Identification of tissue-specific regulatory region in the zebrafish lamin A promoter.

GENE-40474; No. of pages: 8; 4C: Gene xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Identification of tissue-specific regulatory region in the zebrafish lamin A promoter Ajay D. Verma, Veena K. Parnaik ⁎ CSIR-Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad, India

a r t i c l e

i n f o

Article history: Received 19 November 2014 Received in revised form 24 March 2015 Accepted 24 April 2015 Available online xxxx Keywords: Lamin promoter Lamin gene regulation Lamin embryonic expression Lamin tissue-specific expression Lamin developmental regulation

a b s t r a c t Lamins are major structural proteins present in the nuclei of metazoan cells and contribute significantly to nuclear organization and function. The expression of different types of lamins is developmentally regulated and lamin A is detectable in most differentiated tissues. Although the proximal promoter of the mammalian lamin A gene has been characterized, the tissue-specific regulatory elements of the gene have not been identified. In this study, we have cloned and functionally characterized a 2.99 kb segment upstream of exon 1 in the zebrafish lamin A gene. This fragment was able to drive GFP expression in several tissues of the developing embryo at 14–72 h post fertilization in stable transgenic lines. Deletion fragments of the 2.99 kb promoter were analyzed by microinjection into zebrafish embryos in transient assays as well as by luciferase reporter assays in cultured cells. A minimal promoter segment of 1.24 kb conferred tissue-specific expression of GFP in the zebrafish embryo as well as in a myoblast cell line. An 86 bp fragment of this 1.24 kb segment was able to activate a heterologous promoter in myoblasts. Mutational analysis revealed the importance of muscle-specific regulatory motifs in the promoter. Our results have important implications for understanding the tissue-specific regulation and functions of the lamin A gene. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Lamins are conserved type V intermediate filament proteins that form a fibrous network or lamina underlying the inner nuclear membrane which also extends throughout the interior of the nucleus. The lamina plays an essential role in maintaining the integrity of the nuclear envelope and is required for the spatial organization of various nuclear functions as well as organization of chromatin. Two major classes of lamins are found in most metazoan species: B-type lamins B1 and B2 that are coded by separate genes and are expressed in nearly all somatic cells, and A-type lamins A and C that are encoded by a single lamin A gene through alternative splicing and are detectable in several differentiated cell types. Additional splice variants of both types of lamins are expressed in germ cells. In vertebrates, A-type lamins are developmentally regulated and the onset of their expression in different tissues generally correlates with cellular differentiation (Broers et al., 2006; Dechat et al., 2008; Parnaik, 2008). Although the proximal promoter motifs that control lamin A expression have been well documented in the mammalian gene (Lin and Worman, 1993; Nakajima and Abe, 1995; Tiwari et al., 1998), there is very little information available on tissue-specific

Abbreviations: Dpf, days post fertilization; GFP, green fluorescence protein; hpf, hours post fertilization; MEF2C, myocyte-enhancing factor 2C; zlamin A/C, zebrafish lamin A/C. ⁎ Corresponding author at: CSIR-Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad 500007, India. E-mail address: [email protected] (V.K. Parnaik).

regulatory elements of the gene. Understanding the tissue-specific regulation of lamin A expression assumes importance in light of the discovery that different mutations in human lamin A cause a spectrum of tissue-specific diseases which mainly affect skeletal muscle, cardiac tissue, adipose and bone tissues and also cause premature aging disorders (Broers et al., 2006; Dechat et al., 2008; Parnaik, 2008; Parnaik et al., 2011; Butin-Israeli et al., 2012). The zebrafish has emerged as a useful system for the study of vertebrate development, especially due to the ease of visualization of GFPtagged reporters during embryogenesis in both stable and transient transgenic fish. Zebrafish has four genes that code for lamins A, B1, B2 and LIII. Zebrafish lamin A gene shows 63% identity and 76% similarity with the human lamin A gene. Based on its conserved gene structure and sequence similarity, zlamin A can be considered to be an orthologue of mammalian lamin A. Mutations in zlamin A have been reported to functionally simulate human premature aging disorders (Koshimizu et al., 2011). In the present study, we have isolated a 2.99 kb region of the zebrafish lamin A gene upstream of the ATG translational start site which can drive GFP expression in several tissues of the developing embryo. By deletion analysis, we have identified a minimal promoter segment of 1.24 kb that confers tissue-specific expression of GFP in the zebrafish embryo as well as luciferase expression in the C2C12 mouse myoblast cell line. This segment harbors an 86 bp element that is able to activate a heterologous promoter in C2C12 cells and contains a muscle-specific regulatory motif.

http://dx.doi.org/10.1016/j.gene.2015.04.067 0378-1119/© 2015 Elsevier B.V. All rights reserved.

