Vol. 174, No. 3

JOURNAL OF BACTERIOLOGY, Feb. 1992, p. 664-670

0021-9193/92/030664-07$02.00/0 Copyright © 1992, American Society for Microbiology

Positive and Negative Control of ompB Transcription in Escherichia coli by Cyclic AMP and the Cyclic AMP Receptor Protein LIN HUANG, PING TSUI,t AND MARTIN FREUNDLICH* Department of Biochemistry and Cell Biology, State University of New York, Stony Brook, New York 11794-5215 Received 12 August 1991/Accepted 20 November 1991

The ompB operon encodes OmpR and EnvZ, two proteins that are necessary for the expression and osmoregulation of the OmpF and OmpC porins in Escherchia coli. We have used in vitro and in vivo experiments to show that cyclic AMP and the cyclic AMP receptor protein (CRP) directly regulate ompB. ompB expression in an ompB-lacZ chromosomal fusion strain was increased two- to fivefold when cells were grown in medium containing poor carbon sources or with added cyclic AMP. In vivo primer extension analysis indicated that this control is complex and involves both positive and negative effects by cydic AMP-CRP on multiple ompB promoters. In vitro footprinting showed that cyclic AMP-CRP binds to a 34-bp site centered at -53 and at -75 in relation to the start sites of the major transcripts that are inhibited and activated, respectively, by this complex. Site-directed mutagenesis of the crp binding site provided evidence that this site is necessary for the in vivo regulation of ompB expression by cyclic AMP. Control of the ompB operon by cyclic AMP-CRP may account for the observed regulation of the formation of OmpF and OmpC by this complex (N. W. Scott and C. R. Harwood, FEMS Microbiol. Lett. 9:95-98, 1980).

The outer membrane of Escherichia coli contains two major porin proteins, OmpF and OmpC, which allow small hydrophylic molecules to pass into the cell (31). These proteins are encoded by the unlinked ompF and ompC genes (22, 23). The expression of ompF and ompC is reciprocally regulated by the osmolarity of the growth medium, so that OmpF is made preferentially at low osmolarity and OmpC is most prevalent at high osmolarity (52). The expression and osmoregulation of these genes are primarily under transcriptional control mediated by OmpR and EnvZ, the protein products of the ompB operon (22, 23). OmpR is a DNAbinding protein that controls transcription of ompF and ompC by binding to specific sequences upstream from the promoters in these operons (38, 40, 50). EnvZ is an inner membrane protein (16) which is thought to sense the osmolarity of the medium and to subsequently alter OmpR by phosphorylation and dephosphorylation (3, 4, 17, 28, 29). In addition to osmoregulation, the expression of ompF and ompC is affected by a variety of other factors, including growth temperature (33), integration host factor (IHF) (27, 44, 48, 49), stress conditions (6), and cyclic AMP (46). In many of these cases, it is not clear whether these conditions affect ompF and ompC directly or indirectly, through changes in the levels of OmpR and EnvZ (22). In this report, we show by in vitro and in vivo experiments, including primer extension analysis and site-directed mutagenesis, that cyclic AMP and the cyclic AMP receptor protein (CRP) directly regulate the expression of the ompB operon. The overall positive effect by cyclic AMP on ompB expression in vivo appears to be a composite of activation and inhibition by cyclic AMP-CRP of multiple ompB promoters. Cyclic AMP-CRP is negative for those promoters that overlap the CRP binding site and is positive for those that are located further downstream from this site.

