Proc. Nati. Acad. Sci. USA Vol. 76, No. 10, pp. 5090-5094, October 1979 Biochemistry
Interaction site of Escherichia coli cyclic AMP receptor protein on DNA of galactose operon promoters (protein-DNA interactions/DNase protection/methylation protection)
TAKETOSHI TANIGUCHI*t, MICHAEL O'NEILLt, AND BENOIT DE CROMBRUGGHE*§ *Laboratory of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20205; and tDepartment of Biological Sciences, University of Maryland, Baltimore County, Catonsville, Maryland 21228
Communicated by Philip Leder, July 31, 1979
ABSTRACT Cyclic AMP (cAMP) and its receptor protein (CRP) have a dual role in the regulation of the two promoters that control the galactose (gal) operon of Escherichia coli. One promoter, P1, requires cAMP-CRP for activity; the other, P2, is inhibited by these factors. We have examined the interaction site of cAMP'CRP on gal DNA by using two types of protection experiments, involving DNase digestion and methylation by dimethyl sulfate. Our results indicate that cAMP-CRP binds to gal DNA in a segment located between 50 and 24 base pairs preceding the P1 start point for transcription. Although the location of the cAMP-CRP interaction site is clearly different in gal and lac DNA, comparison of the DNA sequences suggests a similar recognition sequence. The location of the cAMPCRP-binding site in gal further suggests that protein-protein interactions between RNA polymerase and cAMP-CRP play an important role in transcription initiation at the gal and possibly other cAMP-dependent promoters. Bacterial or bacteriophage promoters can be subdivided into two groups. In one class of promoters the DNA sequence contains all the necessary information for the binding of RNA polymerase and the formation of a stable complex for productive initiation of transcription. In other promoters the sequence information and hence the DNA structure is insufficient by itself to allow such stable complexes to be formed in the absence of additional protein factors. Cyclic AMP-dependent promoters fall in this second category. The additional information and interactions needed for the formation of a stable complex between RNA polymerase and DNA are provided by the cyclic AMP (cAMP)-cyclic AMP receptor (CRP) complex and the CRP binding site on the DNA. The role of cAMP.CRP in the regulation of the galactose (gal) operon of Escherichia coli is complex because this operon is controlled by two overlapping promoters, P1 and P2 (1). Pi activity requires cAMP and its receptor protein. P2 functions in the absence of these factors but is inhibited by cAM'P-CRP. The start points for transcription of these two promoters are separated by five base pairs or half a turn in the DNA helix. The existence of the two gal promoters probably reflects the dual function of galactose in cellular metabolism. When galactose becomes the principal carbon source in the medium, it is taken up by the cells, converted to glucose-i-P, and further catabolized to serve as a general energy source. One of the intermediary products in this catabolic pathway, UDP-galactose, is also a precursor for cell wall biosynthesis. Even in the absence of galactose, UDP-galactose continues to be generated from UDP-glucose in a reaction catalyzed by the enzyme UDPglucose 4-epimerase, specified by the promoter-proximal cistron of the gal operon. P1 probably controls the catabolic pathway whereas P2 regulates the anabolic or biosynthetic pathway of
galactose. It can be argued that the function of the two promoters is to ensure a constant basal level of synthesis of gal enzymes, particularly UDP-glucose 4-epimerase, regardless of the physiological fluctuations in the intracellular concentrations of cAMP (ref. 2; S. Adhya, personal communication). To try to understand how cAMP-CRP controls gene expression and more particularly how cAMP-CRP exerts its dual role in gal regulation, we have determined the interaction site for cAMP.CRP on gal DNA. We have used two types of protection experiments. First, we have analyzed which DNA segment was protected by cAMP-CRP from DNase digestion (3). We have also probed which purine residues could be protected by cAMP-CRP from methylation by dimethyl sulfate (4). We find that cAMP-CRP protects a gal DNA fragment located between 25 and 50 base pairs preceding the P1 mRNA start site. Hence the location of the gal-CRP interaction site is clearly different from the lac CRP-binding site located between -70 and -50. Examination of the DNA sequence suggests, however, that cAMP-CRP may recognize similar sequences in gal and in
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U. S. C. §1734 solely to indicate this fact.
Abbreviations: cAMP, cyclic AMP; CRP, cAMP receptor protein. t Present address: Department of Biochemistry, Kouchi Medical
lac.
Our data indicate that positive factors for transcription can activate genes by interacting with promoters in a segment around 35 base pairs preceding the transcription initiation site. The location of the gal CRP-binding site suggests that protein-protein interactions between cAMP-CRP and RNA polymerase on gal DNA play an important role in transcription initiation.
METHODS Isolation of gal Promoter DNA. Plasmid pBCl is a derivative of pBR322 in which the 30-base pair EcoRI/HindIII DNA fragment has been replaced by a DNA fragment containing the gal operator-promoter region and the promoterproximal third of the galE cistron (unpublished experiments). The smaller gal subfragments (F-2 and F-3 in Fig. 1) can be conveniently isolated from pBCl by endonuclease digestion followed by preparative 5% polyacrylamide gel electrophoresis. Terminal 32P Labeling of DNA Fragments. The 5' ends of the DNA fragments were treated with bacterial alkaline phosphatase and were labeled with 32P by using phage T4 polynucleotide kinase as described by Maniatis et al. (5). To obtain fragment 1, (F-1) (Fig. 1) labeled at its Hha I 5' end ("upper strand," see Fig. 5), F-2 was isolated, labeled at its 5' end, cleaved by endonuclease Hap II, and fractionated by 5% polyacrylamide gel electrophoresis. Similarly, to obtain F-1 labeled at its Hap II 5' end ("lower strand"), F-S was isolated,
College, Nangoku-Shi, Kouchi, Japan. § To whom reprint requests should be addressed.
5090
Em
Biochemistry: Taniguchi et al. E
QP7PI,
i
-
-
-80
-60
r
T
I
-40 I
-20
ii
Hha
K
I
+20
+1
I
+40 ,
=--_ -_
mRNA (+cAMP-CRP
Operator
,-FR NA (-cAMP-CRP)
7
Hap
Proc. Natl. Acad. Sci. USA 76 (1979)
i
Hinf
Hap I I Hha (F-i )
' ' 'I| fe
(F-2) (F-3) (F -4)
(F-5)
Hi
-135bp
~~~~~~235bp
@
~~~~~~240 bp
2
iO~~~1
0.2-0.5 Mg of labeled fragment in 200 Ml of mM Tris-HCI, pH 7.9/0.1 M KCI/10 mM MgCI2/0.1 mM EDTA/1 mM dithiothreitol/21 Mg of CRP per ml/500,uM cAMP. The mixture was incubated at 370C for 10 min. Sonicated chicken blood DNA (20 Mg/ml) was then added. After 1-min incubation, 1 Ml of dimethyl sulfate (10.7 M) was added and the mixture was incubated at 370C for 1 min. The sample was precipitated and depurinated at 90'C for 15 min at pH 7.0 and hydrolyzed at 90'C for 30 min with alkali in a sealed capillary. The hydrolyzed sample (20 Ml) was mixed with 20 Ml of 10 M urea/0.05%
xylene cyanol/0.05% bromphenol blue and electrophoresed on 20% and 10% polyacrylamide/7 M urea gels.
