JOURNAL

OF

BACTERIOLOGY, OCt. 1990, p. 5706-5713

Vol. 172, No. 10

0021-9193/90/105706-08$02.00/0 Copyright © 1990, American Society for Microbiology

The CytR Repressor Antagonizes Cyclic AMP-Cyclic AMP Receptor Protein Activation of the deoCp2 Promoter of Escherichia coli K-12 LOTTE S0GAARD-ANDERSEN, JAN MARTINUSSEN, NIELS ERIK M0LLEGAARD,t STEPHEN R. DOUTHWAITE, AND POUL VALENTIN-HANSEN*

Department of Molecular Biology, Odense University, Campusvej 55, DK-5230 Odense M, Denmark Received 19 April 1990/Accepted 7 July 1990

We have investigated the regulation of the Escherichia coli deoCp2 promoter by the CytR repressor and the cyclic AMP (cAMP) receptor protein (CRP) complexed to cAMP. Promoter regions controlled by these two proteins characteristically contain tandem cAMP-CRP binding sites. Here we show that (i) CytR selectively regulated cAMP-CRP-dependent initiations, although transcription started from the same site in deoCp2 in the absence or presence of cAMP-CRP; (ii) deletion of the uppermost cAMP-CRP target (CRP-2) resulted in loss of CytR regulation, but had only a minor effect on positive control by the cAMP-CRP complex; (iui) introduction of point mutations in either CRP target resulted in loss of CytR regulation; and (iv) regulation by CytR of deletion mutants lacking CRP-2 could be specifically reestablished by increasing the intracellular concentration of CytR. These findings indicate that both CRP targets are required for efficient CytR repression of deoCp2. Models for the action of CytR are discussed in light of these findings.

The deo operon of Escherichia coli K-12, which encodes nucleoside- and deoxynucleoside-catabolizing enzymes, is expressed from two promoters, deoCp1 and deoCp2 (formerly deoPI and deoP2), located 599 base pairs (bp) apart (29). In deoCp1, promoter control is mediated by the DeoR repressor, whereas deoCp2 is subject to negative regulation by the DeoR and CytR repressors and activation by the cyclic AMP (cAMP)-cAMP receptor protein (cAMP-CRP) complex (29, 34). The DeoR repressor binds cooperatively to three widely spaced operators, two of which overlap the Pribnow boxes of deoCp1 and deoCp2 (5, 6, 19, 30). DeoR thus functions as a classical type of repressor blocking the access of RNA polymerase to the promoter. The mechanism of action of CytR is less straightforward. The activity of all CytR-regulated promoters studied so far is highly dependent on the cAMP-CRP complex. Three such promoters have been sequenced (deoCp2, cdd, and tsx-p2), and all possess tandem cAMP-CRP binding sites (14, 29, 32). In deoCp2, the cAMP-CRP binding sites are located around positions -40 (CRP-1) and -93 (CRP-2) preceding the start site for transcription (Fig. 1). We have undertaken a detailed study of the in vivo activity of the deoCp2 promoter to clarify the mechanism of CytR regulation and cAMP-CRP activation. Transcriptional and translational gene fusions between deoCp2 and the lac genes in low-copy-number vectors exhibiting a copy number of 1 per genome at 30°C (12, 30) have been used to study the regulatory sequences controlling expression from deoCp2. Here we present evidence that activation by cAMP-CRP and repression by CytR is coupled.

MATERIALS AND METHODS

In vitro DNA manipulations. Restriction endonucleases, T4 DNA ligase, Klenow fragment of E. coli DNA polymerase I, T4 polynucleotide kinase, S1 nuclease, and bacterial alkaline phosphatase were purchased from Boehringer Mannheim. Modified T7 DNA polymerase (Sequenase) was from U.S. Biochemical Corp. 32P-labeled nucleotides were purchased from DuPont-NEN. Isolation of plasmid DNA, cloning, transformation of E. coli with plasmid DNA, and gel analyses of recombinant plasmids were carried out by standard techniques as described by Maniatis et al. (13). Bacterial strains. All strains were E. coli K-12 derivatives: S0928 (Adeo Alac deoR+ cytR+), S0929 (Adeo Alac deoR+ cytR15) (34), S01928 (Adeo Alac deoR+ cytR+ TnJO::ilvA Acya), S01929 (Adeo Alac deoR+ cytRi5 TnlO::ilvA Acya). The Acya allele was transferred by P1 vir transduction with a lysate grown on BRE2111 (TnlO::ilvA Acya) (gift of Erhard Bremer). RM1036 A(lac-pro) thi rpsL supE endA sbcB r m mutD5 zaf-13::TnJO/F' traD36 proAB lacIqAM15 was isolated by R. Maurer and obtained through E. Bremer. Growth of bacteria. Cells were grown in LB (2) or AB (4) medium with glycerol or glucose as the carbon source. Plasmids. To create pJEL134, the HgaI-AvaII fragment extending from -116 to +98 of deoCp2 was cloned into the SmaI site in the single-copy fusion vector pJEL122 (28) after filling in the 5' ends. This results in a translational fusion between deoC and lacZ flanked by EcoRI and BamHI sites (28). To create pJEL136, the SfaI-AvaII fragment extending from -87 to +98 of deoCp2 was cloned into the SmaI site of pJEL122 after filling in the 5' ends. This also results in a translational fusion between deoC and lacZ flanked by EcoRI and BamHI sites (28). To create pJEL152, the EcoRI-EcoRI* (EcoRI* restricts at AATT sequence) fragment (extending from -116 to +18) of pJEL134 was cloned into the EcoRI site of the single-copy

