyme digestion and streptomycin precipitation (27). This SDS-PAGE analysis further revealed that pRR1 enhanced the production of an additional protein to some extent. This protein had the characteristics of ,-lactamase (2). However, plasmid pRR1 allowed a relative increase in production of RRF to levels in excess of approximately fivefold that found for ,B-lactamase (Fig. 1B). This result suggests that a possible promoter in the RRF cistron is functioning in the system. To localize the promoter region of the RRF cistron, we generated within it a nested set of deletions and examined the RRF expression from each construct. Figure 2A represents the structures of these deletion mutants, designated the pRR series. pRR2 was made by ligating the SmaI-EcoRI fragment from pRR1 into the SmaI and EcoRI sites of pUC19. The precise end point of each deletion plasmid was confirmed by nucleotide sequencing. We determined in this work the 62-nucleotide sequence
(positions -138 to -77) extending upstream of the previously published RRF sequence (27) as shown in Fig. 2B. In the experiment represented in Fig. 3, relative amounts of RRF expression in cells containing the deletion derivatives of the promoter region of frr were calculated from densitometry of the electrophoretic RRF bands and shown as a percentage of the amount of RRF expression from pRR1. Our pRR series plasmids demonstrate that some portion of the DNA sequence within 100 nucleotides upstream of the translational initiation site is required for full in vivo expression of RRF (Fig. 2 and 3). The region required for full RRF expression is defined by plasmids pRR52B and pRR35B, containing deletions from position -138 to positions -116 and -100, respectively. RRF expression data using these plasmids indicated that deletions in this region had little effect on RRF expression (Fig. 3). In further attempts to define the RRF promoter, we looked for regions showing homology to the conserved -35 (TTGACA) and -10 (TATAAT) regions of E. coli promoters (24, 36, 40). The positions with the highest homology to these promoter consensus sequences were positions -96 to -91 (TTacCc), corresponding to the -35 region, and positions -70 to -65 (TATAcT), corresponding to the -10 region. The capital letters indicate homology to the consensus, and the lower-
5184
J. BACTERIOL.
SHIMIZU AND KAJI Plasmid pRR 1
Relative amount of RRF, %
-
pRR2 pRR52BpRR35BpRR36BpRR55B-
Specific CAT Activity units/mg total cell proteins
Insertions
pRR49B pRR41B pRR60B-