CRP. CRP prepared as described (7) was a generous gift of
5 bp
365 bp
FIG. 1. Schematic representation of the gal operon and the relevant restriction fragments used in this work. Lengths of fragments are given in base pairs (bp). The start site for cAMP-CRP-dependent transcription is represented as +1.
labeled at its 5' end, and cleaved by endonuclease Hha I. F-4 labeled at its Hinfl 5' end can be generated by labeling F-5 and then cleaving by Hap II endonuclease. Conversely, to obtain F-4 labeled at its Hap II end, we isolated F-3, labeled this fragment, and cleaved by Hinfl endonuclease. DNase Protection. The DNase protection method of Galas and Schmitz (3) was used. The principle of this technique is as follows. A DNA fragment, specifically labeled at one 5' end, is digested by pancreatic DNase I under conditions of partial digestion in the presence or absence of a DNA-binding protein. The products are fractionated according to size by electrophoresis on high-resolution polyacrylamide gels and the gels are autoradiographed. The patterns of bands corresponding to the reactions with and without the DNA-binding protein are compared. A decrease in the intensity of a band is attributed to protection of the cleavage site by the DNA-bound protein. In our experiment the reaction mixture consisted of 0.2 Mig of a labeled fragment in 10OMl of 10 mM Tris-HCl, pH 7.9/10 mM MgCI2/5 mM CaCl2/100 ,uM dithiothreitol/21 ,ug of CRP per ml and various concentrations of cAMP. The reaction mixture was incubated at 250C for 10 min and then bovine pancreatic DNase I (Worthington) was added to give a final concentration of 0.13 ug/ml. The digestion was carried out at 250C for 30 sec. The products were precipitated with ethanol and dried under reduced pressure. The samples were dissolved in 10 Ml of 0.1 M NaOH/1 mM EDTA and -10 Ml of 0.05% xylene cyanol/0.05% bromphenol blue/10 M urea solution and applied on both a 10% and a 20% polyacrylamide/7 M urea gel for electrophoretic fractionation. Methylation Protection. Dimethyl sulfate methylates the purine residues in DNA at the N-7 of guanines and at the N-3 of adenines (6). The methylation method of Maxam and Gilbert (6) used for DNA sequencing can also be used to study the interactions of DNA-binding proteins with a DNA fragment (4). This procedure includes the following steps. A DNA fragment, selectively labeled at one 5' end, is partially methylated in the presence or in the absence of a DNA-binding protein. The methylated guanines and adenines are removed by heating at neutral pH and then the phosphodiester bonds of DNA are cleaved at the depurinated sites by heating with alkali. The fractionation products are separated on a high-resolution polyacrylamide/7 M urea gel and autoradiographed to produce a pattern of bands. The binding of DNA by a protein can both decrease and increase the level of methylation of purines in the contact region (4). Decrease (protection) seems to be due to steric hindrance. Conditions of methylation were as described by Gilbert and Maxam (6). The reaction mixture consisted of
5091
J.
Krakow.
RESULTS A Segment of gal Promoter DNA Is Protected by cAMP CRP from DNase Digestion. We first examined the effects of cAMP-CRP on the digestion pattern by DNase I of the 135-base pair gal promoter DNA fragment 1 (F-1) depicted in Fig. 1. This fragment extends from 93 base pairs preceding the start site for PI to 43 base pairs following this start site and includes part of the first structural gene galE. The nucleotide sequence of this fragment has been determined (1). Fig. 2A analyzes which bases are protected on the upper strand of the gal promoter; for this experiment F-1 was specifically labeled at its Hha I 5' end. Similarly, the experiment reproduced in Fig. 2B examined which bases are protected on the lower strand. The location of the protected bases is determined by comparing the position of the gel bands derived from the DNase reaction with the position of G and A bands obtained in a purine-specific reaction (Fig. 2A, lane 1, and Fig. 2B, lane 1) and the position .4
2
11
4
3
6
5
B
1
3
2
_
____~~~~
"Nw
m
x2
'W"
_ij:
--
-60....
am& 40
&-.*
-50 *_.*
vli
amw 0.*04
.- -
or...
mE|||
;7, .,-!
a
mw*w
ovooft
*
-,.!-.
mm& Am
_m
a
w_-
at&
mmm. _aON.
-
mm
&
-20 *
.
-W m
m
-30
so .-
-Oman
:Raw
It= SW
a
-40 *
--10
-1
a" 0
*
-
FIG. 2. DNase footprint analysis of cAMP-CRP protection of gal DNA. Fragment F-1 (see Fig. 1) was end-labeled at one or the other 5' end and digested under partial reaction conditions with DNase in the presence or absence of cAMP-CRP. The reaction products were fractionated on a 20% polyacrylamide/7 M urea gel. (A) Analysis of the upper strand. Lane 1, G + A reaction; lane 2, no cAMP*CRP; lanes 3-6, CRP (20 g/ml) and cAMP at 500 MM (lane 3), 50 MM (lane 4), 5 jM (lane 5), 0.5 ,M (lane 6). (B) Analysis of the bottom strand. Lane 1, G + A reaction; lane 2, no cAMP-CRP; lane 3, CRP (20 Mg/ml) and 5 MM cAMP.
5092
Biochemistry: Taniguchi et al.
Proc. Natl. Acad. Sci. USA 76 (1979)
of C and T bands obtained in a pyrimidine-specific reaction (not shown). The pattern of bands corresponding to a sample that contained CRP but no cAMP is very similar to the pattern derived from a reaction without CRP and cAMP. Hence, CRP itself does not affect the DNase digestion pattern and the protection that is seen is specifically due to the cAMP-CRP complex. The concentration range of cAMP that ensures protection of segments of the gal promoter by cAMP-CRP is very similar to the concentration of cAMP needed for PI stimulation and P2 repression as measured in an in vitro transcription assay (8). The concentration of cAMP needed for half-maximal stimulation of PI (5 jM) is the same as the cAMP concentration that inhibits 50% of P2 activity (8). If the concentration dependency of CRP is examined, we find that the same concentrations of CRP that in vitro activate transcription at P1 or inhibit transcription at P2 protect gal DNA from DNase digestion. The results of Fig. 2 are summarized in Fig. 5. In the top strand protection occurs at the 3' side of the following bases: A at -50, A at -46, A at -41, T at -40, G at -39, T at -38, C at -37, A at -36, and C at -35. On longer exposure we see that the bases between -33 and -25 on the upper strand are also protected. To examine the full extent of protection longer exposures are needed because the patterns of digestion in the absence of cAMP-CRP are not uniform, DNase being much more active at certain specific sites in the DNA sequence than at others. On the bottom strand fewer sites are protected: G at -42 and A at -38. The finding that fewer bases are protected on the lower strand is mostly due to the absence of digestion at many sites on this strand between -50 and -35 in the absence of cAMP-CRP. Interestingly, DNase digestion is enhanced at 2
1
3
4
5
6
-42 C, -34 A, -23 C (less pronounced), -16 A, and -14 A on the upper strand, and at -49 A, -40 A, and -30 A on the lower strand. These enhancements occur at concentrations of cAMP of 5MgM or higher and thus similar to those that cause protection. (We noted that the enhanced sensitivity to DNase at -14 is more pronounced at a cAMP concentration of 50,tM.) We attribute the increased sensitivity to DNase digestion at these sites to a change in DNA conformation resulting from the interaction of cAMP-CRP with gal DNA. At much higher concentrations of cAMP than needed for transcription activation, many additional sites are protected (Fig. 2A, lane 3). We had observed previously that, at high concentrations of cAMP, f3-galactosidase synthesis was inhibited in a cell-free DNA-dependent S30 system (9). It is possible that at higher concentrations cAMP induces a nonspecific cooperative binding of CRP to DNA. It is obvious from our results that at concentrations of cAMP that activate transcription from P1 no bases are protected between -70 and -55. In this segment the gal sequence presents considerable analogies both in sequence and in symmetry with a similarly located sequence in the promoter of the lac operon (10). This sequence contains the lac CRP-binding site (refs. 11 and 12; J. Majors, personal communication). It was formally possible that cAMP.CRP might first recognize the sequence similar to the lac CRP-binding site at -70 to -55 and then bind to the -50 to -25 segment in a second step. To test this possibility we asked whether the 105-base pair fragment F-4 of Fig. 1, which lacks the bases to the left of -59, was capable of interacting with cAMP-CRP in a similar fashion as the larger fragment. The results presented in Fig. 3 indicate that 1
2
-_
ow
3
7
.
mo -20a-
+10. _i
t
.-
*|s *11--
...
gm*
-10'
*
X -
AA- -m a*-40 * -30 . 20
an
-309 + 1 * -
4
-
'0-10
:M
--50.*
_qMom
Mw
_mp
-
*
a
+1
.....