Please cite this article as: Verma, A.D., Parnaik, V.K., Identification of tissue-specific regulatory region in the zebrafish lamin A promoter, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.067

2

A.D. Verma, V.K. Parnaik / Gene xxx (2015) xxx–xxx

2. Materials and methods 2.1. Cloning of lamin A putative promoter region from zebrafish The zebrafish lamin A cDNA sequence (GI 23308640) was blasted to zebrafish genome sequence (Zv9 reference assembly) in NCBI blast (http://blast.ncbi.nlm.nih.gov/blast/Blast). It aligned to the sequence NC_007127.5 at Danio rerio strain Tubingen chromosome 16, Zv9. A 2.99 kb region upstream of the zlamin A translational ATG codon spanning from 32869654 bp to 32866666 bp was identified and amplified from genomic DNA by PCR using the primers and conditions listed in Table 1 (2.99 kb zLmnaA P). Deletion fragments of length 0.91, 1.16 and 2.20 kb were made by digestion with suitable restriction enzymes. Fragments of 1.24, 1.35, 1.41, 1.52 and 1.67 kb were generated by PCR

using the primers and conditions listed in Table 1. Mutant constructs were made by PCR-based mutagenesis using the 1.67 kb lamin A promoter fragment as template, using the primers and conditions listed in Table 1. Single mutations were made in E box E5(m) at − 1165 to −1160 (CAGCTG to GTGCGT), E6(m) at −1506 to −1501 (CATTTG to GTTTGT) and E7(m) at −1639 to −1634 (CATTTG to GTTTGT), followed by double and triple mutations. The promoter fragments were cloned into the Tol2-GFP vector (Urasaki et al., 2006) for analysis in zebrafish embryos or pGL3-Basic vector (Promega Corporation, Madison, WI) for analysis in cultured cells. The fragments spanning −1158/−1243 bp and − 1204/− 1289 bp were amplified by PCR and cloned into the pGL3-Promoter vector, upstream of the SV40 promoter. The sequences of all constructs were verified by automated DNA sequencing. 2.2. Generation of transgenic zebrafish

Table 1 List of PCR primers and reaction conditions. Name of fragment 2.99 kb zLmnA P

Primer sequences (5′–3′)

Forward : ATCCAATTCATATTAA AGTGTTCA Reverse : GGTTGTCTGGAACTAC TGATACTA 1.67 kb zLmnA Forward : CTCTGGAAGTCAATGG P TTACATGT Reverse : GGTTGTCTGGAACTAC TGATACTA 1.41 kb zLmnA Forward : AATTTACTGCTGTTCA P AGCTGC Reverse : GGTTGTCTGGAACTAC TGATACTA 1.52 kb zLmnA Forward : TTTGTTGTAATTGTAT P CATTTGTATT Reverse : GGTTGTCTGGAACTAC TGATACTA 1.29 kb zLmnA Forward : GACTTCACAAACTCCG P CCTTC Reverse : GGTTGTCTGGAACTAC TGATACTA 1.24 kb zLmnA Forward : GAGGCGTGAGTTTCTG P CCAGA Reverse : GGTTGTCTGGAACTAC TGATACTA −1204/−1289 Forward : TGAGAGGCGTGAGTTT CTGCCAGAGATCAGAAGCGCGA GTCGCCTAGCCCGGGCTCGAGA TCT Reverse : ATGAAGAGAAGGAGGA GGAGGAGAAGGCGGAGTTTGTG AAGTCCACGCGTAAGAGCTCGGTA CC −1158/−1243 Forward : ACACACTCTTTCAGCA GAGTTTCAGCGGGACACAGCAGCT GTACTAGCCCGGGCTCGAGATCT Reverse : GCTGCGACTCGCGCTT CTGATCTCTGGCAGAAACTCACGC CTCCACGCGTAAGAGCTCGGTACC zLmnA P Forward : GTTACATGTTTGAAAT E7(m) ATCTTGTTTGTTGTTCAACGGGAC AAAGG Reverse : CCTTTGTCCCGTTGAACA ACAAACAAGATATTTCAAACATGT AAC zLmnA P Forward : TTATTATTTTGTTGTAAT E6(m) TGTATGTTTGTTATTTTATTAAAA TAT Reverse : ATATTTTAATAAAATA ACAAACATACAATTACAACAAAAT AATAA zLmnA P Forward : CAGAGTTTCAGCGGGA E5(m) CACAGGTGCGTTAGGAGCTTCAAT AACC Reverse : GGTTATTGAAGCTCCT AACGCACCTGTGTCCCGCTGAAAC TCTG