MATERIALS AND METHODS Bacteria, plasmids, and preparation of DNA fragments. The Escherichia coli strains and plasmids used in this study are described in Table 1. Plasmid DNA was purified from strains grown in Luria broth (37) and ampicillin (50 ,ug/ml), and restriction enzyme fragments were isolated on 5%

polyacrylamide gels (36). DNase I footprinting. Approximately 0.1 pmol of an AvaIBstBI (-124 to +216) fragment was labeled at the AvaI end (bottom strand) and subjected to DNase I footprinting as described previously (18). In vitro transcription. Single-round transcription assays were carried out essentially as described previously (27). The reaction mixture contained 20 mM Tris-acetate (pH 7.9), 100 mM KCl, 0.1 mM EDTA, 0.1 mM dithiothreitol, 125 ,uM each ATP, GTP, and CTP, 12.5 ,uM UTP, [32P]UTP (3,000 Ci/mmol), AvaI-BstBI template (0.1 pmol), and 1 U of RNA polymerase (U.S. Biochemical Corp.). After incubation for 10 min at 37°C, the reaction was started by adding 4 mM magnesium acetate and rifampin (10 ,ug/ml). The reaction was terminated by adding 1 ,l of proteinase K (20 Rg/ml) and heating at 65°C for 20 min. When used, cyclic AMP-CRP was incubated in the reaction mixture for 20 min before RNA polymerase was added. After adding formamide dye and heating at 90°C for 3 to 5 min, the terminated reaction mixtures were loaded directly onto an 8% polyacrylamide gel containing 8 M urea and fractionated by electrophoresis. Primer extension analysis. Total RNA was isolated (12) from a 10-ml Luria broth (37) culture during exponential growth. Primer extension analysis was done by a modification of the procedure in Ausubel et al. (8). RNA (50 pug) in 40 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid), pH 6.41-1 mM EDTA-0.4 M NaCl-80% formamide was incubated at 30°C for 14 h with 0.6 pmol of synthetic primer DNA labeled at the 5' end with [y-32P]ATP (4,500 Ci/mmol) by using polynucleotide kinase. After ethanol precipitation, the hybridized RNA primer was dissolved in buffer containing 40 mM Tris-HCI (pH 8.0), 5 mM MgCl2, 1 mM dithiothreitol, 50 mM KCI, and 50 ,ug of bovine serum albumin per ,ul. The

* Corresponding author. t Present address: Department of Molecular Genetics, Smith Kline Beecham, Philadelphia, PA 19101.

664

VOL. 174, 1992

DUAL CONTROL OF ompB TRANSCRIPTION BY cAMP-CRP

TABLE 1. Strains and plasmids used Strain or

plasmid Strains JMS65 JM109 MF2705 MF2910 Plasmids pAT428 pKK232-8

pPTS351 pPTS359 pSH2

Relevant cha,actenstics

Source or reference

ompB-lacZ protein fusion recAl recAl JMS65 AhimA82

T. Silhavy This laboratory This laboratory 49

ompB in pBR322 cat vector LH311 ompB promoter fragment in pKK232-8 LH319 ompB promoter fragment in pKK232-8 crp in pBR322

12 42 This study

.

This study 41

665

JM109. Colonies were selected on Luria agar (37) plates supplemented with ampicillin (50 ,ug/ml). Plasmids were analyzed for the RmaI site created by the mutagenesis. The new sequence was confirmed by dideoxy DNA sequencing with Sequenase version 2 (U.S. Biochemical Corp.). The promoterless cat vector pKK232-8 (Pharmacia) and the normal and mutagenized ompB promoter fragments were used to construct ompB-cat transcription fusions. LH311 is the unaltered AvaI-BstBI fragment, and LH319 is the same fragment with the 2-bp change in the CRP binding site. These new plasmids were introduced into strain MF2705. The bacteria were grown in minimal A medium (37) with various carbon sources at 37°C with shaking, and cell extracts were prepared with a Branson 110 sonifier (setting 3, 10 s). Chloramphenicol acetyltransferase activity was measured by the spectrophotometric method of Shaw (47). RESULTS

