Journal of Medical Virology 3754-57 (1992)
Infections of the Cervix Uteri With Human Papillomavirus and Chlamydia trachomatis Eric C.J. Claas, Willem J.G. Melchers, Hubert G.M. Niesters, Ruud van Muyden, Ernst Stolz, and Wim G.V. Quint Department of Virology, Erasmus University Rotterdam (E.C.J.C.); Department of Medical Microbiology, University Hospital Nijmegen, Nijmegen (W.J.G.M.); Department of Gynecology, R. de Graaf Hospital, Delft (R.V.M.); Department of Dermato-Venereology, University Hospital Rotterdam (E.S.); and Diagnostic Centre SSDZ, Department of Molecular Biology, Delft, The Netherlands (H.G.M.N., W.G.V.Q.) Apart from infection with human papillomavirus (HPV), other microorganisms may be involved in the development of cervical neoplasia. To study concomitant infections with HPV and Chlamydia trachomatis, cervical specimens from 4 groups of women were examined for the presence of these microorganisms by the polymerase chain reaction. The first group consisted of 143 consecutive samples from women with no cytological abnormalities w h o participated in a triennial screening program t o prevent cervical cancer. In this group 2 samples were found positive for HPV and 2 additional samples were found positive for C. trachomatis. In the second group of 46 cytologically abnormal smears, HPV DNA was detected in 71.7% of the samples and C. tra chomatis in 4.3%. In a third group of 94 histological abnormal biopsies, the HPV prevalence ranged from 15% i n mild dysplastic lesions up t o 92% in invasive cervical carcinomas. Only 2 biopsies of this group (2.1%) were found positive for C. trachornatis. Finally, a group of cervical scrapes was obtained from women attending a clinic for sexually transmitted diseases. In 52 samples positive for C. trachornatis and 60 samples negative for C.trachomatis, n o significant ( P = 0.57) difference in the frequency of HPV infections was found (11.5% and 8.3%. respectively). The data show that in these study groups HPV and C. trachomatis are independently occurring agents. 0 1992 Wiley-Liss, Inc.
KEY WORDS: CIN, HPV, PCR, sexually transmitted disease (STD)
INTRODUCTION The association between infection of the cervix uteri with particular human papillomavirus (HPV) types, predominantly HPV 16 and 18, and the development of cervical cancer has been established [Gissmann et al., 1986; Zur Hausen e t al., 19871. However, not every 0 1992 WILEY-LISS, INC.
HPV infected cervix was found to progress to malignancy [Campion e t al., 19861, and therefore, it is concluded that HPV is necessary but not sufficient for carcinogenesis in the cervix [Zur Hausen et al., 19891. Additional factors are required for malignant transformation. In patients with epidermodysplasia verruciformis, UV radiation from sunlight is found to be a cofactor of infection with HPV 5 and HPV 8 in the development of skin carcinomas LOrth, 19871. Hardly any epidemiological data a r e available concerning the cofactors in the development of cervical cancer. Factors such a s tobacco metabolites, hormonal contraceptives, or concomitant infections with other microorganisms are described a s possible candidates [Brinton et al., 1986a; Brinton e t al., 1986b; Melnick et al., 1974; Reeves et al., 19891. Infection with Chlamydia trachomatis is known to cause cervicitis, and a role in the development of cervical intraepithelial neoplasia has been suggested [Allerding e t al., 1985; Guaschino et al., 1988; Holmes, 19901. Recently, the polymerase chain reaction (PCR) has been introduced for the detection of HPV in cervical scrapes, and the association of HPV infection with cervical dysplasia was shown [Melchers et al., 19891. The diagnostic value of the PCR for the detection of infections with C . trachomatis has also been established and the PCR showed a n increased sensitivity with 100% specificity a s compared to cell culture LClaas et al., 19911. In the present study PCR is used to determine the prevalence of HPV and C. trachomatis simultaneously in clinical specimens of various population groups to examine whether there is a relation between infections with these 2 organisms.
Accepted for publication November 15, 1991. Address reprint requests to Eric C.J. Claas, Department of Virology, Erasmus University, P.O. Box 1738,3000 DR Rotterdam, The Netherlands.
HPV and Chlamydia Infections of the Cervix
55
MATERIAL AND METHODS Study Groups Cervical specimens from 4 different, dernographically and age-matched groups of women were used in this study. The first group of 143 cervical scrapes were consecutive samples of women involved in a triennial screening program to prevent cervical cancer in the Delft region of the Netherlands. These women had no cytological abnormalities of the cervix and no history of cervical lesions. The second group consisted of 46 cervical scrapes, which were obtained from women attending the outpatient clinic of the Department of Gynecology of Reinier de Graaf Hospital (Delft) and who had cytological abnormalities of the cervix. In both groups, a smear was made for routine cytological examination, which was classified according to the PAP classification. The remaining material and a n additional scrape were collected in 5-ml phosphate buffered saline (PBS), pH 7.5, and used for PCR assays. The third group consisted of 94 formalin-fixed, paraffin-embedded biopsies from women with cervical lesions, which were obtained from the pathological laboratory of Winschoten, the Netherlands. Tissue sections from the biopsies were histologically classified into grades of cervical intraepithelial neoplasia (CIN) or microinvasive carcinoma (MIC) according to the thickness of the epithelium involved in neoplasia. Additional tissue sections were analyzed by PCR as described previously [Claas et al., 19901. Finally, 112 cervical scrapes were obtained from women attending the outpatient clinic for sexually transmitted diseases (STD) of the University Hospital Rotterdam, the Netherlands. These clinical specimens were placed in 2 ml of transport medium, 0.5 ml of which were used for the PCR assays. Fifty-two samples positive for C . trachomatis and 60 negative samples, as determined by PCR and isolation in cell culture, were selected and used for the detection of HPV.