* Corresponding author. t Present address: Department of Biochemistry B, Panum Institute, Copenhagen University, Blegdamsvej 3C, DK-2200 Copen-

hagen N, Denmark. 5706

cAMP-CRP AND CytR-REGULATED PROMOTERS

VOL. 172, 1990

A

HgaI -125

5707

Avai

-100 -80

CRP-2

B -120

-60

-40

-20

CRP-1

+1

+95

+45

deoC'

-10 deoO

-

53

+1

+7

TCATTTGAAAGTGAATTATTTGAACCAGATCGCATTACAGTGATGCAAACTTGTAAGTAGAtTTCCTTAATTGTGATGTGTATCGAAGTGTGT TGCGGAGTAGATGT TAGAATACTAACAAACTCG

I \ I\\x \\\\\1\\ I''''''''1'''' L4CRP-2

C

A(-98)

-

T(-89)

CRP-1

-10

T( -36)

FIG. 1. (A) Map of the deoCp2 promoter. Coordinates are in base pairs; +1 refers to the start site for transcription as indicated by the arrow. Hatched bar labeled deoC' indicates the 5' end of the deoC gene. Remaining hatched bars indicate regions protected by cAMP-CRP in DNase I protection experiments (CRP-1 and CRP-2) and the -10 region of the deoCp2 promoter. Open bar indicates the DeoR operator (deoO). (B) Nucleotide sequence of deoCp2. Only the sequence corresponding to the coding strand of deoC is shown; CRP-1, CRP-2, and -10 regions are indicated. Arrows indicate region of homology between different cAMP-CRP binding sites (8). The center-to-center distance of 53 bp between the two CRP sites is shown. (C) Nucleotide changes in Oc point mutations.

fusion vector pJEL126 (30). This results in a transcriptional deoCp2-lacZ fusion. The copy number of these three fusion plasmids remains unchanged in the different strains (cytR and cytR+, cya+ and Acya) used in this study.

To create p46-213, the cytR gene without its promoter and Shine-Dalgarno sequence was cloned downstream of the tac promoter (7) in the vector pKK223-3 (Pharmacia). From this construct, a BamHI fragment encoding the tac promoter and the entire structural cytR gene was subcloned into the BamHI site of the p15 replicon pGA46 (1). The CytR content in a strain containing this plasmid is 0.1 to 0.5% of the total protein in the absence of Lacd (as judged from Coomassiestained sodium dodecyl sulfate-polyacrylamide gels of totalcell extracts). The growth rate of these cells is reduced by approximately 10%. 13-Galactosidase activity measurements. Measurements of P-galactosidase activity were carried out as described by Miller (16). Samples were taken at an OD450 between 0.2 and 0.6, and cells were grown at 30°C. Specific activity of 0-galactosidase is expressed as OD420 units per OD450 unit per milliliter per minute (30). DNA sequencing. DNA fragments were labeled at their 3' end with the Klenow fragment of DNA polymerase I and purified as previously described (31). Radioactively labeled fragments were sequenced by the chemical modification procedure of Maxam and Gilbert (15). Sequencing of M13 single-stranded DNA with modified T7 DNA polymerase (Sequenase) was performed according to the supplier's recommendations (U.S. Biochemical Corp.). Isolation of deletion mutants. EcoRI-restricted pJEL134 was subjected to S1 nuclease treatment at 20°C. Digestion was halted by adding portions to phenol every 5 min for 1 h. DNA from samples containing deletions down to about position -20 (Fig. 1) were cloned in the SmaI-BamHI sites in the fusion vector pNM480 (17), creating a translational fusion between deoC and lacZ, and were selected on MacConkey lactose agar as Lac' colonies in S0929. From these constructs, EcoRI-BamHI fragments were cloned in pJEL122, creating identical deoC-lacZ fusion points on the single-copy vector pJEL122. With this strategy, all deletions have the same sequences (5'-GAATTCCC-3') upstream of the deo DNA. Isolation of operator-constitutive mutants in vivo. Plasmid