four deoxynucleotide triphosphates (final concentration, 0.15 mM each) were added. Then, 50 U of RNasin and 40 U of avian myeloblastosis virus reverse transcriptase were added, and the primer extension reaction proceeded for 90 min at 42°C. The reaction was stopped with 20 mM EDTA, 1 p,g of RNase A was added, and incubation was continued for 30 min-at 37TC. The synthesized DNA was extracted with phenol-chloroform-isoamyl alcohol (25:24:1), precipitated with ethanol, suspended in formamide loading buffer, and analyzed on an 8% polyacrylamide-8 M urea sequencing gel. Mutagenesis of the CRP binding site and construction of ompB-cat transcription fusions. The CRP binding site in the ompB promoter region was mutagenized by the inverse polymerase chain reaction (PCR) method of Hemsley et al. (25). Two ''back-to-back" primers, corresponding to the top-strand nucleotides from -45 to -25 and the bottomstrand nucleotides from -46 to -65, were used, except the G* C and T'. A base pairs at -56 and -55 were changed to T* A and A * T, respectively. After a cycle of denaturation at 94°C for 1 min, annealing at 45°C for 1 min, and primer extension at 72°C for 12 min, amplification proceeded through 25 cycles in an Eppendorf Microcycler. The ends of the DNA were made blunt by using Klenow enzyme and subsequently 5'-end phosphorylated. Self-ligation was carried out as described by Hemsley et al. (25) except that the concentration of T4 DNA ligase was increased by 2.5-fold. After ligation, the plasmid was used to transform strain

Cyclic AMP-CRP regulates ompB expression in vivo. During a study of binding of IHF to sites in the ompB promoter region (49), we noted a potential cyclic AMP-CRP binding site immediately upstream of the -35 region of the ompB promoter identified in vitro (Fig. 1) (49). To investigate whether cyclic AMP-CRP influences ompB expression in vivo, we used strain JMS65, which has a chromosomal fusion between the promoter and first structural gene of ompB and lacZ. P-Galactosidase activity was measured in bacteria grown under conditions that varied the intracellular levels of cyclic AMP. The results showed an approximately two- to fivefold increase in 3-galactosidase when cyclic AMP was added to cells grown in a minimal glucose medium or when the cells were grown in minimal medium with a poor carbon source (Table 2). These results suggest that cyclic AMP-CRP plays a role in the in vivo expression of ompB. Primer extension analysis was used to determine whether this regulation was an effect on ompB transcription. Total RNA was extracted from cells and hybridized to an oligonucleotide primer complementary to nucleotides +123 to +142 of the ompB operon (14). The initial experiments were done in cells containing an IHF mutation in order to increase the possibility of detecting ompB transcripts. Strains deficient in IHF have been shown to have increased ompB expression (49). The data in Fig. 2A and B indicate that two major and a number of minor transcripts originate from the ompB promoter region. Transcript Ti initiates at a G residue

-120

-80

CGGGTAACCAGGGGCGTTTTCATCTCGTTGATTCCCTTTGTCTGTTTGATAA -40

TGCGCA[CATTGGGTATAACGTGATCAT ®TCAACAGAATCA1ATAATGTTTCGCC

GAZTAAATTGTATACTTAAGCTOCTGTTTAATATGCTTTGThAC ~~~~~~~LaT1 CTGAAATTCATACCAGATTTAGCTGGTGACGAACGTGA

ATTTAGG ---T2

so

CTTTTTTAAGAAT

FIG. 1. Nucleotide sequence of the ompB promoter region. The nucleotide sequence is taken from Comeau et al. (14). The nucleotides are numbered from the start of transcription of the major transcript (Ti) previously identified in vitro (49) and in vivo (11). Ti and T4 are the proposed start sites for the major and minor cyclic AMP-CRP-inhibited transcripts, respectively. T2 and T3 are the proposed start sites for the major and minor cyclic AMP-CRP-activated transcripts, respectively. The proposed -35 and -10 regions (24) for each transcript are shown by a straight or wavy line, respectively. The start sites for Ti through T4 were estimated by the size of run-off transcripts from in vitro transcription assays (Fig. 4) (49) and by in vivo primer extension analysis (Fig. 2). Other in vivo experiments have confirmed the locations of the start sites for Ti, T2, and T4 (11). The start site for T3 was estimated to be at +61 by in vitro analysis and at +69 from in vivo primer extension experiments (Fig. 2). This difference may be a reflection of different start sites in vitro and in vivo, or it may be an experimental artifact. The region (-36 to -69) protected by CRP in DNase I protection experiments (Fig. 3) is indicated by brackets.