Reaction conditions 94 °C — 1 min, 94 °C — 15 s, 56 °C — 25 s, 68 °C — 3 min, 68 °C — 10 min 94 °C — 1 min, 94 °C — 15 s, 60 °C — 25 s, 68 °C — 2 min, 68 °C — 10 min 94 °C — 1 min, 94 °C — 15 s, 56 °C — 25 s, 68 °C — 2 min, 68 °C — 10 min 94 °C — 1 min, 94 °C — 15 s, 58 °C — 25 s, 68 °C — 2 min, 68 °C — 10 min 94 °C — 1 min, 94 °C — 15 s, 58 °C — 25 s, 68 °C — 1.5 min, 68 °C — 10 min 94 °C — 1 min, 94 °C — 15 s, 58 °C — 25 s, 68 °C — 1.5 min, 68 °C — 10 min 94 °C — 1 min, 94 °C — 15 s, 64 °C — 25 s, 68 °C — 12 min, 68 °C — 10 min

94 °C — 1 min, 94 °C — 15 s, 62 °C — 25 s, 68 °C — 12 min, 68 °C — 10 min



Adult zebrafish (Tubingen strain) were maintained on a 14 h light/ 10 h dark cycle in a temperature controlled room at 28 ± 1 °C. Fish were fed with live brine shrimps twice daily and water was changed daily. Breeding and rearing of zebrafish were performed according to standard methods (Westerfield, 2000). To obtain Tol2 transposase mRNA, the pDB600 plasmid encoding the transposase (Balciunas et al., 2006) was linearized by Xba I digestion and transcribed using the T3 mMessage mMachine in vitro transcription kit (Ambion, Foster City, CA) according to the manufacturer's instructions. To generate transgenic larvae, 35 ng/μl of Tol2 transposase mRNA and 30 ng/μl of GFP construct were co-injected into 1-cell stage embryos as described (Fisher et al., 2006). Stable transgenic lines of GFP expressing zebrafish were established by standard breeding procedures. The embryos were staged by hours post fertilization (hpf) or days post fertilization (dpf) and also by morphological criteria as described (Westerfield, 2000). All animal experiments were conducted as per institutional guidelines. 2.3. Transient GFP reporter assays For transient assays of GFP reporter expression, the GFP construct (50 ng/μl) was injected into 1-cell stage zebrafish embryos and the embryos were allowed to develop. At 2.5 dpf embryos were anesthetized by adding tricaine methanesulfonate (Sigma-Aldrich) (0.4% stock solution) to the embryo medium and imaged using a Leica M205 FA fluorescence stereo microscope (Leica Microsystems GmbH, Germany). GFPpositive tissues were counted manually for each embryo (0–5 fluorescent streaks per tissue were denoted as low intensity and 5–20 streaks were denoted as high intensity); tissues were identified by morphological criteria as described (Westerfield, 2000). Approximately 70–100 injected embryos that were positive for GFP fluorescence were imaged per construct and percent values were calculated for data presentation. 2.4. Confocal laser scanning fluorescence microscopy (CLSM) Transgenic zebrafish embryos of different stages (14 hpf, 1 dpf, 2 dpf and 3 dpf) were dechorionated and anesthetized. The anesthetized embryos were imaged using a Leica SP8 confocal microscope (Leica Microsystems GmbH, Germany) with a 20× objective. Confocal images were taken using the laser channel 488 nm. While capturing a tile scan of the embryo, the pinhole was set to 2 airy units and the scanning speed was 300 Hz with a step size of 1.9 μm in the z-direction. The images were processed using LASAF software. 2.5. Cell culture and luciferase promoter assay


C2C12 mouse skeletal myoblasts were maintained at subconfluent densities in DMEM supplemented with 20% FBS. For lamin A promoter analysis, deletion and mutated fragments were cloned into pGL3-Basic vector, which contains the firefly luciferase gene as a reporter but does not contain any eukaryotic promoter or enhancer elements. For



activity analysis of the −1158/−1243 bp and −1204/−1289 bp fragments, these fragments were cloned into pGL3-Promoter vector. Myoblasts were transfected with 0.3 μg of lamin A-luciferase reporter vector and 0.1 μg of pCMV-SPORT-βgal plasmid using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Cells were transfected with pGL3Basic vector instead of the lamin A promoter for negative controls. Cells were harvested 24 h post-transfection and lysed. Aliquots were assayed for luciferase activity using a kit from Promega Corporation (Madison, WI) and for β-galactosidase activity by a standard assay. The values for luciferase activity were normalized to β-galactosidase activity as an internal control and then expressed as fold activation compared to the promoter-less pGL3-Basic vector. Each experiment was repeated three times with two technical replicates for each sample. 2.6. Sequence analysis Sequence comparison was carried out using clustalW analysis (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Putative transcription