Sample Preparation of Cervical Scrapes The scrapes from the first and second group were vortexed vigorously and centrifuged at 2000 x g a t 4°C for 10 minutes. The pellet was resuspended in 1 ml PBS, and 0.5 ml were used for extraction of DNA. The 0.5-ml suspension from the fourth group was used completely for this purpose. DNA extraction was performed according to standard isolation methods [Sambrook et
al., 19891. The quality of the DNA was tested by amplification of the beta-globin gene [Melchers et al., 19891. Tissue sections were deparaffinized as described before [Claas et al., 19891 and were subsequently treated with 150 pg/ml proteinase K for 1hour. After inactivation of proteinase K, the sections were used directly for PCR analysis. Polymerase C h a in Reaction For one PCR, 100-250 ng of extracted DNA or a single tissue section was used. The target DNA was amplified in 40 cycles as described before [Melchers et al., 1989; Claas et al., 19901. Each cycle consisted of denaturation at 94°C for 1 minute, primer annealing a t 42°C for 2 minutes, and elongation at 72°C for 3 minutes. For HPV detection, primarily a general primer set was used that could detect a broad spectrum of genital HPV types [Snijders et al., 19901. Positive results were typed by oligonucleotide hybridization with specific probes for HPV types 6,11,16,18,31, and 33 (Table I). If a n amplified product was observed on the gel that did not hybridize with one of the probes, the sample was classified HPV X positive if Southern blot hybridization was observed under low stringency conditions with HPV-specific PCR products, labeled by random priming [Snijders et al., 19901. In addition, HPV positive results were confirmed by PCR using type-specific primers [Melchers et al., 19891. C . trachomatis was detected using 2 different primer sets [Claas et al., 19901. The first set of primers was directed against the endogenous plasmid of C . trachomatis and was species specific. The second set of primers was directed against the rRNA genes and was genus specific. All PCR products were analyzed by electrophoresis on 2% agarose with subsequent Southern blot hybridization with oligonucleotide probes, directed against internal sequences of the amplified products. In every experiment, water and human spleen DNA were used as negative controls.
Statistical Analysis The results were analyzed statistically using the SPSS/PC+ program (Microsoft, USA). The significance of the results was deducted from the Chi-square calculation, and results were considered significant if P < 0.05.
TABLE I. Sequences of the Oligonucleotide Probes for Detection of HPV 6, 11, 16, 18,31, and 33 Specific Amplified Products, Generated by General Primer-Mediated PCR HPV type Nucl. Sequence 6 11 16 18 31 33
6814-6843 6799-6828 6674-6703 6650-6679 6582-6611 6621-6650
ATCCGTAACTACATCTTCCACATACACCAA ATCTGTGTCTAAATCTGCTACATACACTAA TGCCATATCTACTTCAGAAACTACATATAA TTCTACACAGTCTCCTGTACCTGGGCAATA CTGTTTGTGCTGCAATTGCAAACAGTGATA CTTTATGCACACAAGTAACTAGTGACAGTA
Claas et al.
56
TABLE 11. Presence of HPV and C. trachomatis in Scrapes from Women with a Cytological Abnormal Smear (PAP IIIA or Higher) n = 46 Chlamydia HPV Total
+
6 11 16 18 31 33 16/18 18/31
1
18 I
33 (71.7%) 1
-
Total
2
2 (4.3Yo)
13
13
44
46
RESULTS An indication of the prevalence of HPV and C. trachomatis in women with cytologically normal smears was obtained from a group of women who voluntarily entered a screening program. In this control group of 143 samples, 2 HPV positive scrapes were found (HPV 16 and HPV XI. Two additional scrapes were found positive for C . trachomatis; thus for both organisms the prevalence rate was 1.4%. In the second group of 46 samples with a cytological classification of PAP IIIA or higher, 33 samples (71.7%) were found positive for HPV. Only 2 samples were positive for C . trachomatis (Table 11). Similar results were obtained with the third group of cervical biopsies (Table 111).In these biopsies the HPV prevalence increased with the severity of the lesion, from 15% in CINl lesions up to 92% in microinvasive carcinomas. However, in only 2 cases (2.1%) was C. trachomatis detected. In the fourth group of women attending a n STD clinic, 9.8% of the specimens were found positive for HPV DNA. The 52 specimens positive for C. trachomatis and the 60 samples negative for C . trachomatis contained 11.5% and 8.3% HPV DNA positivity, respectively (Table IV). DISCUSSION During the last decade much attention has been focused on Chlamydia trachomatis and human papillomavirus (HPV) as microorganisms causing lesions of the genital tract. C. trachomatis is known to cause several lesions of the female genital tract, such as cervicitis, endometritis, and salpingitis [Stamm et al., 19901. The asymptomatic character of part of the infections with C. trachomatis has made these infections the most prevalent sexually transmitted disease in the western world and one of the major causes in female infertility [Stamm et al., 19901. Epidemiological data support the hypothesis that HPV-induced lesions also are sexually transmitted. Early age of first intercourse, multiple sexual partners, and HPV-infected partners are risk factors for the development of cervical cancer [Aral et al., 19901. The viral etiology of cervical cancer has been