-6 -0
-30*
_-
_
_
0
10
........
-_ -400
*s
mo
-100gmw
-70'
Ivmw 0
- -ammmw
_m
FIG. 3. Effect of cAMP-CRP on DNase footprint analysis of fragment F-4 (see Fig. 1). F-4 was labeled at its Hinfl 5' end. The partial DNase digestion was conducted as in Fig. 2 with or without cAMP-CRP. Reaction products were fractionated on a 20% polyacrylamide/7 M urea gel. Lane 1, G + A reaction; lane 2, no cAMP-CRP; lanes 3-7, CRP (20 ,g/ml) and cAMP at 500,gM (lane 3), 50MM (lane
4), 5 ,gM (lane 5), 0.5 ,M (lane 6), 0MM (lane 7).
FIG. 4. Effect of cAMP-CRP on methylation of gal DNA. Fragment F-1 (see Fig. 1) was end-labeled at one or the other 5' end and treated with dimethyl sulfate (6). The fractionation products were separated on a 20% denaturing polyacrylamide gel. Lanes 1 and 2, analysis of the upper strand; lane 1, no cAMP-CRP; lane 2, CRP (21
jg/ml) and cAMP (500 ,M). Lanes 3 and 4, analysis of the lower strand; lane 3, no cAMP-CRP; lane 4, CRP (21 ,ug/ml) and cAMP (500 AM).
Proc. Natl. Acad. Sci. USA 76 (1979)
Biochemistry: Taniguchi et al. cAMP-CRP protects the same residues from DNase digestion as in the larger 135-base pair fragment (F-i). cAMP-CRP also produces an enhancement of DNase digestion at the same sites as with the larger fragment except at -34 on the upper strand. Similar concentrations of cAMP are needed to obtain DNase protection as with the larger fragment. Thus a DNA fragment that is missing part of the sequence that is similar to the lac CRP-binding site is capable of interacting with cAMP-CRP as well as a larger fragment that contains these sequences. Methylation Protection. We next examined which specific bases in gal DNA made contact with cAMP-CRP by probing which purine residues could be protected from methylation by cAMP-CRP (4). Again, DNA fragment F-1 (see Fig. 1) was specifically labeled at one or the other of its 5' ends. This fragment was then allowed to react with dimethyl sulfate in either the presence or the absence of cAMP-CRP. As can be seen in Fig. 4, one residue, G -35 on the lower strand, was strongly protected by cAMP.CRP. Weaker protection occurred at G -37 on the lower strand and at G-39 on the upper strand.
DISCUSSION The results presented here (see Fig. 5 for summary) indicate that cAMP-CRP interacts with a gal DNA segment located between 50 and 24 base pairs preceding the start site of PI mRNA. Many sites in this segment are protected by cAMP-CRP from DNase digestion. This protection by CRP is strictly dependent on cAMP at concentrations of the cyclic nucleotide that are identical to those needed for CRP-dependent activation of PI or inhibition of P2. Within this protected segment a number of sites exhibit an enhanced sensitivity to DNase as a result of cAMP-CRP interaction with gal DNA. They appear at regularly spaced intervals in the protected sequence at -42, -34, and -23 on the upper strand (and -49, -40, and -30 on the lower strand). In addition, two other sites at -16 and -14 on the upper strand exhibit an enhanced sensitivity to DNase. These latter sites lie within the Pribnow "heptamer" for P2 and precede by a few bases the "heptamer" for P1. These heptamers are located about 5 to 6 bases preceding the start site of transcription in different prokaryotic promoters and show a high degree of conservation (13, 14). Bases within these heptamers could participate in the localized DNA melting associated with the formation of a stable RNA polymerase-promoter complex (13). The interactions of cAMP-CRP with the -50 and -25 region could thus cause a conformational change in the DNA structure in the P2 heptamer. This structural change, in addition to the protein-protein interactions between cAMP-CRP and RNA polymerase, might favor formation of a stable complex at PI or inhibit the formation of such a complex at P2. Our results clearly indicate that cAMP-CRP does not bind to the -70 to -50 region in gal, a segment that presents homologies both in sequence and in symmetry with the CRP-binding site in lac located between -70 and -50. Fur-
-70
-80
5093
thermore, this gal segment is not needed for CRP binding at -50 to -25, because removal of the sequences to the left of -59 does not alter the cyclic AMP concentration dependency of CRP binding. Earlier results had, in fact, strongly suggested that the -70 to -50 segment was not the gal CRP-binding site (8). Indeed several galOc mutants map in this segment between -66 and -55 (ref. 8; M. Irani and S. Adhya, personal communication). These Oc mutants exhibit the same cAMP-CRP dependent stimulation of PI and repression of P2 as wild-type gal DNA. One such gal mutant results in an identical base change (G-C to A-T) as a lac CRP-binding site mutant and is located the same distance from the cAMP-CRP-dependent initiation site in gal and in lac (8, 11). This mutation severly reduces the cAMP-CRP response in lac but leaves it unchanged in gal. In other experiments the cAMP-CRP interaction site on gal DNA was also functionally mapped by examining whether sequences to the left of the HinfI cleavage site at -59 were needed for transcriptional control of P1 and P2 activity. Transcription of two hybrid DNA fragments in which the segment to the left of -59 was replaced by two different unrelated DNA sequences exhibits a cAMP-CRP response for P1 stimulation or P2 repression identical to that of wild-type gal DNA (unpublished data). Hence, the DNA sequence to the right of -60 contains all the specific interaction sites needed for the cAMP-CRP-dependent activation of P1 and repression of P2. It is clear that the location of the cAMP-CRP interaction site in gal is very different from the CRP-binding site in the lac operon. The identity of this site in lac has been firmly established by DNA sequencing of CRP-binding site mutants and by chemical protection experiments (ref. 11; J. Majors, personal communication). In gal the -50 to -70 segment covers the site where the repressor interacts with gal DNA. We wished to determine more precisely the sequence within these CRP regulatory regions that is recognized by CRP. In this analysis, we employed the following criteria: (i) the common CRP recognition sequence should be altered by the CRPbinding site mutations known in lac and should include the bases protected by or from dimethyl sulfate in lac and in gal; (ii) the sequence should be consistent with the size of CRP (7), spanning 10-15 base pairs; (iii) the sequence should accommodate a dimer, presenting similar sequence elements to each subunit; (iv) the region of the DNA protected against DNase by CRP should be approximately coextensive with the occurrences of the CRP recognition sequence. A computer was utilized to search for homologies in the lac and gal sites that might satisfy these criteria. The regulatory region between araC and araBAD is also known to be involved in complex interactions with cAMP-CRP (15, 16) and was therefore included in this search. The result pointed to a sequence appearing twice in the CRP site of lac, symmetrically located about the dyad axis centered at -60/-61 (11, 17), ap-
-60
G C T ^ ^ A T TC T T a T a ^ ^ ^ C a^0 0
GGCTAAATTCTTGTGTAAACGAT CCGATTTAAGAACACATTTOCTAA
-50 T CC
ACT
^AT T TOT T C
-40
C0)MZJ
AGO T OAT TA AAT A A GT
CAGTT G *
I
pi -30
TbT)T
j-20
-10
C T T TGT A AAG C G TAG A A AC A:A TAC 0
I
+10
G G T TAT T T CAT A C C A T A A G A TA CC A A TATA G TAT GOT AT V C
CT
'--~~~~~~~~~~~~~
FIG. 5. Summary of protection data. Circles indicate protection against DNase digestion by cAMP-CRP at the 3' side of the indicated base. Arrows indicate enhancement of digestion by DNase at the 3' side of the indicated bases. Square indicates base protected by cAMP-CRP from methylation by dimethyl sulfate. P1 and P2 refer to the respective initiation sites for the P1 and P2 promoter (1). Boxed sequences indicate the Pribnow heptamers for each of the two promoters. The upper strand reads 5' - 3' from left to right.