3

factor binding sites were identified using MatInspector and TFSEARCH version 1.3. 3. Results 3.1. Isolation of zebrafish lamin A promoter region Based on data from the zebrafish genome sequencing project (Howe et al., 2013), a 2.99 kb region upstream of the zlamin A translational start site ATG was amplified from genomic DNA by PCR. Comparison of ~ 1.8 kb of sequence (1.5 kb upstream of ATG and ~ 300 bp of first exon) with corresponding mouse (accession number: NC_000069.6, GI: 372099107) and human (accession number: NC_000001.11, GI: 568815597) sequences indicated 71% homology in exon 1 but the upstream region showed poor homology (32%). Sequence analysis of the 2.99 kb lamin A promoter region indicated the presence of several consensus sites for the binding of muscle-specific regulatory factors (E-boxes) as well as binding sites for transcription factors such as

Fig. 1. Structure of the 5′ flanking region of the zebrafish lamin A gene. (A) Schematic representation of the 2.99 kb segment showing the positions of consensus E boxes, TATA boxes, Nkx 2 and MEF2C motifs. (b) Sequence comparison of the proximal promoter segments of human, mouse and zebrafish. In the human and mouse sequences, the reported transcription start site is indicated as +1; in zebrafish the translational start codon ATG has been denoted as +1 in this study. The conserved TATTA sequence in all three species and the reported Sp1/3 and AP-1 binding sites in the mouse promoter are shown in bold.


4


myocyte-enhancing factor 2C (MEF2C) and homeobox transcription factor Nkx 2, and two consensus TATA boxes (Fig. 1). Another TATAlike motif aligned with the functional TATA box of the mouse and human proximal promoters located 33 bp upstream of the reported transcription start site of the mammalian genes. However other functional binding sites such as the Sp1/3 and AP-1 motifs in the mouse promoter were not conserved in the zebrafish sequence. The zlamin A mRNA sequence has been shown to extend 23 bp upstream of ATG (GenBank BC163807), but the exact transcription start site has not been determined. The putative 2.99 kb lamin A promoter segment was cloned upstream of a GFP reporter vector and injected into 1-cell stage zebrafish embryos. Initial fluorescence studies with transiently GFP-expressing embryos indicated that the 2.99 kb region could drive GFP expression in several tissues of the developing embryo. In order to obtain maximum representation of tissues, we generated stable transgenic lines with this segment and examined in vivo tissue specificity of GFP expression in detail during different developmental stages in two independent lines. Fluorescence microscopy of embryos at 14 hpf indicated GFP expression in the Kupffer's vesicle, which functions in left–right patterning, and at the boundary between the embryonic shield and blastodisc, which harbors lineage precursors, as well as the developing notochord and brain primordium (Fig. 2A). At 1 dpf of embryogenesis, GFP fluorescence was visible in the forebrain (olfactory bulb), myotome and notochord (Fig. 3A). At 2–3 dpf of embryogenesis, GFP expression was evident in several tissues in the head region (forebrain, branchial arches and otic vesicle), the myotome, notochord and pectoral fin bud, and weak fluorescence was observed in the heart. In stable transgenic lines, a deletion fragment of 1.67 kb was similar in activity to the 2.99 kb segment, and this fragment could drive GFP expression in several tissues such as the head, myotome and notochord across developmental stages (Figs. 2B, 3B). Our tissue-specific GFP reporter expression data correlates with the reported expression of zlamin A transcripts in the developing somites (12–24 hpf) and head region and pectoral fin buds (48–72 hpf) (Koshimizu et al., 2011). 3.2. Deletion analysis of lamin A promoter region in embryos In order to identify tissue-specific promoter elements in the lamin A promoter segment, overlapping deletion fragments of 1.67 kb, 1.52 kb, 1.41 kb and 0.91 kb upstream of the ATG start site were analyzed. The ability of these fragments to drive GFP expression in different tissues of the developing embryo was determined at 2.5 dpf by microinjection into zebrafish embryos in transient assays. A detailed quantitative