established, but apart from infection with HPV, other factors must be involved in the carcinogenesis [Zur Hausen, 19891. Infections with other microorganisms, such as herpes simplex virus type 2 or C. trachomatis, are described a s possible cofactors [Schachter et al., 1982; DiLuca et al., 19871. Cytological and serological findings have associated cervical intraepithelial neoplasia with infection with C. trachomatis [Allerding et al., 1985; Guaschino e t al., 19881.Therefore, a synergistic process between HPV and C. trachomatis in the pathogenesis of cervical cancer could be suggested. To study this relationship, Syrjanen et al. [1986, 19871 investigated a large number of women for simultaneous infection with C. trachomatis and HPV. They were unable to find a relation between these two microorganisms, but the presence of C. trachomatis genomes was not excluded by their studies. In our study, the polymerase chain reaction, the most sensitive assay available at the moment, was used to detect coexistent HPV and C. trachomatis genomes in cervical samples from women with no cytological abnormalities of the cervix, women with dysplastic cervical lesions, and women attending a n STD clinic. The prevalence rate of HPV ranged from 1.4% in scrapes from women with no cytological abnormalities, to 92% in biopsies from women with cervical carcinomas. No relationship was observed between infection with HPV and infection with Chlamydia. C . trachomatis infections were detected in 1.4% of the control group. Thirty-three out of 46 samples (71.7%) from women with cytologically abnormal smears were found positive for HPV. Only 2 out of these 46 scrapes contained C. trachomatis. The frequency of infection with C. trachomatis was not significantly higher in this group a s compared to the control group (P = 0.22). Also in histologically abnormal biopsies, in which HPV prevalence increased with a higher degree of CIN, in only 2 out of 94 biopsies chlamydia1 DNA was detected (P = 0.65). No significant increase in C. trachomatis positivity was observed with a higher degree of CIN. In addition, no significant increase of the HPV positivity was observed in scrapes positive for C. trachomatis from women attending a n STD clinic in comparison with scrapes negative for C. trachomatis from this group. HPV DNA was detected in 11.5% and 8.3%,respectively, of the scrapes ( P = 0.57). The overall HPV percentage in this fourth group was significantly higher th a n in the control group of women without cytological abnormalities of the cervix: 9.8% vs. 1.4% (P = 0.0024). This supports the sexually transmitted character of HPV. It can be concluded th a t both HPV and C. trachomatis may cause cervical lesions, but no direct relation between infections with these microorganisms was observed. However, the possibility of a n STD as a risk factor for another STD has been suggested for several agents [Aral e t al., 19901. From the data in this study, such a relation cannot be excluded. It is possible that a former infection with C. trachomatis makes the cervix more susceptible to infection with HPV. HPV and C. trachomatis should be considered as independently occurring sexually transmitted agents, which can both affect the cervix uteri. However, epidemiolog-
HPV and Chlamydia Infections of the Cervix
57
TABLE 111. Presence of HPV and C. trachomatis in Histologically Abnormal, Paraffin-Embedded Biopsies of the Cervix Histologya
(4
-
MIC (12) CIN3 (44) CINP (25) CINl (13)
1 11 12 11
6/11 2
16 10 23 7 2
HPV
18 1 5 3
31
33
X
3 1
2
Chlamydia %POS
92 75 52 15
+
lb
lC
aMIC = microinvasive carcinoma; GIN = cervical intraepithelial neoplasia (grades 3,2, a n d 1). bThe GIN3 lesion positive for C. trachomatis was also positive for HPV 16. cThe CIN2 lesion positive for C. trachomatis was negative for HPV.
TABLE IV. Presence of HPV and C. trachomatis in Cervical Scrapes from Women Attending an STD Clinic Chlamydia
+
(n = 52) - (n = 60) Total (n = 112)
-
46
55 101
6/11 2 1
HPV 16 18 2 3 11
1
31
X
%pos.
1
11.5 8.3 9.8
1
ical studies should reveal whether a C . trachornatis infection should be considered as a risk factor for infection of the cervix with HPV.
ACKNOWLEDGMENTS This work was supported by the “Praeventiefonds,” the Netherlands, grant 28-1502. We thank Marion de Bruin for technical assistance, Marc Sprenger for the statistical analysis, and J a n Lindeman for his useful comments.