pJEL134 was mutagenized in vivo by transformation into the mutator strain RM1036 (25). Isolated plasmid DNA was then retransformed into strain S0928. Colonies exhibiting resistance to ampicillin and increased expression of lac were selected. Of 20 Lac' colonies that were chosen for further studies, approximately 50% were judged from their resistance level to ampicillin to be copy number mutants and were consequently discarded. The 220-base-pair (bp) EcoRIBamHI fragment was recloned from the remaining plasmid candidates into pJEL122. Candidates that still exhibited an operator-constitutive phenotype were analyzed further by sequencing. Site-directed mutagenesis. The 220-bp EcoRI-BamHI fragment of pJEL134 was cloned in the EcoRI-BamHI sites in mpl9 (35). The oligonucleotides 5'-GTG AAT TAT TTA AAC CAG-3' and 5'-GTG ATG TGT ATT GAA GTG TGT TG-3' (gifts from Otto Dahl) were used to introduce a G to A transition at position -98 (italics) and a C to T transition at position -36 (italics), respectively, following the mutagenesis procedure of Taylor et al. (26). The EcoRI-BamHI fragment from the replicative form of M13 containing the mutation was cloned into pJEL122. Si mapping. RNA isolation, labeling of DNA, hybridization, and S1 nuclease treatment were carried out as described previously (29, 31). DNase I protection. Footprinting studies were carried out as described by Galas and Schmitz (9). CRP was purified by the procedure of Ghosaini et al. (10). RESULTS CytR regulation in deoCp2. The plasmid pJEL134, encoding a protein fusion between deoCp2-deoC' and lacZ', contains all the sequence information required for CytR- and cAMP-CRP-regulated expression of deoCp2 (28). The cloned fragment encodes two cAMP-CRP binding sites, a single DeoR operator, the start site for transcription, and the proximal part of the first structural gene in deo (deoC) (Fig. 1). Previous experiments (5, 30) have shown that promoter fragments which only contain one operator for DeoR are regulated weakly (twofold) by this repressor. As all strains used in this work are deoR+ and the DeoR operator is not perturbed in any of the plasmid constructs, P-galactosidase expression from pJEL134 reflects only cAMP-CRP activation and CytR regulation.

5708

S0GAARD-ANDERSEN ET AL.

J. BACTERIOL.

TABLE 1. ,B-Galactosidase specific activity expressed from deoCP2-lacZ fusions p-Galactosidase activitya

Fusionplasuid pJEL134

cya CRP-2

R-

CRP-1

r

pJZL134-89

1

p,JEL134-98

r

pJBL136

* E

'_

cytR cya cytR+ cya cytR

deoC

0.9

9

0.3

0.3

*

00.2

1.8

0.07

0.07

'-"

1.1

3.6

0.3

0.3

r

3.4

7

0.3

0.3

3.6

7

0.3

0.3

7

7

0.3

0.3

R-1

pJEL152b pJEL134-36

cytR+ cya'

-l *--

cya+ p46-213

0.1

cya p46-213

0.3

0.5

(A&cya)

a Activity was measured after exponential growth with glycerol (cya+) or glucose as the carbon source. Activity units are defined in the text. b The lower activities expressed from the operon fusion are most likely due to transcriptional polarity (for a discussion, see Valentin-Hansen et al. [30]).