analysis of percentage of injected embryos showing GFP expression in myotome, heart, head, epidermis and notochord is given in Table 2. In these transient assays, the tissue-specific activity of the 1.67 kb fragment was similar to its activity in stable lines, and high levels of GFP fluorescence could be visualized in several tissues such as the myotome, heart, head, epidermis and notochord in 30–60% of embryos (Fig. 4, Table 2). The 1.52 kb and 1.41 kb fragments could also direct GFP expression in these tissues, though the intensity of the fluorescence was overall lower. There were no distinct differences between these fragments in the types of tissues that expressed GFP; any observed quantitative differences might be attributed to the limitations of the transient assay technique. However, the 0.91 kb fragment gave nil or very low tissue-specific GFP fluorescence in the majority of embryos (98.5%). Injection of a promoterless GFP construct did not yield any fluorescence (data not shown). 3.3. Deletion analysis of lamin A promoter in a myoblast cell line Since our GFP reporter data indicated that the lamin A promoter could direct reporter expression in the myotome, we analyzed the muscle specific activity of the promoter in more detail. We employed the well-studied C2C12 mouse myoblast cell line as a model system to identify muscle-specific elements of the promoter since proliferating muscle progenitors (myoblasts) contribute to expansion of the embryonic myotome. The C2C12 myoblasts are known to contain muscle-specific regulatory factors which are highly conserved across species and can target specific binding motifs on promoter fragments (Yaffe and Saxel, 1977). Moreover, lamin transcript levels are high in lineage-committed proliferating cells and decrease upon terminal differentiation as lamins are very long-lived proteins. Initially, the lamin A 2.99 kb promoter and deletion fragments of 2.20 kb, 1.67 kb and 0.91 kb were cloned into the pGL3-Basic reporter vector and luciferase activity was determined in C2C12 cells. The 2.99 kb promoter gave an increase of 10-fold activity over pGL3-Basic vector while the 0.91 kb fragment showed only 3-fold higher activity than the pGL3-Basic vector (Fig. 5A). The activities of the 2.20 kb and 1.67 kb fragments were similar to that of the 2.99 kb fragment. The low activity of the 0.91 kb fragment was consistent with the data on GFP reporter analysis in developing embryos. The luciferase activity data suggested that regulatory elements were likely to be present between the 0.91 kb and 1.67 kb fragments. In order to identify these elements, luciferase activity was tested with additional deletion fragments of 1.16, 1.24, 1.35, 1.41 and 1.52 kb (Fig. 5B). The activity of the 1.16 kb fragment was low, similar to the 0.91 kb fragment. Interestingly, the 1.24 kb fragment showed a significant 10-fold increase over the 1.16 kb

Fig. 2. Activity of the zlamin A promoter in transgenic zebrafish embryos at 14 hpf of development. (A) Tissue-specific expression of GFP driven by the 2.99 kb promoter region in Kupffer's vesicle (K), boundary between the embryonic shield and blastodisc (B), and brain primordium (Bp). (B) Tissue-specific GFP expression driven by the 1.67 kb promoter segment. Similar patterns were obtained in two independent transgenic lines for each promoter fragment. CLSM images are shown for the lateral view, and regular fluorescence images for the dorsal and ventral views. Bar, 0.25 mm.



5

Fig. 3. Activity of the zlamin A promoter in transgenic zebrafish embryos at 1–3 dpf of development. (A) Tissue-specific expression of GFP driven by the 2.99 kb promoter region in notochord (N), myotome (M), forebrain (F), otic vesicle (O), branchial arches (A), eye (E) and pectoral fin bud (PF). (B) Tissue-specific GFP expression driven by the 1.67 kb promoter segment. Similar patterns were obtained in two independent transgenic lines for each promoter fragment. CLSM images are shown. Bar, 0.25 mm.

fragment, suggesting the presence of a positive regulatory element between 1.16 and 1.24 kb. This increase was maintained in the 1.35 kb fragment, but was reduced in the longer fragments of 1.41, 1.52 and 1.67 kb, suggesting that a negative regulatory element might be present between 1.35 and 1.41 kb. 3.4. Identification of muscle-specific regulatory element The above results on GFP expression in embryos and luciferase activity in C2C12 myoblasts suggested the presence of a muscle-specific positive regulatory element between −1.16 kb and −1.24 kb. The intervening sequence from −1158 to −1243 bp harbors transcription factor binding sites for the highly conserved muscle regulatory factor MyoD and a few other transcription factors (Fig. 6A). We checked the ability of the sequence from − 1158 to − 1243 bp to activate a heterologous SV40 promoter in C2C12 myoblasts. A 2-fold increase in pGL3-Promoter activity was observed in the presence of this 86 bp segment, whereas an overlapping segment from − 1204 to

− 1289 did not show this increase (Fig. 6B). The 1.24 kb segment was also able to drive expression in the myotome as well as other embryonic tissues, whereas the 0.91 kb fragment could not direct GFP expression in the myotome or most other embryonic tissues (Fig. 6C). Since a consensus site (E box E5) was observed for binding of myogenic regulatory factors in the 86 bp fragment, this sequence at −1165 to −1160 was mutated in the context of the 1.67 kb fragment and its activity was checked in C2C12 myoblasts. Additional E box motifs E6 (at − 1506) and E7 (at −1639) were also mutated and analyzed. Further, double mutants E5/E6, E5/E7 and E6/E7 as well as a triple mutant E5/E6/E7 were constructed and analyzed. There was no loss in activity compared to the original 1.67 kb fragment in C2C12 cells with the single mutants (Fig. 6D). On the other hand, both E5/E7 and E5/E6 double mutants showed significantly lower activity (32% and 64% of intact 1.67 kb) and lower activity was also observed with the triple mutant (73%). However, the E6/E7 double mutant did not show reduced activity. These data suggest that the E5 motif is functionally important in the context of the E6 and E7 motifs.