REFERENCES Allerding TJ, Jordan SW, Boardman RE (1985):Association of human papillomavirus and Chlamydia infections with incidence cervical neoplasia. Acta Cytologica 29653-660. Aral SO, Holmes KK (1990): Epidemiology of sexual behavior and sexually transmitted diseases. In Holmes KK, Mlrdh PA, Sparling PA, Wiesner PJ, Gates W, Lemon SM, Stamm WE (eds): “Sexually Transmitted Diseases, 2nd ed.” New York: McGraw-Hill, pp 1936. Brinton LA, Schairer C, Haenszel W, Stolley P, Lehman HF, Levine R, Savitz DA (1986a): Cigarette smoking and invasive cervical cancer. JAMA 22532653269. Brinton LA, Huggins GR, Lehman HF, Mallin K, Savitz DA, Trapido E, Rosenthal J , Hoover R (1986b):Long-term use of oral contraceptives and risk of invasive cervical cancer. International Journal of Cancer 38399404. Campion MJ, McCance DJ, Cuzick J, Singer A (1986): Progressive potential of mild cervical atypica: prospective cytological, colposcopic, and virological study. Lancet 2:237-240. Claas ECJ, Melchers WJG, Van der Linden HC, Lindeman J, Quint WGV (1989):Human papillomavirus detection in parafin embedded cervical carcinomas and metastases of the carcinomas bv the polymerase chain reaction. American Journal of Pathology 135703-709. Claas HCJ, Melchers WJG, De Bruijn IH, De Graaf M, Van Dijk WC, Lindeman J , Quint WGV (1990): Detection of Chlamydia trachomatis infections in clinical specimens by the polymerase chain reaction. European Journal of Clinical Microbiology and Infectious Diseases 9:864-868. Claas HCJ, Wagenvoort JHT, Niesters HGM, Tio TT,Van RijsoortVos JH, Quint WGV (1991): Diagnostic value of the polymerase
chain reaction for Chlamydia detection as determined in a follow up study. Journal of Clinical Microbiology 29:42-45. Di Luca D, Rotola A, Pilotti S, Monini P, Caselli E, Rilke F, Cassai E (1987):Simultaneous presence of herpes simplex and human papillomavirus sequences in human genital tumors. InternationalJournal of Cancer 40:763-768. Gissmann L, Schneider A (1986):The role of human papillomaviruses in genital cancer. In De Palo G, Rilke F, Zur Hausen H (eds): “Herpes and Papilloma Viruses.” New York: Serono Symposia Publications 31, Raven Press, pp 15-24. Guaschino S, Stola E, Spinillo A (1988): Chlamydia truchomtis and cervical intraepithelial neoplasia. Clinical and Experimental Obstetrics and Gynaecology 15:9%101. Holmes KK (1990):Lower genital tract infections in women: cystitis, urethritis, vulvovaginitis, and cervicitis. In Holmes KK, Mlrdh PA, Sparling PF, Wiesner PJ, Gates W, Lemon SM, Stamm WE (eds): “Sexually Transmitted Diseases, 2nd ed.” New York: McGraw-Hill, pp 527-545. Melchers W, Van den Brule A, Walboomers J , De Bruin M, Burger M, Herbrink P, Meijer C, Lindeman J, Quint W (1989): Increased detection rate of human papillomavirus in cervical scrapes by the polymerase chain reaction as compared to modified FISH and Southern blot analysis. Journal of Medical Virology 27:329-335. Melnick JL, Adam E, Rawls WE (1974):The causative role of herpesvirus type 2 in cervical cancer. Cancer 34:1375-1385. Orth G (1987): Epidermodysplasia verruciformis. In Salzman NP, Howley PM (eds): “The Papovaviridae, Vol. 2. The Papillomaviruses.” New York: Plenum Press, pp 199-243. Reeves WC, Rawls WE, Brinton LA (1989): Epidemiology of genital papillomavirus and cervical cancer. Reviews of Infectious Diseases 11:426-439. Sambrook J, Fritsch EF, Maniatis T (1989): “Molecular Cloning. A Laboratory Manual.” Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Schachter J, Hill EC, King EB, Heilbron DC, Ray RM, Margolis AJ, Greenwood SA (1982):Chlamydia trachomatis and cervical neoplasia. JAMA 248:2134-2138. Snijders PJF, Van den Brule A, Schrijnemakers HFJ, Snow G, Meijer CJLM, Valboomers JMM (1990):The use of general primers in the polymerase chain reaction permits the detection of a broad spectrum of human papillomavirus genotypes. Journal of General Virology 71:173-178. Stamm WE, Holmes KK (1990): Chlamydia trachomatis infections in the adult. In Holmes KK, Mlrdh PA, Sparling PA, Wiesner PJ, Gates W, Lemon SM, Stamm WE (eds): “Sexually Transmitted Diseases, 2nd ed.” New York: McGraw-Hill, pp 181-194. Syrjanen K, Mantyjarvi R, Vayrynen M, Parkkinen S, Holopainen H, Syrjajen S, Saarikoski S, Castren 0 (1986):Coexistent chlamydia1 infections related to the natural history of human papillomavirus lesions in the uterine cervix. Genitourinary Medicine 62:345-351. Syrjanen K, Mantyjarvi R, Vayrynen M, Syrjanen S, Parkkinen S, Yliskoski M, Saarikoski S, Castren 0 (1987):Human papillomavirus (HPV) infection involved in the neoplastic process of the uterine cervix as established by prospective follow up of 513 women for two years. European Journal of Gynaecology and Oncology 85-16, Zur Hausen H (1987): Papillomaviruses in human cancer. Cancer 59:1692-1696. Zur Hausen H (1989): Papillomaviruses in anogenital cancer as a model to understand the role of viruses in human cancer. Cancer Research 49:46774681.