5094
Biochemistry: Taniguchi et al.
pearing three times in the gal CRP region, and five (or more) times in the ara regulatory region (18, 19). These sequences are listed as follows: lac -73 T-T-A-A-T-G-T-G-A-G-T -63 -50 A-A-T-G-A-G-T-G-A-G-G -60
gal -21 A-A-G-A-T-G-C-G-A-A-A -31 -30 A-A-A-G-T-G-T-G-A-C-A -40 -44 T-C-C-A-T-G-T-C-A-C-A -34 ara -29 A-A-A-G-C-G-T-C-A-G-G -39 -82 A-A-A-G-T-G-T-G-A-C-G -92 -141 A-A-A-G-T-G-T-C-T-A-T -131
-148 A-A-A-G-C-G-C-T-A-C-A -138 -158 A-A-A-G-C-G-C-T-A-C-A -148 The consensus sequence obtained from this list is 5' A-AA-G-T-G-T-G-A-C-A 3'. This sequence appears without changes in gal from -30 to -40. The underlined region of the sequence seems to be most important for recognition. The two Gs in this region are strongly implicated by methylation experiments both in the lac (J. Majors, personal communication) and in the gal sites. The first G and the A are totally conserved within this list. A transition of the second G to A constitutes the symmetric CRP mutations that Dickson et al. (11) have determined in the lac CRP site. This sequence is generally distinguished from rather similar sequences that appear in numerous promoters in the -35 region (20) and in the lac, gal, and X operators (8, 20, 21) by differences in the underlined region of the sequence. The consensus sequence also satisfies criteria i and iii above because it is the right size and can, according to our preliminary analysis, accommodate a dimer of identical subunits in either a direct repeat or an inverted repeat arrangement. We find that cAMP.CRP protects a gal segment that is larger than the sequence presenting homologies with the lac CRP sites in gal. This could be due to binding of CRP to adjacent weaker sites. The binding of CRP to these weaker sites might be stabilized by protein-protein interactions. In fact, two additional sites with partial homology with the proposed recognition sequence were found within the protected sequence (-21 to -31 and -44 to -34). How can the difference in location between the CRP-binding sites in lac and in gal be reconciled with their similar effects on activation of transcription? One possible explanation would be that the interaction between CRP and RNA polymerase occurs around -35 in both gal and lac. In lac the primary binding site for CRP is obviously at -70 to -50, but the binding of CRP to a secondary binding site around -35 might also be stabilized by CRP-CRP or CRP-RNA polymerase interactions. In fact, the gal sequence -30 -36 A-C-A-C-T-T-T T-G-T-G-A-A-A is also found in lac from -34 to -28. This sequence constitutes part of what we think is the CRP recognition sequence in
gal.
The interaction of an activator for gene transcription such
as cAMP-CRP with promoter DNA around -35 is not unique to gal. Indeed, recent experiments on the stimulation of the X PRM promoter by the X repressor support this notion. Although the X repressor preferentially binds to a site 59 to 75 base pairs preceding PRM, its binding to a segment between -35 and -51 is essential for PRM stimulation. Interaction of the X repressor with the -59 to -75 site induces a cooperative binding of the repressor to the -35/-51 site (B. Meyer and M. Ptashne, per-
sonal communication).
Proc. N.tl. Acad. Sci. USA 76 (1979)
Our results establish that factors that activate transcription initiation can interact with promoters between -50 and'-25. The sequences around -35 are one of two regions of homology in prokaryotic promoters (20), the other being the heptamer centered at -10 (7, 13, 14). In the lac UV5 promoter RNA polymerase makes contact with a G residue at -32 (4). The segment around -35 is also the site of several promoter mutations. These mutations either decrease or increase promoter activity. They alter the binding of RNA polymerase or change the rate of initiation of transcription at these promoters (20, 22-25). The proposed CRP recognition sequence in the same region in gal probably provides some of the necessary interactions for productive initiation of transcription at P1. The location of the CRP-binding site strongly suggests that initiation of transcription includes protein-protein interactions between cAMP-CRP and RNA polymerase in gal DNA and maybe also in other cAMP-dependent promoters. We are grateful to Joe Krakow for CRP. We thank Linda Harris for secretarial assistance and Ray Steinberg for the illustrations. 1. Musso, R. E., DiLauro, R., Adhya, S. & de Crombrugghe, B. (1977) Cell 12,847-854. 2. de Crombrugghe, B. & Pastan, I. (1978) in The Operon, eds. Miller, J. H. & Reznikoff, W. S. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY), pp. 303-324, 3. Galas, D. & Schmitz, A. (1978) Nucleic Acids Res. 5, 31573170. 4. Johnsrud, L. (1978) Proc. Natl. Acad. Sci. USA 75, 53145318. 5. Maniatis, T., Jeffrey, A. & Kleid, D. G. (1975) Proc. Nati. Acad. Sci. USA 72, 1184-1188. 6. Maxam, A. M. & Gilbert, W. (1977) Proc. Nati. Acad. Sci. USA
74,560-564.
7. Anderson, W. B., Schneider, A. B., Emmer, M., Perlman, R. L. & Pastan, I. (1971) J. Biol. Chem. 246,5929-5937. 8. DiLauro, R., Taniguchi, T., Musso, R. & de Crombrugghe, B. (1979) Nature (London) 279,494-500. 9. Emmer, M., de Crombrugghe, B., Pastan, L. & Perlman, R. (1970) Proc. Nati. Acad. Sci. USA 6 480-487. 10. Musso, R., DiLauro, R., Rosenbeg, M. & de Crombrugghe, B. (1977) Proc. Natl. Acad. Sci. USA, 74, 106-110. 11. Dickson, R. C., Abelson, J., Johnson, P., Reznikoff, W. S. & Barnes, W. M. (1977) J. Mol. Biol. 111, 65-75. 12. Majors, J. (1975) Nature (London) 256, 672-674. 13. Pribnow, D. (1975) Proc. Nati. Acad. Sci. USA 72,784-788. 14. Schaller, H., Gray, C. & Herrman, K. (1975) Proc. Natl. Acad. Sci. USA 72,737-741. 15. Greenblatt, J. & Schleif, R. (1971) Nature (London) New Biol. 233, 166-170. 16. Casadaban, M. (1976) J. Mol. Biol. 104,557-566. 17. Gilbert, W. (1976) RNA Polymerase, eds. Losick, R. & Chamberlin, M. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY), pp. 193-205. 18. Greenfield, L., Boone, T. & Wilcox, G. (1978) Proc. Natl. Acad. Sci. USA 75,4724-4728. ,19. Smith, B. & Schleif, R. (1978) J. Biol. Chem. 253,6931-6932. 20. Reznikoff, W. S. & Abelson, J. N. (1978) in The Operon, eds. Miller, J. & Reznikoff, W. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY), pp. 221-243. 21. Maniatis, T., Ptashne, M., Backman, K., Fleid, D., Flashman, S., Jeffrey, A. & Maurer, R. (1975) Cell 5, 109-113. 22. Meyer, B. J., Kleid, D. G. & Ptashne, M. (1975) Proc. Natl. Acad. Sci. USA 72,4785-4789. 23. Kleid, D., Humayun, Z., Jeffrey, A. & Ptashne, M. (1976) Proc. Natl. Acad. Sci. USA 73,293-297. 24. Maquat, L. E. & Reznikoff, W. S. (1978) J. Mol. Biol. 125, 467-490. 25. Calos, M. P. (1978) Nature (London) 274,762-765.