666

J. BACTERIOL.

HUANG ET AL.

TABLE 2. Effect of cyclic AMP and poor carbon source on (-galactosidase activity in an ompB-lacZ fusion strain

1-Galactosidaseb (Miller units)

Growth conditionsa ................................ Glucose Glucose + cAMP (1 mg/ml) ................................ Glucose + cAMP (5 mg/ml) ................................

Glycerol Lactate Malate

............................... ................................ .................................

22.7 35.8 82.6 95.8 78.2 111.1

a JMS65 (IHF+) was grown with shaking at 37°C for 16 h in minimal medium with the indicated carbon source (0.4%). cAMP, cyclic AMP. b f3-Galactosidase activity was measured as described previously and is expressed in Miller units (37). The data are averages of three separate experiments.

designated + 1 (Fig. 2) and was previously identified in in vitro experiments (49). The start site of the other major transcript, T2, is 22 bp downstream from the start of Ti. These transcripts appear to be reciprocally regulated by cyclic AMP-CRP. The formation of Ti is inhibited and that of T2 is activated by this complex. This positive and negative control by cyclic AMP-CRP is apparent in both the IHF+ and IHF- strains (Fig. 2A and B). As has been reported (49), IHF reduces ompB expression, especially the formation of transcript Ti. Cyclic AMP-CRP binds to the ompB promoter region. The A.

a b c d e

results of in vivo experiments suggest that cyclic AMP-CRP may be directly involved in ompB expression. We used DNase I footprinting (19) to examine whether cyclic AMPCRP binds to ompB promoter DNA. The results, presented in Fig. 3, show protection by cyclic AMP-CRP of a region from approximately -36 to -69. In addition, cleavage of a number of nucleotides within the site was enhanced with added cyclic AMP-CRP. The protected region contains a sequence, 5'-CGTGA-N6-CAACA-3', where N6 indicates a stretch of six nucleotides, which is similar to the consensus cyclic AMP-CRP binding sequence derived by a number of investigators (9, 15). The pattern of protection and the estimated number of nucleotides within the site are also similar to those reported for other cyclic AMP-CRP binding sites (9, 15). Positive and negative effects of cyclic AMP-CRP on ompB transcription in vitro. The specific binding of cyclic AMPCRP to the ompB promoter region, taken together with the results obtained in the in vivo experiments, suggests that cyclic AMP-CRP is a direct effector of ompB expression. We examined this possibility by adding cyclic AMP-CRP to a purified ompB in vitro transcription system. The data in Fig. 4 show that cyclic AMP-CRP has strong effects on ompB transcription in vitro and that these effects are similar to those seen in vivo. Transcript Ti was strongly inhibited by cyclic AMP-CRP, with the concurrent activation of a second transcript, T2. The two minor transcripts T3 and T4, previously found in vivo, were also identified in vitro. Results

A+G C+T

B.