Infections of the Cervix Uteri With Human Papillomavirus and Chlamydia trachomatis Eric C.J. Claas, Willem J.G. Melchers, Hubert G.M. Niesters, Ruud van Muyden, Ernst Stolz, and Wim G.V. Quint Department of Virology, Erasmus University Rotterdam (E.C.J.C.); Department of Medical Microbiology, University Hospital Nijmegen, Nijmegen (W.J.G.M.); Department of Gynecology, R. de Graaf Hospital, Delft (R.V.M.); Department of Dermato-Venereology, University Hospital Rotterdam (E.S.); and Diagnostic Centre SSDZ, Department of Molecular Biology, Delft, The Netherlands (H.G.M.N., W.G.V.Q.) Apart from infection with human papillomavirus (HPV), other microorganisms may be involved in the development of cervical neoplasia. To study concomitant infections with HPV and Chlamydia trachomatis, cervical specimens from 4 groups of women were examined for the presence of these microorganisms by the polymerase chain reaction. The first group consisted of 143 consecutive samples from women with no cytological abnormalities w h o participated in a triennial screening program t o prevent cervical cancer. In this group 2 samples were found positive for HPV and 2 additional samples were found positive for C. trachomatis. In the second group of 46 cytologically abnormal smears, HPV DNA was detected in 71.7% of the samples and C. tra chomatis in 4.3%. In a third group of 94 histological abnormal biopsies, the HPV prevalence ranged from 15% i n mild dysplastic lesions up t o 92% in invasive cervical carcinomas. Only 2 biopsies of this group (2.1%) were found positive for C. trachornatis. Finally, a group of cervical scrapes was obtained from women attending a clinic for sexually transmitted diseases. In 52 samples positive for C. trachornatis and 60 samples negative for C.trachomatis, n o significant ( P = 0.57) difference in the frequency of HPV infections was found (11.5% and 8.3%. respectively). The data show that in these study groups HPV and C. trachomatis are independently occurring agents. 0 1992 Wiley-Liss, Inc.
KEY WORDS: CIN, HPV, PCR, sexually transmitted disease (STD)
INTRODUCTION The association between infection of the cervix uteri with particular human papillomavirus (HPV) types, predominantly HPV 16 and 18, and the development of cervical cancer has been established [Gissmann et al., 1986; Zur Hausen e t al., 19871. However, not every 0 1992 WILEY-LISS, INC.
HPV infected cervix was found to progress to malignancy [Campion e t al., 19861, and therefore, it is concluded that HPV is necessary but not sufficient for carcinogenesis in the cervix [Zur Hausen et al., 19891. Additional factors are required for malignant transformation. In patients with epidermodysplasia verruciformis, UV radiation from sunlight is found to be a cofactor of infection with HPV 5 and HPV 8 in the development of skin carcinomas LOrth, 19871. Hardly any epidemiological data a r e available concerning the cofactors in the development of cervical cancer. Factors such a s tobacco metabolites, hormonal contraceptives, or concomitant infections with other microorganisms are described a s possible candidates [Brinton et al., 1986a; Brinton e t al., 1986b; Melnick et al., 1974; Reeves et al., 19891. Infection with Chlamydia trachomatis is known to cause cervicitis, and a role in the development of cervical intraepithelial neoplasia has been suggested [Allerding e t al., 1985; Guaschino et al., 1988; Holmes, 19901. Recently, the polymerase chain reaction (PCR) has been introduced for the detection of HPV in cervical scrapes, and the association of HPV infection with cervical dysplasia was shown [Melchers et al., 19891. The diagnostic value of the PCR for the detection of infections with C . trachomatis has also been established and the PCR showed a n increased sensitivity with 100% specificity a s compared to cell culture LClaas et al., 19911. In the present study PCR is used to determine the prevalence of HPV and C. trachomatis simultaneously in clinical specimens of various population groups to examine whether there is a relation between infections with these 2 organisms.
Accepted for publication November 15, 1991. Address reprint requests to Eric C.J. Claas, Department of Virology, Erasmus University, P.O. Box 1738,3000 DR Rotterdam, The Netherlands.
HPV and Chlamydia Infections of the Cervix
55
MATERIAL AND METHODS Study Groups Cervical specimens from 4 different, dernographically and age-matched groups of women were used in this study. The first group of 143 cervical scrapes were consecutive samples of women involved in a triennial screening program to prevent cervical cancer in the Delft region of the Netherlands. These women had no cytological abnormalities of the cervix and no history of cervical lesions. The second group consisted of 46 cervical scrapes, which were obtained from women attending the outpatient clinic of the Department of Gynecology of Reinier de Graaf Hospital (Delft) and who had cytological abnormalities of the cervix. In both groups, a smear was made for routine cytological examination, which was classified according to the PAP classification. The remaining material and a n additional scrape were collected in 5-ml phosphate buffered saline (PBS), pH 7.5, and used for PCR assays. The third group consisted of 94 formalin-fixed, paraffin-embedded biopsies from women with cervical lesions, which were obtained from the pathological laboratory of Winschoten, the Netherlands. Tissue sections from the biopsies were histologically classified into grades of cervical intraepithelial neoplasia (CIN) or microinvasive carcinoma (MIC) according to the thickness of the epithelium involved in neoplasia. Additional tissue sections were analyzed by PCR as described previously [Claas et al., 19901. Finally, 112 cervical scrapes were obtained from women attending the outpatient clinic for sexually transmitted diseases (STD) of the University Hospital Rotterdam, the Netherlands. These clinical specimens were placed in 2 ml of transport medium, 0.5 ml of which were used for the PCR assays. Fifty-two samples positive for C . trachomatis and 60 negative samples, as determined by PCR and isolation in cell culture, were selected and used for the detection of HPV.