Interaction site of Escherichia coli cyclic AMP receptor protein on DNA of galactose operon promoters (protein-DNA interactions/DNase protection/methylation protection)
TAKETOSHI TANIGUCHI*t, MICHAEL O'NEILLt, AND BENOIT DE CROMBRUGGHE*§ *Laboratory of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20205; and tDepartment of Biological Sciences, University of Maryland, Baltimore County, Catonsville, Maryland 21228
Communicated by Philip Leder, July 31, 1979
ABSTRACT Cyclic AMP (cAMP) and its receptor protein (CRP) have a dual role in the regulation of the two promoters that control the galactose (gal) operon of Escherichia coli. One promoter, P1, requires cAMP-CRP for activity; the other, P2, is inhibited by these factors. We have examined the interaction site of cAMP'CRP on gal DNA by using two types of protection experiments, involving DNase digestion and methylation by dimethyl sulfate. Our results indicate that cAMP-CRP binds to gal DNA in a segment located between 50 and 24 base pairs preceding the P1 start point for transcription. Although the location of the cAMP-CRP interaction site is clearly different in gal and lac DNA, comparison of the DNA sequences suggests a similar recognition sequence. The location of the cAMPCRP-binding site in gal further suggests that protein-protein interactions between RNA polymerase and cAMP-CRP play an important role in transcription initiation at the gal and possibly other cAMP-dependent promoters. Bacterial or bacteriophage promoters can be subdivided into two groups. In one class of promoters the DNA sequence contains all the necessary information for the binding of RNA polymerase and the formation of a stable complex for productive initiation of transcription. In other promoters the sequence information and hence the DNA structure is insufficient by itself to allow such stable complexes to be formed in the absence of additional protein factors. Cyclic AMP-dependent promoters fall in this second category. The additional information and interactions needed for the formation of a stable complex between RNA polymerase and DNA are provided by the cyclic AMP (cAMP)-cyclic AMP receptor (CRP) complex and the CRP binding site on the DNA. The role of cAMP.CRP in the regulation of the galactose (gal) operon of Escherichia coli is complex because this operon is controlled by two overlapping promoters, P1 and P2 (1). Pi activity requires cAMP and its receptor protein. P2 functions in the absence of these factors but is inhibited by cAM'P-CRP. The start points for transcription of these two promoters are separated by five base pairs or half a turn in the DNA helix. The existence of the two gal promoters probably reflects the dual function of galactose in cellular metabolism. When galactose becomes the principal carbon source in the medium, it is taken up by the cells, converted to glucose-i-P, and further catabolized to serve as a general energy source. One of the intermediary products in this catabolic pathway, UDP-galactose, is also a precursor for cell wall biosynthesis. Even in the absence of galactose, UDP-galactose continues to be generated from UDP-glucose in a reaction catalyzed by the enzyme UDPglucose 4-epimerase, specified by the promoter-proximal cistron of the gal operon. P1 probably controls the catabolic pathway whereas P2 regulates the anabolic or biosynthetic pathway of
galactose. It can be argued that the function of the two promoters is to ensure a constant basal level of synthesis of gal enzymes, particularly UDP-glucose 4-epimerase, regardless of the physiological fluctuations in the intracellular concentrations of cAMP (ref. 2; S. Adhya, personal communication). To try to understand how cAMP-CRP controls gene expression and more particularly how cAMP-CRP exerts its dual role in gal regulation, we have determined the interaction site for cAMP.CRP on gal DNA. We have used two types of protection experiments. First, we have analyzed which DNA segment was protected by cAMP-CRP from DNase digestion (3). We have also probed which purine residues could be protected by cAMP-CRP from methylation by dimethyl sulfate (4). We find that cAMP-CRP protects a gal DNA fragment located between 25 and 50 base pairs preceding the P1 mRNA start site. Hence the location of the gal-CRP interaction site is clearly different from the lac CRP-binding site located between -70 and -50. Examination of the DNA sequence suggests, however, that cAMP-CRP may recognize similar sequences in gal and in
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U. S. C. §1734 solely to indicate this fact.
Abbreviations: cAMP, cyclic AMP; CRP, cAMP receptor protein. t Present address: Department of Biochemistry, Kouchi Medical
lac.
Our data indicate that positive factors for transcription can activate genes by interacting with promoters in a segment around 35 base pairs preceding the transcription initiation site. The location of the gal CRP-binding site suggests that protein-protein interactions between cAMP-CRP and RNA polymerase on gal DNA play an important role in transcription initiation.
METHODS Isolation of gal Promoter DNA. Plasmid pBCl is a derivative of pBR322 in which the 30-base pair EcoRI/HindIII DNA fragment has been replaced by a DNA fragment containing the gal operator-promoter region and the promoterproximal third of the galE cistron (unpublished experiments). The smaller gal subfragments (F-2 and F-3 in Fig. 1) can be conveniently isolated from pBCl by endonuclease digestion followed by preparative 5% polyacrylamide gel electrophoresis. Terminal 32P Labeling of DNA Fragments. The 5' ends of the DNA fragments were treated with bacterial alkaline phosphatase and were labeled with 32P by using phage T4 polynucleotide kinase as described by Maniatis et al. (5). To obtain fragment 1, (F-1) (Fig. 1) labeled at its Hha I 5' end ("upper strand," see Fig. 5), F-2 was isolated, labeled at its 5' end, cleaved by endonuclease Hap II, and fractionated by 5% polyacrylamide gel electrophoresis. Similarly, to obtain F-1 labeled at its Hap II 5' end ("lower strand"), F-S was isolated,
College, Nangoku-Shi, Kouchi, Japan. § To whom reprint requests should be addressed.
5090
Em
Biochemistry: Taniguchi et al. E
QP7PI,
i
-
-
-80
-60
r
T
I
-40 I
-20
ii
Hha
K
I
+20
+1
I
+40 ,
=--_ -_
mRNA (+cAMP-CRP
Operator
,-FR NA (-cAMP-CRP)
7
Hap
Proc. Natl. Acad. Sci. USA 76 (1979)
i
Hinf
Hap I I Hha (F-i )
' ' 'I| fe
(F-2) (F-3) (F -4)
(F-5)
Hi
-135bp
~~~~~~235bp
@
~~~~~~240 bp
2
iO~~~1
0.2-0.5 Mg of labeled fragment in 200 Ml of mM Tris-HCI, pH 7.9/0.1 M KCI/10 mM MgCI2/0.1 mM EDTA/1 mM dithiothreitol/21 Mg of CRP per ml/500,uM cAMP. The mixture was incubated at 370C for 10 min. Sonicated chicken blood DNA (20 Mg/ml) was then added. After 1-min incubation, 1 Ml of dimethyl sulfate (10.7 M) was added and the mixture was incubated at 370C for 1 min. The sample was precipitated and depurinated at 90'C for 15 min at pH 7.0 and hydrolyzed at 90'C for 30 min with alkali in a sealed capillary. The hydrolyzed sample (20 Ml) was mixed with 20 Ml of 10 M urea/0.05%
xylene cyanol/0.05% bromphenol blue and electrophoresed on 20% and 10% polyacrylamide/7 M urea gels.