a b c

527-

- 527

309-

- 309

242-

- 242

190160147-

4 I

-

190

-

160

-

147

123-

-123

110-

-110

90-

-90

67-

-67

FIG. 2. Primer extension analysis. Total cellular RNA was isolated from cells grown in Luria broth and hybridized with a synthetic primer complementary to ompB nucleotides +251 to +270 (14). Primer extension analysis was carried out as described in Materials and Methods. (A) Strain MF2910 (IHF-). Lanes a, b, and c, RNA isolated from MF2910; lanes d and e, RNA isolated from MF2910 containing the CRP plasmid pSH2. Cyclic AMP added to the growth medium at (a) 0, (b) 1, (c) 5, (d) 0, and (e) 1 mg/ml. Arrowheads: 1, Ti, the major cyclic AMP-CRP-inhibited transcript; 2, T2, the major cyclic AMP-CRP-activated transcript; 3 and 4, minor transcripts T3 and T4, respectively (see Fig. 1). (B) Strain JMS65 (IHF+). Lane a, RNA isolated from JMS65; lanes b and c, RNA isolated from JMS65 containing the CRP plasmid pSH2. Cyclic AMP was added to the growth medium at (a) 0, (b) 0, and (c) 1 mg/ml. Arrowheads are marked as for panel A. A+G and C+T indicate products of an A+G and C+T sequencing reaction, respectively. An MspI digest of pBR322 was used as size markers, which are shown in nucleotides at the edge of each gel.

VOL. 174, 1992

DUAL CONTROL OF ompB TRANSCRIPTION BY cAMP-CRP

667

TaqI, all of the run-off transcripts made from the template

were 70 bp shorter (26). The start sites of transcripts Ti through T4 were estimated by the sizes of the RNAs on gels and were very similar to

*

-20

*

-40

.

-60

-80

FIG. 3. DNase I footprinting of cyclic AMP-CRP in the ompB promoter region. Approximately 0.1 pmol of an AvaI-BstBI (-124 to +216) fragment was labeled at the AvaI end. CRP was added at 0, 0.25, 0.5, 1, 1.5, and 2 ,uM in lanes 1 through 6, respectively. Cyclic AMP (12.5 ,uM) was included in all of the reaction mixes that contained CRP. C+T and A+G show the products of the C+T and A+G sequencing reactions, respectively, of the fragment. The approximate extent of protection by CRP is indicated by the bracket. The sequence is numbered as shown in Fig. 1. The significance of the decreased intensity of some of the bands upstream of the CRP binding site is unknown.

with DNA fragments shortened at either the 3' or 5' end of the template suggest that each of these run-off transcripts was transcribed in the

the AvaI-BstBI

ompB direction. For example, when (-124 to +216) template was cut at + 146 by

5

6

-

309

242 -238 217

Ti-

201 190 180

160

those found in vivo by primer extension analysis (Fig. 2) (11). The start sites for the major transcripts Ti and T2 are separated by the same number of base pairs (22) as are the two transcripts in lac that are reciprocally regulated by cyclic AMP-CRP (35). In addition, the distance between these start sites and the beginning of the CRP-binding consensus (TGTGA) is similar in both promoter regions (78 and 68 bp for the CRP-dependent transcript and 56 and 46 bp for the CRP-inhibited transcript in ompB and lac, respectively). Thus, the CRP binding site overlaps the putative promoters for the transcripts that are inhibited by cyclic AMP-CRP, while the promoters that are activated by this complex are downstream from the CRP-binding domain. This suggests, as has been postulated for the lac P2 (35) and other promoters (1, 2), that the negative activity of cyclic AMP-CRP in ompB may be due to the ability of this complex to directly compete with RNA polymerase for promoter function. Consistent with this were the results obtained when the ompB template was preincubated with RNA polymerase before cyclic AMP-CRP was added to the transcription assay. Under these conditions, transcripts Ti and T4 were not inhibited and the activation of transcripts T2 and T3 was sharply reduced (Fig. 5). Effect of deleting the CRP binding site on cyclic AMP regulation of ompB expression. Our in vitro and in vivo experiments indicate that cyclic AMP-CRP positively and negatively alters ompB transcription by differentially regulating multiple ompB promoters. However, it is not clear from these results whether cyclic AMP-CRP directly affects ompB expression in vivo. This possibility was tested by altering the CRP binding site by site-specific mutagenesis. The inverse PCR method (25) was used to change nucleotides G and T at -56 and -55 in the CRP binding site to T and A, respectively. This change, in the 5'-TGTGA-3' CRP consensus sequence (9, 15), abolished CRP binding to the ompB promoter region in vitro (26). This altered fragment, as well as the normal ompB template, was cloned in front of the cat structural gene in pKK232-8 (42). These new plasmids were used to transform the wild-type strain MF2705, and ompB promoter activity was determined by measuring chloramphenicol acetyltransferase in cells grown under conditions that alter cyclic AMP levels. The data in Table 3 show that ompB expression from the plasmid with the unaltered fragment was three- to fivefold higher when cells were grown in medium with high levels of cyclic AMP. However, cells containing the plasmid with the altered CRP binding site showed little or no cyclic AMP-dependent increase in chloramphenicol acetyltransferase activity. These results suggest that the cyclic AMP-CRP binding site characterized in vitro is important for the effects of cyclic AMP on ompB expression observed in vivo.