Table 2 Spatial pattern of GFP expression in zebrafish embryos.a Construct

GFP intensityb

Myotome

Heart

Head

Epidermis

Notochord

Total embryos

1.67 kb

Low High Low High Low High Low High

40.2 59.8 51.4 48.6 60.9 39.1 98.5 1.5

62.7 37.3 78.6 21.4 82.6 17.4 100 Nil

71.6 28.4 91.4 8.6 88.4 11.6 100 Nil

60.8 39.2 80.0 20.0 85.5 14.5 100 Nil

71.6 28.4 94.3 5.7 89.9 10.1 100 Nil

102

1.52 kb 1.41 kb 0.91 kb a b

70 69 68

Data presented as percentage of total embryos showing GFP positive tissue. Low: 0–5 streaks; high: 5–20 streaks.


6


Fig. 4. Activity of zlamin A promoter fragments in zebrafish embryos in transient assays. Tissue-specific GFP expression driven by 1.67, 1.52, 1.41 and 0.91 kb promoter fragments in myotome (M), heart (H), notochord (N), head region (He) and epidermis (E) at 2.5 dpf. Bar, 1 mm.

4. Discussion In this study we have described the isolation and functional characterization of a 2.99 kb genomic region upstream of the zebrafish lamin A translational start site that confers promoter activity in developing zebrafish embryos as well as cultured cells. The 2.99 kb zlamin A promoter as well as a 1.67 kb deletion fragment could drive expression of a GFP reporter gene in several tissues of the developing embryo. Analysis of reporter activity in cultured cells indicated that a 1.24 kb deletion fragment gave 10-fold higher reporter activity in cultured myoblasts compared to a 1.16 kb fragment. The 86 bp intervening segment at − 1243/− 1158 bp was able to activate a heterologous promoter in muscle cells and contained an important E box motif. Expression of A-type lamin proteins has been studied during development of various species such as Xenopus, mouse and Drosophila (Benavente et al., 1985; Stewart and Burke, 1987; Röber et al., 1989; Riemer et al., 1995). These early studies established that expression of A-type lamins is regulated spatially and temporally in a tissue-specific manner during development in various species. Further studies have revealed that mouse and human embryonic stem cells express lamin A and C proteins and mRNAs upon differentiation (Constantinescu et al., 2006; Sehgal et al., 2013). In zebrafish, lamin A mRNA is expressed from the late gastrula stage (9 hpf) onwards (Koshimizu et al., 2011), though protein is detectable only by 48–72 hpf, when most organs have been formed, probably due to limitations of sensitivity of the detection method. We detected lamin A promoter activity in the developing embryo by 14 hpf and in several tissues by 24–48 hpf. In previous studies, analysis of the 5′ flanking region of the mouse lamin A promoter in cultured cells has shown the importance of the transcription factors Sp1, Sp3 and CREB-binding protein as well as a retinoic-acid-responsive element within a 200-bp proximal promoter region (Tiwari et al., 1998; Okumura et al., 2000; Muralikrishna and

Parnaik, 2001; Ramaiah and Parnaik, 2006). In the zlamin A promoter, though the proximal 0.91 kb segment contained the conserved TATTA box, other motifs were not conserved. Moreover, this fragment showed very low activity in C2C12 cells and could not drive GFP expression in

Fig. 5. Luciferase reporter gene assays in cultured cell lines. (A, B) Transient transfection experiments in C2C12 myoblasts using serial deletions of the zlamin A promoter-luciferase reporter gene (solid box) fusion constructs (*denotes −1 with respect to the translational start site).



the embryo, suggesting that the regulatory elements in the zlamin A proximal promoter are likely to be distinct from those in the mammalian gene. Although the first intron of the mammalian gene contains motifs that mediate cell-type specific interactions with transcription factors in binding assays (Arora et al., 2004), tissue-specific regulatory regions that are important for developmental regulation in the whole animal have not been identified in the 5′ flanking region or intronic regions of the lamin A gene in any species. Our present data demonstrates that stable transgenic lines of the 2.99 kb lamin A promoter fragment as well as deletions of 1.67 kb, 1.52 kb and 1.41 kb can drive GFP expression in several tissues of the developing embryo, such as the head region, myotome, notochord, epidermis and heart. A 1.24 kb fragment also showed GFP expression in the embryonic myotome as well as other tissues, and also showed a significant 10-fold increase in activity compared to the 0.91 and 1.16 kb fragments in C2C12 myoblasts. The intervening segment of 86 bp which harbored a consensus binding site for MyoD (E box E5) was able to activate the heterologous SV40 promoter by 2-fold in myoblasts, whereas an overlapping sequence did not show an increase in activity in these