The regulatory features of pJEL134 are shown in Table 1. In the presence of the cAMP-CRP complex, initiation of transcription from deoCp2 was repressed 10-fold by CytR. To investigate deoCp2 activity and regulation in the absence of the cAMP-CRP complex, we introduced pJEL134 into strains unable to synthesize cAMP (Acya). As shown in Table 1, 3-galactosidase activities remained unaffected by CytR and were reduced 30-fold relative to the level in a cytR cya+ strain. As it could be argued that the lack of CytR regulation on cAMP-CRP-independent initiations is caused by a decreased expression of cytR in the Acya background, we introduced the CytR-overproducing plasmid p46-213 (in which cytR is expressed from the tac promoter; see Materials and Methods) into cya+ and Acya strains harboring pJEL134. Although enhanced repression was observed in cya+ cells, we did not find any repression in the Acya background (Table 1). Thus, these results clearly show that in the absence of the cAMP-CRP complex, the CytR repressor cannot modulate initiations from the deoCp2 region. Mapping of the initiation site for transcription. Transcription assays, both in vivo and in vitro, have previously defined the start site for deoCp2 initiation of transcription in a cya+ background (29). To test whether transcription in vivo could possibly occur at a significant level from another start site in a Acya background, total RNA was isolated from cya+ and Acya strains harboring pJEL134. Si mapping analyses showed that transcription initiated at the same site in both strains (Fig. 2, left panel). Deletion mapping of deoCp2. The CRP-2 site, the spacer region between the two CRP targets, and CRP-1 were deleted stepwise in pJEL134 (Fig. 3) to define the sequence information required for regulated expression of deoCp2. The regulatory features of these deletion mutants are shown in Fig. 3. Deletion mutants lacking CRP-2 were no longer regulated by CytR. In addition, removal of CRP-2 resulted in a 20% reduction of promoter activity, whereas deletions that extended into CRP-1 had a strong effect on the promoter activity, which was gradually reduced to 3% of that of the intact promoter. In Acya strains, the promoter activity remained unaffected by the deletions with the exception of those large enough to extend into CRP-1. The operon fusion (pJEL152), encoding deoCp2 information from -116 to + 18, was constructed to examine whether the regulatory pattern of deoCp2 was affected by downstream deo sequences. Since the regulatory response of this operon fusion was similar to that of pJEL134 (Table 1), we

can conclude that pJEL152 encodes all the information required for regulated expression of deoCp2. Operator-constitutive mutations in deoCp2. To locate the operator for the CytR repressor more precisely, we isolated deoCp2 mutants with a reduced regulatory response to CytR. Use of pJEL134 facilitated the screening for mutants with an elevated lacZ expression in the presence of the CytR repressor. Three independent mutants of pJEL134 were isolated. All three mutants carried the same single-base-pair mutation in the CRP-2 target, C G to T- A at position -89 (Fig. 1). Based on this result, we changed the symmetrically located G. C base pair of CRP-2 at position -98 to A. T and the formally identical C G base pair in CRP-1 at position -36 to T. A by site-directed mutagenesis (Fig. 1). Table 1 shows the specific activity of P-galactosidase expressed from the mutants pJEL134-36, pJEL134-89, and pJEL134-98. The activity was partially constitutive and was only regulated two- to threefold by CytR under cya+ conditions. In addition to a reduced regulatory response to CytR, the mutations in CRP-2 resulted in a 20% reduction of promoter activity in a cya+ cytR strain, whereas the mutation in CRP-1 resulted in a more drastic decrease of 60% in promoter activity in the same genetic background. Thus, the promoter activity of the CRP-2 mutants is very similar to those obtained with the fully constitutive mutants lacking the CRP-2 target (Fig. 3 and Table 1, pJEL136). The transcriptional start site of the operator-constitutive (0C) mutants in Acya and cya+ strains was determined by Si mapping. In all cases, transcription was found to initiate at position +1 (Fig. 2, right panel), ruling out the possibility that the Oc phenotype is caused by the introduction of a new promoter. These results clearly show the importance of the tandem CRP targets for CytR repression of deoCp2. CRP protection of deoCp2. Genetic and biochemical data have shown that point mutations analogous to those in our Oc mutants prevent stable CRP binding in several other promoter regions (for a review, see reference 8). Consequently, we performed DNase I footprinting to test whether this is also the case in deo and to estimate the relative affinities of the cAMP-CRP complex for the different deoCp2 targets. Figure 4 shows an autoradiogram of the cAMP-dependent protection of the two O' mutants with mutations in CRP-2 and the wild-type deoCp2 promoter. CRP gave a clear cAMP-dependent footprint at around -40 and -90 in both the wild type and Oc mutants when saturating concentrations of both CRP and cAMP were used (Fig. 4, left panel).

VOL. 172, 1990

~.

cAMP-CRP AND CytR-REGULATED PROMOTERS

5709

-AMNA..

,qw,

to

*806

.m.

.ikd

NW,

*w X

4

4

a "^

I-

A B C

D

E

F G H

I

J K

0-W ,...

_,w , w

"0 *.

901 -I

+1

Of

.i

1- n... .: !:::

a-`

FIG. 2. S1 nuclease mapping of deoCp2-specific RNAs expressed from the wild-type promoter (pJEL134, left panel) and the Oc mutants (pJEL134-36, pJEL134-89, and pJEL134-98, right panel) in cya+ (S0929) and zAcya (S01929) backgrounds. Approximately 0.1 ,xg of the 22-bp EcoRI-BamHI fragment 32p labeled at the BamHI 5' end and 25 to 150 ,ug of RNA were used per reaction. The S1 digestion was carried out for 4 min (left panel, lanes D and E; right panel, lanes A, C, E, G, I, and J) or 10 min (left panel, lanes C and F; right panel, lanes B, D, F, and H) with 100 U of Si nuclease per reaction. (Left panel) Lane A, Control (RNA from S0929); lane B, A+G sequence of the hybridization probe; lanes C and D, RNA from S01929 harboring pJEL134; lanes E and F, RNA from S0929 harboring pJEL134. (Right panel) Hybrids formed between the DNA probe and RNA isolated from S0929 (lanes A, B, and E to H) or S01929 (lanes C, D, I, and J) harboring plasmid pJEL134-36 (lanes A to D), pJEL134-89 (lanes E, F, and I), or pJEL134-98 (lanes G, H, and J). The weak bands around +15 are due to cleavage by Si nuclease in an A+T-rich region (29).