Sample Preparation of Cervical Scrapes The scrapes from the first and second group were vortexed vigorously and centrifuged at 2000 x g a t 4°C for 10 minutes. The pellet was resuspended in 1 ml PBS, and 0.5 ml were used for extraction of DNA. The 0.5-ml suspension from the fourth group was used completely for this purpose. DNA extraction was performed according to standard isolation methods [Sambrook et
al., 19891. The quality of the DNA was tested by amplification of the beta-globin gene [Melchers et al., 19891. Tissue sections were deparaffinized as described before [Claas et al., 19891 and were subsequently treated with 150 pg/ml proteinase K for 1hour. After inactivation of proteinase K, the sections were used directly for PCR analysis. Polymerase C h a in Reaction For one PCR, 100-250 ng of extracted DNA or a single tissue section was used. The target DNA was amplified in 40 cycles as described before [Melchers et al., 1989; Claas et al., 19901. Each cycle consisted of denaturation at 94°C for 1 minute, primer annealing a t 42°C for 2 minutes, and elongation at 72°C for 3 minutes. For HPV detection, primarily a general primer set was used that could detect a broad spectrum of genital HPV types [Snijders et al., 19901. Positive results were typed by oligonucleotide hybridization with specific probes for HPV types 6,11,16,18,31, and 33 (Table I). If a n amplified product was observed on the gel that did not hybridize with one of the probes, the sample was classified HPV X positive if Southern blot hybridization was observed under low stringency conditions with HPV-specific PCR products, labeled by random priming [Snijders et al., 19901. In addition, HPV positive results were confirmed by PCR using type-specific primers [Melchers et al., 19891. C . trachomatis was detected using 2 different primer sets [Claas et al., 19901. The first set of primers was directed against the endogenous plasmid of C . trachomatis and was species specific. The second set of primers was directed against the rRNA genes and was genus specific. All PCR products were analyzed by electrophoresis on 2% agarose with subsequent Southern blot hybridization with oligonucleotide probes, directed against internal sequences of the amplified products. In every experiment, water and human spleen DNA were used as negative controls.
Statistical Analysis The results were analyzed statistically using the SPSS/PC+ program (Microsoft, USA). The significance of the results was deducted from the Chi-square calculation, and results were considered significant if P < 0.05.
TABLE I. Sequences of the Oligonucleotide Probes for Detection of HPV 6, 11, 16, 18,31, and 33 Specific Amplified Products, Generated by General Primer-Mediated PCR HPV type Nucl. Sequence 6 11 16 18 31 33
6814-6843 6799-6828 6674-6703 6650-6679 6582-6611 6621-6650
ATCCGTAACTACATCTTCCACATACACCAA ATCTGTGTCTAAATCTGCTACATACACTAA TGCCATATCTACTTCAGAAACTACATATAA TTCTACACAGTCTCCTGTACCTGGGCAATA CTGTTTGTGCTGCAATTGCAAACAGTGATA CTTTATGCACACAAGTAACTAGTGACAGTA
Claas et al.
56
TABLE 11. Presence of HPV and C. trachomatis in Scrapes from Women with a Cytological Abnormal Smear (PAP IIIA or Higher) n = 46 Chlamydia HPV Total
+
6 11 16 18 31 33 16/18 18/31
1
18 I
33 (71.7%) 1
-
Total
2
2 (4.3Yo)
13
13
44
46
RESULTS An indication of the prevalence of HPV and C. trachomatis in women with cytologically normal smears was obtained from a group of women who voluntarily entered a screening program. In this control group of 143 samples, 2 HPV positive scrapes were found (HPV 16 and HPV XI. Two additional scrapes were found positive for C . trachomatis; thus for both organisms the prevalence rate was 1.4%. In the second group of 46 samples with a cytological classification of PAP IIIA or higher, 33 samples (71.7%) were found positive for HPV. Only 2 samples were positive for C . trachomatis (Table 11). Similar results were obtained with the third group of cervical biopsies (Table 111).In these biopsies the HPV prevalence increased with the severity of the lesion, from 15% in CINl lesions up to 92% in microinvasive carcinomas. However, in only 2 cases (2.1%) was C. trachomatis detected. In the fourth group of women attending a n STD clinic, 9.8% of the specimens were found positive for HPV DNA. The 52 specimens positive for C. trachomatis and the 60 samples negative for C . trachomatis contained 11.5% and 8.3% HPV DNA positivity, respectively (Table IV). DISCUSSION During the last decade much attention has been focused on Chlamydia trachomatis and human papillomavirus (HPV) as microorganisms causing lesions of the genital tract. C. trachomatis is known to cause several lesions of the female genital tract, such as cervicitis, endometritis, and salpingitis [Stamm et al., 19901. The asymptomatic character of part of the infections with C. trachomatis has made these infections the most prevalent sexually transmitted disease in the western world and one of the major causes in female infertility [Stamm et al., 19901. Epidemiological data support the hypothesis that HPV-induced lesions also are sexually transmitted. Early age of first intercourse, multiple sexual partners, and HPV-infected partners are risk factors for the development of cervical cancer [Aral et al., 19901. The viral etiology of cervical cancer has been