147

FIG. 4. Inhibition and activation of

ompB transcription

in vitro

by cyclic AMP-CRP. Approximately 0.1 pmol of the AvaI-BstBI fragment used in the binding studies was used as the template. Lanes: 1, no addition; 2, 0.25 ,uM CRP; 3, 0.5 ,uM CRP; 4, 1 jiM CRP; 5, 1.5 ,uM CRP; 6, pBR322 DNA cut with MspI used as size markers, which are shown in nucleotides at the right. Cyclic AMP (12.5 jiM) was added to all of the reaction mixes containing CRP. Arrows Ti, T2, T3, and T4 indicate transcripts 1, 2, 3, and 4,

respectively,

as shown in

Fig.

1.

DISCUSSION The synthesis of OmpF and OmpC in E. coli is known to be altered by conditions that change the levels of cyclic AMP (46). Although the mechanism of this effect is unknown, it has been hypothesized that it is indirect and due to the putative regulation of the ompB operon by cyclic AMP-CRP (53). In the current study, we present evidence that cyclic AMP-CRP is a direct effector of ompB in vivo and in vitro. This complex binds to a site at approximately -36 to -69 in

HUANG ET AL.

668

(a)

J. BACTERIOL.

6 7 8 9 10

1 2 3 4 5

TABLE 3. Effect of a deletion in the CRP binding site on in vivo ompB promoter activitya Chloramphenicol

ompB fragment LH311 (CRP site intact) Ti

LH319 (CRP site deleted)

T2_-o

Addition to

medium

Glucose Glucose + cAMP Malate Xylose Glucose Glucose + cAMP Malate Xylose

acetyltransferaseb (,umol/mg of protein/min)

31.5 158.0 85.1 137.2 30.8 47.6 39.2 49.7

a JM109 (IHF+), transformed with pKK232-8 containing an ompB-cat fusion, was grown in minimal medium with the indicated carbon source (0.4%) with shaking at 37'C for 16 h. When added, cyclic AMP (cAMP) was used at 5 mg/ml. Cell extracts were prepared and chloramphenicol acetyltransferase activity was measured as described in Materials and Methods. b Enzyme activity is expressed as micromoles of product per milligram of protein per minute. The data are averages of three separate experiments. Enzyme activity did not vary more than 15% from experiment to experiment.

(b)