However, this picture changed when the cAMP and CRP concentrations were reduced. At a low cAMP concentration (0.1 puM), the CRP protein protected only the wild-type CRP-2 target (middle panel, lane 4). Protection of the wildtype CRP-1 target as well as both targets in the Oc mutants was not seen until a higher cAMP concentration (5 ,uM) was used (middle and right panels, lanes 12 and 6, respectively). Also, the Oc mutants showed a weaker protection of the unmutated site (CRP-1) (Fig. 4, middle and right panels). In

addition, these OC mutants displayed an altered DNase I digestion pattern between the two CRP targets, probably reflecting an altered DNA conformation in this region. For the OC mutant with a mutation in CRP-1, the CRP footprint was unchanged from that for the wild-type promoter except that CRP-1 protection was not observed until the cAMP concentration reached 20 F.M (data not shown). It appears, therefore, that the cAMP-CRP complex has a higher affinity for wild-type CRP-2 than wild-type CRP-1 and

J. BACTERIOL.

S0GAARD-ANDERSEN ET AL.

5710

SPECIFIC ACTIVITY OF

P-GALACTOSIDASE

A CYA

9.0 k_

O A

7.0 _ 5.0

CYTR'

* CYA+CYTR

A *

CYA-CYTR

*A

FOLD OF CYTR REGULATION

7k 5k

-

3.0 _ 1.0 k

10 9

I

3k1

A

*

ONam

CRP-2 0.4 0.3 0.2

-

0

0

0 00

00 0 0

* a

CRP-1

-10

A 0

0

a

0

ATTCATTTGAAA6TGAAT TATTTGAACCABATCGCATTACA6T6ATGCAAACTT6TAA6TA6A TTTCCTTAATT6T6AT6TGTATC6AA6T6T6TTGC66AGTAGATGTTAGAATACTAACAAACTCG

I pJEL134

II

pJEL.136 1361 1362

I\m

1364 1367

1368 1369

1372

1373

+1

1363 FIG. 3. Specific activity of f3-galactosidase expressed from deoCp2-lacZ fusions in different regulatory strains. The abscissa shows the relevant part of the nucleotide sequence of deoCp2; + 1 refers to the start site for initiation of transcription; hatched bars are the -10 region, CRP-1, and CRP-2. The deo sequence in each fusion extends from the AvaII site at position +98 to the position indicated below the abscissa; the ordinate shows specific activity of ,B-galactosidase. The numbers of the pJEL134 deletion constructs are indicated below the abscissa. (Inset) CytR regulation in deoCp2-lacZ fusions as a function of the endpoint of the deletion in deoCp2. This value was calculated as the specific activity of p-galactosidase in a cya+ cytR strain divided by the specific activity of P-galactosidase in a cya+ cytR+ strain. Hence, each square indicates the endpoint of the deletion in deoCp2 and the fold of CytR regulation in that particular construct. The two leftmost squares correspond to plasmids pJEL133 (endpoint at position -280) (28) and pJEL190 (endpoint at position -606) (30).

that the affinity of cAMP and CRP for the mutated CRP-2 sites is reduced. Effect of excess CytR. To further characterize the function of CRP-1 in CytR regulation, we tested whether it was possible to reestablish CytR regulation in a deoCp2 promoter lacking CRP-2 by increasing the intracellular concentration of CytR. Accordingly, the CytR-overproducing plasmid p46-213 was introduced into a cya+ cytR strain harboring pJEL134 (wild type) or pJEL136 (ACRP-2). CytR regulation was indeed reestablished by the increased concentration of CytR (Table 1). As a control, expression of ,-galactosidase from a deoCpl-lacZ fusion on a single-copy vector (pVH146) (30) was measured with and without p46-213, to check whether the effect on pJEL136 was due to an unspecific inhibitory effect on promoter activity caused by a high concentration of CytR. No effect was found on deoCpl activity (data not shown), indicating that the repression at decCp2 is specific. DISCUSSION The regulation of transcription in many procaryotic systems involves both positive and negative regulatory elements. cAMP-CRP-activated and CytR-regulated promoters are examples of such systems in E. coli. The expression of these promoters responds to carbon source and the presence of cytidine or adenosine in the medium. Using a combination of genetic, biochemical, and gene fusion techniques on single-copy plasmids, we have analyzed one such promoter, deoCp2, to define the DNA sequences involved in positive and negative control by the