established, but apart from infection with HPV, other factors must be involved in the carcinogenesis [Zur Hausen, 19891. Infections with other microorganisms, such as herpes simplex virus type 2 or C. trachomatis, are described a s possible cofactors [Schachter et al., 1982; DiLuca et al., 19871. Cytological and serological findings have associated cervical intraepithelial neoplasia with infection with C. trachomatis [Allerding et al., 1985; Guaschino e t al., 19881.Therefore, a synergistic process between HPV and C. trachomatis in the pathogenesis of cervical cancer could be suggested. To study this relationship, Syrjanen et al. [1986, 19871 investigated a large number of women for simultaneous infection with C. trachomatis and HPV. They were unable to find a relation between these two microorganisms, but the presence of C. trachomatis genomes was not excluded by their studies. In our study, the polymerase chain reaction, the most sensitive assay available at the moment, was used to detect coexistent HPV and C. trachomatis genomes in cervical samples from women with no cytological abnormalities of the cervix, women with dysplastic cervical lesions, and women attending a n STD clinic. The prevalence rate of HPV ranged from 1.4% in scrapes from women with no cytological abnormalities, to 92% in biopsies from women with cervical carcinomas. No relationship was observed between infection with HPV and infection with Chlamydia. C . trachomatis infections were detected in 1.4% of the control group. Thirty-three out of 46 samples (71.7%) from women with cytologically abnormal smears were found positive for HPV. Only 2 out of these 46 scrapes contained C. trachomatis. The frequency of infection with C. trachomatis was not significantly higher in this group a s compared to the control group (P = 0.22). Also in histologically abnormal biopsies, in which HPV prevalence increased with a higher degree of CIN, in only 2 out of 94 biopsies chlamydia1 DNA was detected (P = 0.65). No significant increase in C. trachomatis positivity was observed with a higher degree of CIN. In addition, no significant increase of the HPV positivity was observed in scrapes positive for C. trachomatis from women attending a n STD clinic in comparison with scrapes negative for C. trachomatis from this group. HPV DNA was detected in 11.5% and 8.3%,respectively, of the scrapes ( P = 0.57). The overall HPV percentage in this fourth group was significantly higher th a n in the control group of women without cytological abnormalities of the cervix: 9.8% vs. 1.4% (P = 0.0024). This supports the sexually transmitted character of HPV. It can be concluded th a t both HPV and C. trachomatis may cause cervical lesions, but no direct relation between infections with these microorganisms was observed. However, the possibility of a n STD as a risk factor for another STD has been suggested for several agents [Aral e t al., 19901. From the data in this study, such a relation cannot be excluded. It is possible that a former infection with C. trachomatis makes the cervix more susceptible to infection with HPV. HPV and C. trachomatis should be considered as independently occurring sexually transmitted agents, which can both affect the cervix uteri. However, epidemiolog-
HPV and Chlamydia Infections of the Cervix
57
TABLE 111. Presence of HPV and C. trachomatis in Histologically Abnormal, Paraffin-Embedded Biopsies of the Cervix Histologya
(4
-
MIC (12) CIN3 (44) CINP (25) CINl (13)
1 11 12 11
6/11 2
16 10 23 7 2
HPV
18 1 5 3
31
33
X
3 1
2
Chlamydia %POS
92 75 52 15
+
lb
lC
aMIC = microinvasive carcinoma; GIN = cervical intraepithelial neoplasia (grades 3,2, a n d 1). bThe GIN3 lesion positive for C. trachomatis was also positive for HPV 16. cThe CIN2 lesion positive for C. trachomatis was negative for HPV.
TABLE IV. Presence of HPV and C. trachomatis in Cervical Scrapes from Women Attending an STD Clinic Chlamydia
+
(n = 52) - (n = 60) Total (n = 112)
-
46
55 101
6/11 2 1
HPV 16 18 2 3 11
1
31
X
%pos.
1
11.5 8.3 9.8
1
ical studies should reveal whether a C . trachornatis infection should be considered as a risk factor for infection of the cervix with HPV.
ACKNOWLEDGMENTS This work was supported by the “Praeventiefonds,” the Netherlands, grant 28-1502. We thank Marion de Bruin for technical assistance, Marc Sprenger for the statistical analysis, and J a n Lindeman for his useful comments.