unusual, since only in rare cases does cyclic AMP-CRP both activate and inhibit expression from an individual operon (1, i 30 35). In the most extensively studied of these systems, a single CRP binding site in the gal promoter region positively controls the P1 promoter and exerts negative regulation on a 20 second promoter, P2 (1). It has been suggested that the wo existence of the two gal promoters and their differential control by cyclic AMP-CRP provide the flexibility for ade10[ quate gal expression needed for both biosynthetic and degradative purposes (1). ompB also has a dual role in E. coli, since its products, OmpR and EnvZ, control the levels of the OmpF and OmpC porins through transcriptional CRP (nM) CRP (nM) regulation of the ompF and ompC operons (22, 23). FIG. 5. Effect of time of addition of cyclic AMP-CRP on in vitro It is known that the synthesis of a variety of outer transcription. (A) In vitro transcription. Transcription was carried membrane proteins is regulated by cyclic AMP (5, 21, 45) out as described in the legend to Fig. 4. CRP and cyclic AMP were and that the composition of the E. coli cell envelope is added to the preincubation mixture either 10 min before (lanes 6 strongly influenced by this complex (7, 32). Perhaps this is a through 10) or 10 min after (lanes 1 through 5) RNA polymerase. In reflection of the need for E. coli to increase its ability to all cases, incubation was continued for 10 min before transcription degrade secondary carbon and energy sources during gluwas started with 4 mM magnesium acetate. Lanes: 1 and 6, no cose starvation (34). Consistent with this idea is the obseraddition; 2 and 7, 0.25 ,uM CRP; 3 and 8, 0.5 ,uM CRP; 4 and 9, 1 FM vation that OmpF levels are increased while those of OmpC CRP; 5 and 10, 1.5 ,uM CRP. Arrows Tl, T2, T3, and T4 indicate are decreased by cyclic AMP (46). The OmpF porin allows a transcripts 1, 2, 3, and 4, respectively, as shown in Fig. 1. (B) Quantification of transcription. The RNA bands were quantified much larger number of compounds to enter the cell than with a Joyce-Loebl densitometer. The graph on the left corresponds does the more restrictive OmpC channel (39). This is particto lanes 1 through 5 and the graph on the right corresponds to lanes ularly true for amino acids (30), which can serve as a 6 through 10 in panel a. Transcripts: Ti (0); T2 (A); T3 (A); T4 (0). secondary carbon and energy source for E. coli in the absence of glucose. These observations suggest a physiological basis for cyclic AMP-CRP regulation of ompB, since this control could, as previously postulated (53), lead to the the ompB promoter region and markedly alters transcription. observed positive action by cyclic AMP on OmpF synthesis. Two ompB transcripts are inhibited by cyclic AMP-CRP, How this could occur is unclear, since differential synthesis concomitant with the activation of two new transcripts. of OmpF and OmpC is usually mediated by the products of Primer extension analysis shows that these transcripts are the ompB operon, OmpR and EnvZ, in response to the made in vivo and that their regulation by cyclic AMP-CRP is similar to that found in vitro. In addition, inactivation of the osmolarity of the growth medium (22, 23). Although the overall effect of cyclic AMP-CRP in vivo is CRP binding site by site-specific mutagenesis strongly reduces effects by cyclic AMP on ompB expression in an positive, there is no evidence that increased expression of ompB-cat fusion plasmid. Taken together, these results ompB leads to a differential increase in OmpF levels in relation to OmpC (20). Perhaps the altered activity of the show that cyclic AMP is a regulator of ompB expression and that this regulation is due primarily to direct interactions of multiple ompB promoters due to cyclic AMP-CRP control leads to a change in the ratio of OmpR and EnvZ. Alterations cyclic AMP-CRP with the ompB promoter region. in this ratio have previously been found to cause a differenCyclic AMP-CRP is a positive or negative regulator of tial synthesis of one porin in relation to the other (20). transcription of numerous operons in E. coli (51). The dual Alternatively, since OmpR and EnvZ have pleiotropic regucontrol exerted by this complex on ompB expression is 3-

v

c

a

VOL. 174, 1992

DUAL CONTROL OF ompB TRANSCRIPTION BY cAMP-CRP

latory effects (20), cyclic AMP-CRP control of ompB may be a reflection of the role of these regulatory proteins in systems other than ompF and ompC. A number of E. coli operons are expressed through more than one promoter (13), and it has been suggested that this allows multiple levels of regulation mediated by numerous transcriptional regulatory factors (13). Multiple promoters in ompB may be a reflection of complex control in this operon. In addition to cyclic AMP-CRP, at least two other regulatory proteins, IHF (49) and OmpR (11), bind in the ompB promoter region. Data suggest that these proteins influence ompB expression in vivo (10, 43). Preliminary evidence indicates that these factors interact to alter how the individual proteins regulate ompB transcription (43). An understanding of these interactions, as well as a detailed functional analysis of the ompB promoters, is probably required in order to understand the molecular basis of cyclic AMP-CRP control in this operon.