CRP. CRP prepared as described (7) was a generous gift of
5 bp
365 bp
FIG. 1. Schematic representation of the gal operon and the relevant restriction fragments used in this work. Lengths of fragments are given in base pairs (bp). The start site for cAMP-CRP-dependent transcription is represented as +1.
labeled at its 5' end, and cleaved by endonuclease Hha I. F-4 labeled at its Hinfl 5' end can be generated by labeling F-5 and then cleaving by Hap II endonuclease. Conversely, to obtain F-4 labeled at its Hap II end, we isolated F-3, labeled this fragment, and cleaved by Hinfl endonuclease. DNase Protection. The DNase protection method of Galas and Schmitz (3) was used. The principle of this technique is as follows. A DNA fragment, specifically labeled at one 5' end, is digested by pancreatic DNase I under conditions of partial digestion in the presence or absence of a DNA-binding protein. The products are fractionated according to size by electrophoresis on high-resolution polyacrylamide gels and the gels are autoradiographed. The patterns of bands corresponding to the reactions with and without the DNA-binding protein are compared. A decrease in the intensity of a band is attributed to protection of the cleavage site by the DNA-bound protein. In our experiment the reaction mixture consisted of 0.2 Mig of a labeled fragment in 10OMl of 10 mM Tris-HCl, pH 7.9/10 mM MgCI2/5 mM CaCl2/100 ,uM dithiothreitol/21 ,ug of CRP per ml and various concentrations of cAMP. The reaction mixture was incubated at 250C for 10 min and then bovine pancreatic DNase I (Worthington) was added to give a final concentration of 0.13 ug/ml. The digestion was carried out at 250C for 30 sec. The products were precipitated with ethanol and dried under reduced pressure. The samples were dissolved in 10 Ml of 0.1 M NaOH/1 mM EDTA and -10 Ml of 0.05% xylene cyanol/0.05% bromphenol blue/10 M urea solution and applied on both a 10% and a 20% polyacrylamide/7 M urea gel for electrophoretic fractionation. Methylation Protection. Dimethyl sulfate methylates the purine residues in DNA at the N-7 of guanines and at the N-3 of adenines (6). The methylation method of Maxam and Gilbert (6) used for DNA sequencing can also be used to study the interactions of DNA-binding proteins with a DNA fragment (4). This procedure includes the following steps. A DNA fragment, selectively labeled at one 5' end, is partially methylated in the presence or in the absence of a DNA-binding protein. The methylated guanines and adenines are removed by heating at neutral pH and then the phosphodiester bonds of DNA are cleaved at the depurinated sites by heating with alkali. The fractionation products are separated on a high-resolution polyacrylamide/7 M urea gel and autoradiographed to produce a pattern of bands. The binding of DNA by a protein can both decrease and increase the level of methylation of purines in the contact region (4). Decrease (protection) seems to be due to steric hindrance. Conditions of methylation were as described by Gilbert and Maxam (6). The reaction mixture consisted of
5091
J.
Krakow.
RESULTS A Segment of gal Promoter DNA Is Protected by cAMP CRP from DNase Digestion. We first examined the effects of cAMP-CRP on the digestion pattern by DNase I of the 135-base pair gal promoter DNA fragment 1 (F-1) depicted in Fig. 1. This fragment extends from 93 base pairs preceding the start site for PI to 43 base pairs following this start site and includes part of the first structural gene galE. The nucleotide sequence of this fragment has been determined (1). Fig. 2A analyzes which bases are protected on the upper strand of the gal promoter; for this experiment F-1 was specifically labeled at its Hha I 5' end. Similarly, the experiment reproduced in Fig. 2B examined which bases are protected on the lower strand. The location of the protected bases is determined by comparing the position of the gel bands derived from the DNase reaction with the position of G and A bands obtained in a purine-specific reaction (Fig. 2A, lane 1, and Fig. 2B, lane 1) and the position .4
2
11
4
3
6
5
B
1
3
2
_
____~~~~
"Nw
m
x2
'W"
_ij:
--
-60....
am& 40
&-.*
-50 *_.*
vli
amw 0.*04
.- -
or...
mE|||
;7, .,-!
a
mw*w
ovooft
*
-,.!-.
mm& Am
_m
a
w_-
at&
mmm. _aON.
-
mm
&
-20 *
.
-W m
m
-30
so .-
-Oman
:Raw
It= SW
a
-40 *
--10
-1
a" 0
*
-
FIG. 2. DNase footprint analysis of cAMP-CRP protection of gal DNA. Fragment F-1 (see Fig. 1) was end-labeled at one or the other 5' end and digested under partial reaction conditions with DNase in the presence or absence of cAMP-CRP. The reaction products were fractionated on a 20% polyacrylamide/7 M urea gel. (A) Analysis of the upper strand. Lane 1, G + A reaction; lane 2, no cAMP*CRP; lanes 3-6, CRP (20 g/ml) and cAMP at 500 MM (lane 3), 50 MM (lane 4), 5 jM (lane 5), 0.5 ,M (lane 6). (B) Analysis of the bottom strand. Lane 1, G + A reaction; lane 2, no cAMP-CRP; lane 3, CRP (20 Mg/ml) and 5 MM cAMP.
5092
Biochemistry: Taniguchi et al.
Proc. Natl. Acad. Sci. USA 76 (1979)
of C and T bands obtained in a pyrimidine-specific reaction (not shown). The pattern of bands corresponding to a sample that contained CRP but no cAMP is very similar to the pattern derived from a reaction without CRP and cAMP. Hence, CRP itself does not affect the DNase digestion pattern and the protection that is seen is specifically due to the cAMP-CRP complex. The concentration range of cAMP that ensures protection of segments of the gal promoter by cAMP-CRP is very similar to the concentration of cAMP needed for PI stimulation and P2 repression as measured in an in vitro transcription assay (8). The concentration of cAMP needed for half-maximal stimulation of PI (5 jM) is the same as the cAMP concentration that inhibits 50% of P2 activity (8). If the concentration dependency of CRP is examined, we find that the same concentrations of CRP that in vitro activate transcription at P1 or inhibit transcription at P2 protect gal DNA from DNase digestion. The results of Fig. 2 are summarized in Fig. 5. In the top strand protection occurs at the 3' side of the following bases: A at -50, A at -46, A at -41, T at -40, G at -39, T at -38, C at -37, A at -36, and C at -35. On longer exposure we see that the bases between -33 and -25 on the upper strand are also protected. To examine the full extent of protection longer exposures are needed because the patterns of digestion in the absence of cAMP-CRP are not uniform, DNase being much more active at certain specific sites in the DNA sequence than at others. On the bottom strand fewer sites are protected: G at -42 and A at -38. The finding that fewer bases are protected on the lower strand is mostly due to the absence of digestion at many sites on this strand between -50 and -35 in the absence of cAMP-CRP. Interestingly, DNase digestion is enhanced at 2
1
3
4
5
6
-42 C, -34 A, -23 C (less pronounced), -16 A, and -14 A on the upper strand, and at -49 A, -40 A, and -30 A on the lower strand. These enhancements occur at concentrations of cAMP of 5MgM or higher and thus similar to those that cause protection. (We noted that the enhanced sensitivity to DNase at -14 is more pronounced at a cAMP concentration of 50,tM.) We attribute the increased sensitivity to DNase digestion at these sites to a change in DNA conformation resulting from the interaction of cAMP-CRP with gal DNA. At much higher concentrations of cAMP than needed for transcription activation, many additional sites are protected (Fig. 2A, lane 3). We had observed previously that, at high concentrations of cAMP, f3-galactosidase synthesis was inhibited in a cell-free DNA-dependent S30 system (9). It is possible that at higher concentrations cAMP induces a nonspecific cooperative binding of CRP to DNA. It is obvious from our results that at concentrations of cAMP that activate transcription from P1 no bases are protected between -70 and -55. In this segment the gal sequence presents considerable analogies both in sequence and in symmetry with a similarly located sequence in the promoter of the lac operon (10). This sequence contains the lac CRP-binding site (refs. 11 and 12; J. Majors, personal communication). It was formally possible that cAMP.CRP might first recognize the sequence similar to the lac CRP-binding site at -70 to -55 and then bind to the -50 to -25 segment in a second step. To test this possibility we asked whether the 105-base pair fragment F-4 of Fig. 1, which lacks the bases to the left of -59, was capable of interacting with cAMP-CRP in a similar fashion as the larger fragment. The results presented in Fig. 3 indicate that 1
2
-_
ow
3
7
.
mo -20a-
+10. _i
t
.-
*|s *11--
...
gm*
-10'
*
X -
AA- -m a*-40 * -30 . 20
an
-309 + 1 * -
4
-
'0-10
:M
--50.*
_qMom
Mw
_mp
-
*
a
+1
.....