7

cells. Mutational analysis of three consensus muscle-specific regulatory motifs in the 1.67 kb fragment revealed that E5 was essential in the context of an intact E6 or E7 box in C2C12 myoblasts, which is consistent with the reported cooperative binding of MyoD at E boxes (Fong and Tapscott, 2013). Since the 1.24 kb fragment can drive GFP expression in other tissues in addition to the myotome, this region is likely to contain additional motifs that target expression in different tissues. We also cannot rule out the possibility of additional regulatory regions upstream of the 2.99 kb segment or in the intronic regions of the gene. Recent studies indicate that the lamins play an important role in neural development (Jung et al., 2012; Sehgal et al., 2013). Lamin C has been shown to be highly expressed in the mouse brain while levels of lamin A and prelamin A are low due to downregulation by a brainspecific microRNA (Jung et al., 2012). Our finding that lamin A promoter fragments are able to direct reporter expression to the head region of the embryo is interesting in light of this report on the complex regulation of A-type lamin expression in the mouse brain. Our results provide the first report of the characterization of a tissuespecific regulatory region of the lamin A promoter and its activity during

Fig. 6. Analysis of 86 bp putative muscle regulatory element. (A) Sequence of −1158/−1243 bp indicating consensus binding sites for various transcription factors. (B) Luciferase reporter assays in C2C12 myoblasts. (C) GFP expression driven by 1.24 and 0.91 kb fragments in myotome (M), epidermis (E), heart (H) and pericardium (P) in 2.5 dpf embryos. (D) Luciferase reporter assays of 1.67 kb promoter segment with single, double or triple mutations in E-boxes E5, E6 and E7. ** p b 0.01.


8


development. The minimal promoter of 1.24 kb that we have identified can drive reporter expression in the myotome and other embryonic tissues of zebrafish and harbors a novel 86 bp segment that can activate muscle-specific gene expression in cells. Acknowledgments We thank Bojja Sathish for technical assistance in maintenance of zebrafish. ADV was supported by a senior research fellowship from the Council of Scientific and Industrial Research, India. VKP is a recipient of the J C Bose national fellowship from the Department of Science and Technology, India. VKP acknowledges financial support from the Council of Scientific and Industrial Research network project BSC208 for this work. References Arora, P., Muralikrishna, Bh., Parnaik, V.K., 2004. Cell-type-specific interactions at regulatory motifs in the first intron of the lamin A gene. FEBS Lett. 568, 122–128. Balciunas, D., Wangensteen, K.J., Wilber, A., Bell, J., Geurts, A., Sivasubbu, S., Wang, X., Hackett, P.B., Largaespada, D.A., McIvor, R.S., Ekker, S.C., 2006. Harnessing a high cargo-capacity transposon for genetic applications in vertebrates. PLoS Genet. 2, e169. Benavente, R., Krohne, G., Franke, W.W., 1985. Cell type-specific expression of nuclear lamina proteins during development of Xenopus laevis. Cell 41, 177–190. Broers, J.L., Ramaekers, F.C., Bonne, G., Yaou, R.B., Hutchison, C.J., 2006. Nuclear lamins: laminopathies and their role in premature ageing. Physiol. Rev. 86, 967–1008. Butin-Israeli, V., Adam, S.A., Goldman, A.E., Goldman, R.D., 2012. Nuclear lamin functions and disease. Trends Genet. 28, 464–471. Constantinescu, D., Gray, H.L., Sammak, P.J., Schatten, G.P., Csoka, A.B., 2006. Lamin A/C expression is a marker of mouse and human embryonic stem cell differentiation. Stem Cells 24, 177–185. Dechat, T., Pfleghaar, K., Sengupta, K., Shimi, T., Shumaker, D.K., Solimando, L., Goldman, R.D., 2008. Nuclear lamins: major factors in the structural organization and function of the nucleus and chromatin. Genes Dev. 22, 832–853. Fisher, S., Grice, E.A., Vinton, R.M., Bessling, S.L., Urasaki, A., Kawakami, K., McCallion, A.S., 2006. Evaluating the biological relevance of putative enhancers using Tol2 transposon-mediated transgenesis in zebrafish. Nat. Protoc. 1, 1297–1305. Fong, A.P., Tapscott, S.J., 2013. Skeletal muscle programming and re-programming. Curr. Opin. Genet. Dev. 23, 568–573. Howe, K., Clark, M.D., Torroja, C.F., Torrance, J., Berthelot, C., Muffato, M., Collins, J.E., Humphray, S., McLaren, K., Matthews, L., et al., 2013. The zebrafish reference genome sequence and its relationship to the human genome. Nature 496, 498–503.