REFERENCES Allerding TJ, Jordan SW, Boardman RE (1985):Association of human papillomavirus and Chlamydia infections with incidence cervical neoplasia. Acta Cytologica 29653-660. Aral SO, Holmes KK (1990): Epidemiology of sexual behavior and sexually transmitted diseases. In Holmes KK, Mlrdh PA, Sparling PA, Wiesner PJ, Gates W, Lemon SM, Stamm WE (eds): “Sexually Transmitted Diseases, 2nd ed.” New York: McGraw-Hill, pp 1936. Brinton LA, Schairer C, Haenszel W, Stolley P, Lehman HF, Levine R, Savitz DA (1986a): Cigarette smoking and invasive cervical cancer. JAMA 22532653269. Brinton LA, Huggins GR, Lehman HF, Mallin K, Savitz DA, Trapido E, Rosenthal J , Hoover R (1986b):Long-term use of oral contraceptives and risk of invasive cervical cancer. International Journal of Cancer 38399404. Campion MJ, McCance DJ, Cuzick J, Singer A (1986): Progressive potential of mild cervical atypica: prospective cytological, colposcopic, and virological study. Lancet 2:237-240. Claas ECJ, Melchers WJG, Van der Linden HC, Lindeman J, Quint WGV (1989):Human papillomavirus detection in parafin embedded cervical carcinomas and metastases of the carcinomas bv the polymerase chain reaction. American Journal of Pathology 135703-709. Claas HCJ, Melchers WJG, De Bruijn IH, De Graaf M, Van Dijk WC, Lindeman J , Quint WGV (1990): Detection of Chlamydia trachomatis infections in clinical specimens by the polymerase chain reaction. European Journal of Clinical Microbiology and Infectious Diseases 9:864-868. Claas HCJ, Wagenvoort JHT, Niesters HGM, Tio TT,Van RijsoortVos JH, Quint WGV (1991): Diagnostic value of the polymerase
chain reaction for Chlamydia detection as determined in a follow up study. Journal of Clinical Microbiology 29:42-45. Di Luca D, Rotola A, Pilotti S, Monini P, Caselli E, Rilke F, Cassai E (1987):Simultaneous presence of herpes simplex and human papillomavirus sequences in human genital tumors. InternationalJournal of Cancer 40:763-768. Gissmann L, Schneider A (1986):The role of human papillomaviruses in genital cancer. In De Palo G, Rilke F, Zur Hausen H (eds): “Herpes and Papilloma Viruses.” New York: Serono Symposia Publications 31, Raven Press, pp 15-24. Guaschino S, Stola E, Spinillo A (1988): Chlamydia truchomtis and cervical intraepithelial neoplasia. Clinical and Experimental Obstetrics and Gynaecology 15:9%101. Holmes KK (1990):Lower genital tract infections in women: cystitis, urethritis, vulvovaginitis, and cervicitis. In Holmes KK, Mlrdh PA, Sparling PF, Wiesner PJ, Gates W, Lemon SM, Stamm WE (eds): “Sexually Transmitted Diseases, 2nd ed.” New York: McGraw-Hill, pp 527-545. Melchers W, Van den Brule A, Walboomers J , De Bruin M, Burger M, Herbrink P, Meijer C, Lindeman J, Quint W (1989): Increased detection rate of human papillomavirus in cervical scrapes by the polymerase chain reaction as compared to modified FISH and Southern blot analysis. Journal of Medical Virology 27:329-335. Melnick JL, Adam E, Rawls WE (1974):The causative role of herpesvirus type 2 in cervical cancer. Cancer 34:1375-1385. Orth G (1987): Epidermodysplasia verruciformis. In Salzman NP, Howley PM (eds): “The Papovaviridae, Vol. 2. The Papillomaviruses.” New York: Plenum Press, pp 199-243. Reeves WC, Rawls WE, Brinton LA (1989): Epidemiology of genital papillomavirus and cervical cancer. Reviews of Infectious Diseases 11:426-439. Sambrook J, Fritsch EF, Maniatis T (1989): “Molecular Cloning. A Laboratory Manual.” Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Schachter J, Hill EC, King EB, Heilbron DC, Ray RM, Margolis AJ, Greenwood SA (1982):Chlamydia trachomatis and cervical neoplasia. JAMA 248:2134-2138. Snijders PJF, Van den Brule A, Schrijnemakers HFJ, Snow G, Meijer CJLM, Valboomers JMM (1990):The use of general primers in the polymerase chain reaction permits the detection of a broad spectrum of human papillomavirus genotypes. Journal of General Virology 71:173-178. Stamm WE, Holmes KK (1990): Chlamydia trachomatis infections in the adult. In Holmes KK, Mlrdh PA, Sparling PA, Wiesner PJ, Gates W, Lemon SM, Stamm WE (eds): “Sexually Transmitted Diseases, 2nd ed.” New York: McGraw-Hill, pp 181-194. Syrjanen K, Mantyjarvi R, Vayrynen M, Parkkinen S, Holopainen H, Syrjajen S, Saarikoski S, Castren 0 (1986):Coexistent chlamydia1 infections related to the natural history of human papillomavirus lesions in the uterine cervix. Genitourinary Medicine 62:345-351. Syrjanen K, Mantyjarvi R, Vayrynen M, Syrjanen S, Parkkinen S, Yliskoski M, Saarikoski S, Castren 0 (1987):Human papillomavirus (HPV) infection involved in the neoplastic process of the uterine cervix as established by prospective follow up of 513 women for two years. European Journal of Gynaecology and Oncology 85-16, Zur Hausen H (1987): Papillomaviruses in human cancer. Cancer 59:1692-1696. Zur Hausen H (1989): Papillomaviruses in anogenital cancer as a model to understand the role of viruses in human cancer. Cancer Research 49:46774681.