-6 -0
-30*
_-
_
_
0
10
........
-_ -400
*s
mo
-100gmw
-70'
Ivmw 0
- -ammmw
_m
FIG. 3. Effect of cAMP-CRP on DNase footprint analysis of fragment F-4 (see Fig. 1). F-4 was labeled at its Hinfl 5' end. The partial DNase digestion was conducted as in Fig. 2 with or without cAMP-CRP. Reaction products were fractionated on a 20% polyacrylamide/7 M urea gel. Lane 1, G + A reaction; lane 2, no cAMP-CRP; lanes 3-7, CRP (20 ,g/ml) and cAMP at 500,gM (lane 3), 50MM (lane
4), 5 ,gM (lane 5), 0.5 ,M (lane 6), 0MM (lane 7).
FIG. 4. Effect of cAMP-CRP on methylation of gal DNA. Fragment F-1 (see Fig. 1) was end-labeled at one or the other 5' end and treated with dimethyl sulfate (6). The fractionation products were separated on a 20% denaturing polyacrylamide gel. Lanes 1 and 2, analysis of the upper strand; lane 1, no cAMP-CRP; lane 2, CRP (21
jg/ml) and cAMP (500 ,M). Lanes 3 and 4, analysis of the lower strand; lane 3, no cAMP-CRP; lane 4, CRP (21 ,ug/ml) and cAMP (500 AM).
Proc. Natl. Acad. Sci. USA 76 (1979)
Biochemistry: Taniguchi et al. cAMP-CRP protects the same residues from DNase digestion as in the larger 135-base pair fragment (F-i). cAMP-CRP also produces an enhancement of DNase digestion at the same sites as with the larger fragment except at -34 on the upper strand. Similar concentrations of cAMP are needed to obtain DNase protection as with the larger fragment. Thus a DNA fragment that is missing part of the sequence that is similar to the lac CRP-binding site is capable of interacting with cAMP-CRP as well as a larger fragment that contains these sequences. Methylation Protection. We next examined which specific bases in gal DNA made contact with cAMP-CRP by probing which purine residues could be protected from methylation by cAMP-CRP (4). Again, DNA fragment F-1 (see Fig. 1) was specifically labeled at one or the other of its 5' ends. This fragment was then allowed to react with dimethyl sulfate in either the presence or the absence of cAMP-CRP. As can be seen in Fig. 4, one residue, G -35 on the lower strand, was strongly protected by cAMP.CRP. Weaker protection occurred at G -37 on the lower strand and at G-39 on the upper strand.
DISCUSSION The results presented here (see Fig. 5 for summary) indicate that cAMP-CRP interacts with a gal DNA segment located between 50 and 24 base pairs preceding the start site of PI mRNA. Many sites in this segment are protected by cAMP-CRP from DNase digestion. This protection by CRP is strictly dependent on cAMP at concentrations of the cyclic nucleotide that are identical to those needed for CRP-dependent activation of PI or inhibition of P2. Within this protected segment a number of sites exhibit an enhanced sensitivity to DNase as a result of cAMP-CRP interaction with gal DNA. They appear at regularly spaced intervals in the protected sequence at -42, -34, and -23 on the upper strand (and -49, -40, and -30 on the lower strand). In addition, two other sites at -16 and -14 on the upper strand exhibit an enhanced sensitivity to DNase. These latter sites lie within the Pribnow "heptamer" for P2 and precede by a few bases the "heptamer" for P1. These heptamers are located about 5 to 6 bases preceding the start site of transcription in different prokaryotic promoters and show a high degree of conservation (13, 14). Bases within these heptamers could participate in the localized DNA melting associated with the formation of a stable RNA polymerase-promoter complex (13). The interactions of cAMP-CRP with the -50 and -25 region could thus cause a conformational change in the DNA structure in the P2 heptamer. This structural change, in addition to the protein-protein interactions between cAMP-CRP and RNA polymerase, might favor formation of a stable complex at PI or inhibit the formation of such a complex at P2. Our results clearly indicate that cAMP-CRP does not bind to the -70 to -50 region in gal, a segment that presents homologies both in sequence and in symmetry with the CRP-binding site in lac located between -70 and -50. Fur-
-70
-80
5093
thermore, this gal segment is not needed for CRP binding at -50 to -25, because removal of the sequences to the left of -59 does not alter the cyclic AMP concentration dependency of CRP binding. Earlier results had, in fact, strongly suggested that the -70 to -50 segment was not the gal CRP-binding site (8). Indeed several galOc mutants map in this segment between -66 and -55 (ref. 8; M. Irani and S. Adhya, personal communication). These Oc mutants exhibit the same cAMP-CRP dependent stimulation of PI and repression of P2 as wild-type gal DNA. One such gal mutant results in an identical base change (G-C to A-T) as a lac CRP-binding site mutant and is located the same distance from the cAMP-CRP-dependent initiation site in gal and in lac (8, 11). This mutation severly reduces the cAMP-CRP response in lac but leaves it unchanged in gal. In other experiments the cAMP-CRP interaction site on gal DNA was also functionally mapped by examining whether sequences to the left of the HinfI cleavage site at -59 were needed for transcriptional control of P1 and P2 activity. Transcription of two hybrid DNA fragments in which the segment to the left of -59 was replaced by two different unrelated DNA sequences exhibits a cAMP-CRP response for P1 stimulation or P2 repression identical to that of wild-type gal DNA (unpublished data). Hence, the DNA sequence to the right of -60 contains all the specific interaction sites needed for the cAMP-CRP-dependent activation of P1 and repression of P2. It is clear that the location of the cAMP-CRP interaction site in gal is very different from the CRP-binding site in the lac operon. The identity of this site in lac has been firmly established by DNA sequencing of CRP-binding site mutants and by chemical protection experiments (ref. 11; J. Majors, personal communication). In gal the -50 to -70 segment covers the site where the repressor interacts with gal DNA. We wished to determine more precisely the sequence within these CRP regulatory regions that is recognized by CRP. In this analysis, we employed the following criteria: (i) the common CRP recognition sequence should be altered by the CRPbinding site mutations known in lac and should include the bases protected by or from dimethyl sulfate in lac and in gal; (ii) the sequence should be consistent with the size of CRP (7), spanning 10-15 base pairs; (iii) the sequence should accommodate a dimer, presenting similar sequence elements to each subunit; (iv) the region of the DNA protected against DNase by CRP should be approximately coextensive with the occurrences of the CRP recognition sequence. A computer was utilized to search for homologies in the lac and gal sites that might satisfy these criteria. The regulatory region between araC and araBAD is also known to be involved in complex interactions with cAMP-CRP (15, 16) and was therefore included in this search. The result pointed to a sequence appearing twice in the CRP site of lac, symmetrically located about the dyad axis centered at -60/-61 (11, 17), ap-
-60
G C T ^ ^ A T TC T T a T a ^ ^ ^ C a^0 0
GGCTAAATTCTTGTGTAAACGAT CCGATTTAAGAACACATTTOCTAA
-50 T CC
ACT
^AT T TOT T C
-40
C0)MZJ
AGO T OAT TA AAT A A GT
CAGTT G *
I
pi -30
TbT)T
j-20
-10
C T T TGT A AAG C G TAG A A AC A:A TAC 0
I
+10
G G T TAT T T CAT A C C A T A A G A TA CC A A TATA G TAT GOT AT V C
CT
'--~~~~~~~~~~~~~
FIG. 5. Summary of protection data. Circles indicate protection against DNase digestion by cAMP-CRP at the 3' side of the indicated base. Arrows indicate enhancement of digestion by DNase at the 3' side of the indicated bases. Square indicates base protected by cAMP-CRP from methylation by dimethyl sulfate. P1 and P2 refer to the respective initiation sites for the P1 and P2 promoter (1). Boxed sequences indicate the Pribnow heptamers for each of the two promoters. The upper strand reads 5' - 3' from left to right.