Jung, H.J., Coffinier, C., Choe, Y., Beigneux, A.P., Davies, B.S., Yang, S.H., Barnes II, R.H., Hong, J., Sun, T., Pleasure, S.J., et al., 2012. Regulation of prelamin A but not lamin C by miR9, a brain-specific microRNA. Proc. Natl. Acad. Sci. U. S. A. 109, 423–431. Koshimizu, E., Imamura, S., Qi, J., Toure, J., Valdez Jr., D.M., Carr, C.E., Hanai, J., Kishi, S., 2011. Embryonic senescence and laminopathies in a progeroid zebrafish model. PLoS One 6, e17688. Lin, F., Worman, H.J., 1993. Structural organization of the human gene encoding nuclear lamin A and nuclear lamin C. J. Biol. Chem. 268, 16321–16326. Muralikrishna, Bh., Parnaik, V.K., 2001. Sp3 and AP-1 mediate transcriptional activation of the lamin A proximal promoter. Eur. J. Biochem. 268, 3736–3743. Nakajima, N., Abe, K., 1995. Genomic structure of the mouse A-type lamin gene locus encoding somatic and germ cell-specific lamins. FEBS Lett. 365, 108–114. Okumura, K., Nakamachi, K., Hosoe, Y., Nakajima, N., 2000. Identification of a novel retinoic-acid-responsive element within the lamin A/C promoter. Biochem. Biophys. Res. Commun. 269, 197–202. Parnaik, V.K., 2008. Role of nuclear lamins in nuclear organization, cellular signaling and inherited diseases. Int. Rev. Cell Mol. Biol. 266, 157–206. Parnaik, V.K., Chaturvedi, P., Muralikrishna, Bh., 2011. Lamins, laminopathies and disease mechanisms: possible role for proteasomal degradation of key regulatory proteins. J. Biosci. 36, 471–479. Ramaiah, M.J., Parnaik, V.K., 2006. An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein. Biochem. Biophys. Res. Commun. 348, 1132–1137. Riemer, D., Stuurman, N., Berrios, M., Hunter, C., Fisher, P.A., Weber, K., 1995. Expression of Drosophila lamin C is developmentally regulated: analogies with vertebrate A-type lamins. J. Cell Sci. 108, 3189–3198. Röber, R.A., Weber, K., Osborn, M., 1989. Differential timing of nuclear lamin A/C expression in the various organs of the mouse embryo and the young animal: a developmental study. Development 105, 365–378. Sehgal, P., Chaturvedi, P., Kumaran, R.I., Kumar, S., Parnaik, V.K., 2013. Lamin A/C haploinsufficiency modulates the differentiation potential of mouse embryonic stem cells. PLoS One 8, e57891. Stewart, C., Burke, B., 1987. Teratocarcinoma stem cells and early mouse embryos contain only a single major lamin polypeptide closely resembling lamin B. Cell 51, 383–392. Tiwari, B., Muralikrishna, Bh., Parnaik, V.K., 1998. Functional analysis of the 5′ promoter region of the rat lamin A gene. DNA Cell Biol. 17, 957–965. Urasaki, A., Morvan, G., Kawakami, K., 2006. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics 174, 639–649. Westerfield, M., 2000. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio). 4th ed. University of Oregon Press, Eugene. Yaffe, D., Saxel, O., 1977. Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature 270, 725–727.


Multiple regulatory sites in the Bacillus subtilis citB promoter region.

Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

Characterization of the promoter region of the porcine opn (osteopontin, secreted phosphoprotein 1) gene. Identification of positive and negative regulatory elements and a 'silent' second promoter.

Regulatory elements in the promoter region of vgf, a nerve growth factor-inducible gene.

Local depletion of DNA methylation identifies a repressive p53 regulatory region in the NEK2 promoter.

Identification of the optic recess region as a morphogenetic entity in the zebrafish forebrain.

Identification of a novel ovine LH-beta promoter region, which dramatically enhances its promoter activity.

A 53 kDa protein binds to the negative regulatory region of JC virus early promoter.

Identification of a novel promoter in the replication control region of plasmid R6K.

Conserved regulatory elements in the promoter region of the N-CAM gene.

Identification of a gonadotropin-releasing hormone-responsive region in the glycoprotein hormone alpha-subunit promoter.

Dissection of the mouse N-ras gene upstream regulatory sequences and identification of the promoter and a negative regulatory element.

Global identification of the genetic networks and cis-regulatory elements of the cold response in zebrafish.

Identification of a G1-S-phase-regulated region in the human thymidine kinase gene promoter.

The Zymomonas mobilis glf, zwf, edd, and glk genes form an operon: localization of the promoter and identification of a conserved sequence in the regulatory region.

Identification of a polypeptide bound to the beta region of the mouse r protein L32 promoter.

Identification of a binding protein to the X gene promoter region of hepatitis B virus.

Identification of a region of the bacteriophage T3 and T7 RNA polymerases that determines promoter specificity.

Identification of functional haplotypes in the promoter region of the LST1 gene.

BioID Identification of Lamin-Associated Proteins.

C silencing in a subset of neuroblastoma cells.

Identification of a mutation in the promoter region of the dystrophin gene in a patient with atypical Becker muscular dystrophy.

Identification of the promoter region of the Escherichia coli major cold shock gene, cspA.

Identification of the promoter region of the ribosome-releasing factor cistron (frr).