cAMP-CRP complex and the CytR repressor. Our results with an intact deoCp2 promoter region clearly show that repression by CytR cannot be obtained in the absence of the cAMP-CRP complex. Even in the presence of a high concentration of CytR in the cell, the level of expression from deoCp2 remains unaffected in a Acya background. Since the start site for transcription is unchanged in cya+ and Acya strains, these results demonstrate that CytR selectively regulates cAMP-CRP-dependent initiation of transcription. A direct connection between CytR regulation and the presence of intact tandem CRP targets in deoCp2 (Fig. 1) was evident from analyses of deletion and point mutations. The results from two point mutations in CRP-2 are consistent with the CRP-2 deletion analysis and show that complete repression of deoCp2 is effective only when CRP-2 is intact, i.e., the deletion mutants are no longer regulated by CytR, while the point mutants exhibit a partially constitutive phenotype (Table 1). Introduction of a point mutation in CRP-1 results in partially constitutive expression of deoCp2; furthermore, CytR regulation can be reestablished in decCp2 derivatives lacking CRP-2 by increasing the intracellular concentration of CytR. Hence, both CRP targets are involved in and required for efficient CytR regulation. In addition, CytR regulation can be reestablished in a deoCp2 promoter deleted for CRP-2 by inserting a synthetic cAMP-CRP binding site precisely five helical turns upstream from CRP-1 and only when inserted at this position (14). Thus, in addition to the tandem CRP targets, the distance between the two targets seems to be an important factor for CytR regulation. Finally,

Wvr I

C, ''

1

(., --1 2

_3

.i

,

1

2

-

Oc

1+-- + -4- 4 -+ -.- -+ -+ + -t + CRf F} .t 1 ) O 0 0 .10 0 1)1 ("0 c'AMP 0P

A

3

'1

C-T-CRP-2 G--A. 90C

5711

cAMP-CRP AND CytR-REGULATED PROMOTERS

VOL. 172, 1990

:

G

-

UCf..21

0

A

1)X b

~~~~R

I

CRP-2

-60

4CR P-1 q

-30.

CRP- 1

-10 t *

1

FIG. 4. Footprint analysis of cAMP-CRP protection of the wild-type (WT) deoCp2 promoter and the OC mutants at positions -98 and -89. A 420-bp RsaI-BamHI fragment covering the entire deoCp2 promoter was isolated from pJEL134, pJEL134-89, or pJEL134-98 and used as a template following 32P end labeling. (Left) Effect of saturating amounts of CRP (10 ,u.g/ml) and cAMP (15 ,uM) on digestion by DNase I. Lane 1, No addition; lane 2, CRP alone; lane 3, CRP and cAMP. (Middle and right) Autoradiographs show the effect of CRP (2 ,ug/ml) and increasing concentrations of cAMP (shown at the top) on DNase I footprint analyses of the wild-type and O' promoters. The first and last lanes of the gels on the left and in the middle are the C+T sequences of the wild-type and OC -89 DNA. The first lane of the autoradiogram on the right is the G sequence of the Oc -98 DNA fragment. The regions protected by cAMP-CRP are marked, and the sequences are numbered with respect to the deoCp2 RNA start site (+1).

the occurrence of tandem CRP binding sites in all CytRregulated promoters studied so far (14, 32; unpublished data) suggests that this is a structural requirement for CytR regulation. The point mutations in CRP-2 are analogous to the L8 and L29 mutations in the CRP target of lac (23) and the P-37 mutation in the gal promoter (3). In gal and lac, these mutations have severe effects on cAMP-CRP activation and in vitro binding of cAMP-CRP. In accordance with this, DNase I protection experiments demonstrated that the cAMP-CRP complex has a reduced affinity for the mutated CRP sites in deoCp2. It is evident from the analysis of deletion derivatives of deoCp2 that efficient cAMP-CRP activation of deoCp2 does not require CRP-2, and therefore CRP-1 is the essential site for promoter activation by cAMPCRP. However, the mutation in CRP-1 only results in a relatively modest decrease in promoter activity compared with the effect in lac and gal. In this context, it is interesting that both deletion of CRP-2 and the introduction of point mutations in this target lead to a 20% reduction in maximal

promoter activity. Furthermore, DNase I footprinting by cAMP-CRP of the CRP-2 point mutations reveals a decreased protection of the CRP-1 target, indicating a reduction in the binding of cAMP-CRP at CRP-1. These observations may reflect a weak cooperative interaction between CRP dimers bound at sites 1 and 2. How CytR exerts its effect still remains to be elucidated. CytR has extensive homology with known DNA-binding proteins like LacI, GalR, PurR, and MalI (22, 24, 33), and CytR contains a region exhibiting a high level of homology to the a-helix-turn-a-helix motif found in the DNA-binding domain of several DNA-binding proteins (20). In addition, amino acid changes in this region of CytR abolish its inhibitory effect on deoCp2 (L. S0gaard-Andersen and P. Valentin-Hansen, unpublished data). These data support the notion that CytR is a DNA-binding protein. A model for the mode of action of CytR must account for the observations in this study that CytR only inhibits cAMPCRP-dependent initiation of transcription and that tandem, intact CRP binding sites are required for repression. This can

5712

S0GAARD-ANDERSEN ET AL.

be envisioned in two fundamentally different scenarios. (i) CytR and cAMP-CRP compete for the same DNA sequences, with CytR binding cooperatively to the tandem CRP sites, i.e., a model which would resemble the cI/Cro system of bacteriophage lambda, in which the cI and Cro proteins bind to the same DNA sequences and each excludes the binding of the other (21). (ii) CytR could interact with deoCp2 without precluding cAMP-CRP binding to the DNA and antagonize the activating effect of cAMP-CRP either by inducing a conformational change in the DNA or by directly contacting CRP. In this second model, protein-protein interactions between CytR and DNA-bound CRP could be a prerequisite for the interaction of CytR with deoCp2, with CytR forming a bridge between the two DNA-bound cAMPCRP dimers. It is still too soon to distinguish between these possibilities; however, the recent isolation of a crp mutant characterized by specifically inhibiting CytR regulation of the udp promoter (18) points to the second model as the most likely mechanism for CytR action. The classical repressors of transcriptional initiation in E. coli, such as Lacd and DeoR, inhibit the initiation of both factor-dependent and independent transcriptions. CytR differs from such repressors in that it only inhibits factordependent initiations. This mode of activity resembles that found in several eucaryotic systems in which repressors disrupt interactions between transcriptional activators, thereby inhibiting initiation of transcription (for a review, see reference 11). It thus appears likely that the type of regulatory mechanism described here is not merely peculiar to CytR and CRP in E. coli, but possibly illustrates a mechanism of gene regulation that occurs in other types of organisms. ACKNOWLEDGMENTS We thank Pia Hovendahl and Marianne Hald for excellent technical assistance and Irene B. Hansen for carefully typing the

J. BACTERIOL.

10.

11. 12.

13. 14.

15.

16. 17. 18.

19.

20. 21. 22.

manuscript. This work was supported by the Danish Center for Microbiology and grants from the Carlsberg Foundation.

1. 2.

3.

4.

5. 6.

7. 8.