5094
Biochemistry: Taniguchi et al.
pearing three times in the gal CRP region, and five (or more) times in the ara regulatory region (18, 19). These sequences are listed as follows: lac -73 T-T-A-A-T-G-T-G-A-G-T -63 -50 A-A-T-G-A-G-T-G-A-G-G -60
gal -21 A-A-G-A-T-G-C-G-A-A-A -31 -30 A-A-A-G-T-G-T-G-A-C-A -40 -44 T-C-C-A-T-G-T-C-A-C-A -34 ara -29 A-A-A-G-C-G-T-C-A-G-G -39 -82 A-A-A-G-T-G-T-G-A-C-G -92 -141 A-A-A-G-T-G-T-C-T-A-T -131
-148 A-A-A-G-C-G-C-T-A-C-A -138 -158 A-A-A-G-C-G-C-T-A-C-A -148 The consensus sequence obtained from this list is 5' A-AA-G-T-G-T-G-A-C-A 3'. This sequence appears without changes in gal from -30 to -40. The underlined region of the sequence seems to be most important for recognition. The two Gs in this region are strongly implicated by methylation experiments both in the lac (J. Majors, personal communication) and in the gal sites. The first G and the A are totally conserved within this list. A transition of the second G to A constitutes the symmetric CRP mutations that Dickson et al. (11) have determined in the lac CRP site. This sequence is generally distinguished from rather similar sequences that appear in numerous promoters in the -35 region (20) and in the lac, gal, and X operators (8, 20, 21) by differences in the underlined region of the sequence. The consensus sequence also satisfies criteria i and iii above because it is the right size and can, according to our preliminary analysis, accommodate a dimer of identical subunits in either a direct repeat or an inverted repeat arrangement. We find that cAMP.CRP protects a gal segment that is larger than the sequence presenting homologies with the lac CRP sites in gal. This could be due to binding of CRP to adjacent weaker sites. The binding of CRP to these weaker sites might be stabilized by protein-protein interactions. In fact, two additional sites with partial homology with the proposed recognition sequence were found within the protected sequence (-21 to -31 and -44 to -34). How can the difference in location between the CRP-binding sites in lac and in gal be reconciled with their similar effects on activation of transcription? One possible explanation would be that the interaction between CRP and RNA polymerase occurs around -35 in both gal and lac. In lac the primary binding site for CRP is obviously at -70 to -50, but the binding of CRP to a secondary binding site around -35 might also be stabilized by CRP-CRP or CRP-RNA polymerase interactions. In fact, the gal sequence -30 -36 A-C-A-C-T-T-T T-G-T-G-A-A-A is also found in lac from -34 to -28. This sequence constitutes part of what we think is the CRP recognition sequence in
gal.
The interaction of an activator for gene transcription such
as cAMP-CRP with promoter DNA around -35 is not unique to gal. Indeed, recent experiments on the stimulation of the X PRM promoter by the X repressor support this notion. Although the X repressor preferentially binds to a site 59 to 75 base pairs preceding PRM, its binding to a segment between -35 and -51 is essential for PRM stimulation. Interaction of the X repressor with the -59 to -75 site induces a cooperative binding of the repressor to the -35/-51 site (B. Meyer and M. Ptashne, per-
sonal communication).
Proc. N.tl. Acad. Sci. USA 76 (1979)
Our results establish that factors that activate transcription initiation can interact with promoters between -50 and'-25. The sequences around -35 are one of two regions of homology in prokaryotic promoters (20), the other being the heptamer centered at -10 (7, 13, 14). In the lac UV5 promoter RNA polymerase makes contact with a G residue at -32 (4). The segment around -35 is also the site of several promoter mutations. These mutations either decrease or increase promoter activity. They alter the binding of RNA polymerase or change the rate of initiation of transcription at these promoters (20, 22-25). The proposed CRP recognition sequence in the same region in gal probably provides some of the necessary interactions for productive initiation of transcription at P1. The location of the CRP-binding site strongly suggests that initiation of transcription includes protein-protein interactions between cAMP-CRP and RNA polymerase in gal DNA and maybe also in other cAMP-dependent promoters. We are grateful to Joe Krakow for CRP. We thank Linda Harris for secretarial assistance and Ray Steinberg for the illustrations. 1. Musso, R. E., DiLauro, R., Adhya, S. & de Crombrugghe, B. (1977) Cell 12,847-854. 2. de Crombrugghe, B. & Pastan, I. (1978) in The Operon, eds. Miller, J. H. & Reznikoff, W. S. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY), pp. 303-324, 3. Galas, D. & Schmitz, A. (1978) Nucleic Acids Res. 5, 31573170. 4. Johnsrud, L. (1978) Proc. Natl. Acad. Sci. USA 75, 53145318. 5. Maniatis, T., Jeffrey, A. & Kleid, D. G. (1975) Proc. Nati. Acad. Sci. USA 72, 1184-1188. 6. Maxam, A. M. & Gilbert, W. (1977) Proc. Nati. Acad. Sci. USA
74,560-564.
7. Anderson, W. B., Schneider, A. B., Emmer, M., Perlman, R. L. & Pastan, I. (1971) J. Biol. Chem. 246,5929-5937. 8. DiLauro, R., Taniguchi, T., Musso, R. & de Crombrugghe, B. (1979) Nature (London) 279,494-500. 9. Emmer, M., de Crombrugghe, B., Pastan, L. & Perlman, R. (1970) Proc. Nati. Acad. Sci. USA 6 480-487. 10. Musso, R., DiLauro, R., Rosenbeg, M. & de Crombrugghe, B. (1977) Proc. Natl. Acad. Sci. USA, 74, 106-110. 11. Dickson, R. C., Abelson, J., Johnson, P., Reznikoff, W. S. & Barnes, W. M. (1977) J. Mol. Biol. 111, 65-75. 12. Majors, J. (1975) Nature (London) 256, 672-674. 13. Pribnow, D. (1975) Proc. Nati. Acad. Sci. USA 72,784-788. 14. Schaller, H., Gray, C. & Herrman, K. (1975) Proc. Natl. Acad. Sci. USA 72,737-741. 15. Greenblatt, J. & Schleif, R. (1971) Nature (London) New Biol. 233, 166-170. 16. Casadaban, M. (1976) J. Mol. Biol. 104,557-566. 17. Gilbert, W. (1976) RNA Polymerase, eds. Losick, R. & Chamberlin, M. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY), pp. 193-205. 18. Greenfield, L., Boone, T. & Wilcox, G. (1978) Proc. Natl. Acad. Sci. USA 75,4724-4728. ,19. Smith, B. & Schleif, R. (1978) J. Biol. Chem. 253,6931-6932. 20. Reznikoff, W. S. & Abelson, J. N. (1978) in The Operon, eds. Miller, J. & Reznikoff, W. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY), pp. 221-243. 21. Maniatis, T., Ptashne, M., Backman, K., Fleid, D., Flashman, S., Jeffrey, A. & Maurer, R. (1975) Cell 5, 109-113. 22. Meyer, B. J., Kleid, D. G. & Ptashne, M. (1975) Proc. Natl. Acad. Sci. USA 72,4785-4789. 23. Kleid, D., Humayun, Z., Jeffrey, A. & Ptashne, M. (1976) Proc. Natl. Acad. Sci. USA 73,293-297. 24. Maquat, L. E. & Reznikoff, W. S. (1978) J. Mol. Biol. 125, 467-490. 25. Calos, M. P. (1978) Nature (London) 274,762-765.