LITERATURE CITED An, G., and J. D. Friesen. 1979. Plasmid vehicles for direct cloning of Escherichia coli promoters. J. Bacteriol. 140:400407. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62: 293-300. Busby, S., H. Aiba, and B. de Crombrugghe. 1982. Mutations in the Escherichia coli gal operon that define two promoters and the binding site of the cyclic AMP receptor protein. J. Mol. Biol. 154:211-227. Clark, D. J., and 0. Maal0e. 1967. DNA replication and the cell cycle in Escherichia coli. J. Mol. Biol. 23:99-112. Dandanell, G., and K. Hammer. 1985. Two operator sites separated by 599 base pairs are required for deoR repression of the deo operon in Escherichia coli. EMBO J. 4:3333-3338. Dandanell, G., P. Valentin-Hansen, J. E. L0ve Larsen, and K. Hammer. 1987. Long-range cooperativity between gene regulatory sequences in a prokaryote. Nature (London) 325:823-826. de Boer, H. A., C. J. Comstock, and M. Vasser. 1983. The tac promoter: a functional hybrid derived from the trp and lac promoters. Proc. Natl. Acad. Sci. USA 80:21-25. de Crombrugghe, B., S. Busby, and H. Buc. 1984. Cyclic AMP receptor protein: role in transcription activation. Science 224:

831-838. 9. Galas, D. J., and A. Schmitz. 1978. DNase footprinting: a simple

23. 24. 25. 26.

27. 28.

29.

30.

31.

method for the detection of protein-DNA binding specificity. Nucleic Acids Res. 5:3157-3170. Ghosaini, L. R., A. M. Brown, and J. M. Sturtevant. 1988. Scanning calorimetric study of the thermal unfolding of catabolite activator protein from Escherichia coli in the absence and presence of cyclic mononucleotides. Biochemistry 27: 5257-5261. Levine, M., and J. C. Manley. 1989. Transcriptional repression of eukaryotic promoters. Cell 3;405-408. L0ve Larsen, J. E., K. Gerdes, J. Light, and S. Molin. 1984. Low-copy-number plasmid-cloning vectors amplificable by depression of an inserted foreign promoter. Gene 28:45-54. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Martinussen, J., N. E. M0olegaard, B. Holst, S. R. Douthwaite, and P. Valentin-Hansen. 1989. A new version of negative control: DNA sequences involved in expression and regulation of CytR and cAMP-CRP controlled genes in Escherichia coli, p. 31-41. In J. D. Gralla, (ed.), DNA-protein interactions in transcription. Alan R. Liss, Inc., New York. Maxam, A., and W. Gilbert. 1980. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65: 499-560. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Minton, N. P. 1984. Improved plasmid vectors for the isolation of translational lac gene fusions. Gene 31:269-273. Mironov, A. S., G. D. Nechayeva, and V. V. Sukhodelets. 1989. Interactions of elements of negative (CytR) and positive (cAMPCRP) regulation in the promoter region of the uridinephosphorylase (udp) gene in Escherichia coli K12. Genetika 25:438-447. Mortensen, L., G. Dandanell, and K. Hammer. 1989. Purification and characterization of the deoR repressor of E. coli. EMBO J. 8:325-331. Pabo, C. O., and R. T. Sauer. 1984. Protein-DNA recognition. Annu. Rev. Biochem. 53:293-321. Ptashne, M. 1986. A genetic switch. Blackwell Scientific Publications, Palo Alto, Calif. and Cell Press, Cambridge, Mass. Reidl, J., K. Romisch, M. Ehrmann, and W. Boos. 1989. MalI, a novel protein involved in regulation of the maltose system of Escherichia coli, is highly homologous to the repressor proteins GaIR, CytR, and Lacd. J. Bacteriol. 171:4888-4899. Reznikoff, W. S., and J. N. Abelson. 1978. The lac promoter, p. 221-243. In H. J. Miller and W. S. Reznikoff (ed.), The operon. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Rolfes, R. J., and H. Zalkin. 1988. Escherichia coli gene purR encoding a repressor protein for purine nucleotide synthesis. J. Biol. Chem. 263:19653-19661. Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions. Cold Spring Harbor Laboratory, Cold Spring.Harbor, N.Y. Taylor, J. W., J. Ott, and F. Eckstein. 1985. The rapid generation of oligonucleotide-directed mutations at high frequency using phosphorothioate-modified DNA. Nucleic Acids Res. 13:8765-8785. Valentin-Hansen, P. 1982. Tandem CRP binding sites in the deo operon of Escherichia coli. EMBO J. 9:1049-1054. Valentin-Hansen, P. 1985. DNA sequences involved in expression and regulation of DeoR, CytR, and cAMP-CRP controlled genes in Escherichia coli, p. 273-288. In R. E. Glass and J. Spicek (ed.), Gene manipulation and expression. Croom Helm, London. Valentin-Hansen, P., H. Aiba, and D. Schumperli. 1982. The structure of tandem regulatory regions in the deo operon of Escherichia coli K12. EMBO J. 1:317-322. Valentin-Hansen, P., B. Albrechtsen, and J. E. L0ve Larsen. 1986. DNA-protein recognition: demonstration of three genetically separated operator elements that are required for repression of the Escherichia coli deoCABD promoters by the DeoR repressor. EMBO J. 5:2015-2021. Valentin-Hansen, P., K. Hammer-Jespersen, F. Boetius, and I. Svenningsen. 1984. Structure and function of the intercistronic

VOL. 172, 1990 regulatory deoC-deoA element of Escherichia coli K12. EMBO J. 3:179-183. 32. Valentin-Hansen, P., B. Holst, J. Josephsen, K. Hammer, and B. Albrechtsen. 1989. CRP/cAMP and CytR regulated promoters in Escherichia coli K12: the cdd promoter. Mol. Microbiol. 3:1385-1390. 33. Valentin-Hansen, P., J. E. L0ve Larsen, P. H0jrup, S. Short, and C. S. Barbier. 1986. Nucleotide sequence of the CytR regulatory

cAMP-CRP AND CytR-REGULATED PROMOTERS

5713

gene of E. coli K12. Nucleic Acids Res. 14:2215-2228. 34. Valentin-Hansen, P., I. Svenningsen, A. Munch-Petersen, and K. Hammer-Jespersen. 1978. Regulation of the deo operon in Escherichia coli. Mol. Gen. Genet. 159:191-202. 35. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mpl8 and pUC19 vectors. Gene 33:103-119.