13.

14.

15.

16.

17.

18.

ACKNOWLEDGMENTS We are grateful to J. Krakow for his gift of purified CRP, T. Silhavy and M. Inouye for bacterial strains and plasmids, and M. Hedeshian for doing the chloramphenicol acetyltransferase assays and densitometer scannings. This work was supported by grant GM17152 from the National Institutes of Health. REFERENCES 1. Adhya, S. 1987. The galactose operon, p. 1503-1512. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C. 2. Aiba, H. 1985. Transcription of the Escherichia coli adenylate cyclase gene is negatively regulated by cAMP-cAMP receptor protein. J. Biol. Chem. 260:3063-3070. 3. Aiba, H., and T. Mizuno. 1990. Phosphorylation of a bacterial activator protein, OmpR, by a protein kinase, EnvZ, stimulates the transcription of the ompF and ompC genes in Escherichia coli. FEBS Lett. 261:19-22. 4. Aiba, H., T. Mizuno, and S. Mizushima. 1989. Transfer of phosphoryl group between two regulatory proteins involved in osmoregulatory expression of the ompF and ompC genes in Escherichia coli. J. Biol. Chem. 264:8563-8567. 5. Alderman, E. M., S. S. Dulls, T. Melton, and W. J. Dobrogosz. 1979. Cyclic adenosine 3',5'-monophosphate regulation of the bacteriophage T6/colicin K receptor in Escherichia coli. J. Bacteriol. 140:369-376. 6. Anderson, J., S. A. Forst, K. Zhao, M. Inouye, and N. Delihas. 1989. The function of micF RNA: micF RNA is a major factor in the thermal regulation of OmpF protein in Escherichia coli. J. Biol. Chem. 264:17961-17970. 7. Aono, R., M. Yamasaki, and G. Tamura. 1978. Changes in composition of envelope proteins in adenylate cyclase or cyclic AMP receptor protein-deficient mutants of Escherichia coli. J. Bacteriol. 136:812-814. 8. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1987. Current protocols in molecular biology. John Wiley & Sons, Inc., New York. 9. Berg, 0. G., and P. H. von Hippel. 1988. Selection of DNA binding sites by regulatory proteins. II. The binding specificity of cyclic AMP receptor protein to recognition sites. J. Mol. Biol. 200:709-723. 10. Berman, M. L., and D. E. Jackson. 1984. Selection of lac gene fusions in vivo: ompR-lacZ fusions that define a functional domain of the ompR gene product. J. Bacteriol. 159:750-756. 11. Brissette, R., and M. Inouye (Robert Wood Johnson Medical School). 1991. Personal communication. 12. Coleman, J., P. J. Green, and M. Inouye. 1984. The use of RNAs

19. 20.

21.

22.

23. 24.

25.

26. 27.

28.

29.

30.

31. 32. 33.

34. 35.

669

complementary to specific mRNAs to regulate the expression of individual bacterial genes. Cell 37:429-436. Collado-Vides, J., B. Magasanik, and J. D. Gralia. 1991. Control site location and transcriptional regulation in Escherichia coli. Microbiol. Rev. 55:371-394. Comeau, D. E., K. Ikenaka, K. Tsung, and M. Inouye. 1985. Primary characterization of the protein products of the Escherichia coli ompB locus: structure and regulation of synthesis of the OmpR and EnvZ proteins. J. Bacteriol. 164:578-584. deCrombrugghe, B., S. Busby, and H. Buc. 1984. Cyclic AMP receptor protein: role in transcription activation. Science 224: 831-838. Forst, S., D. Comeau, S. Norioka, and M. Inouye. 1987. Localization and membrane topology of EnvZ, a protein involved in osmoregulation of OmpF and OmpC in Escherichia coli. J. Biol. Chem. 262:16433-16438. Forst, S., J. Delgado, and M. Inouye. 1989. Phosphorylation of OmpR by the osmosensor EnvZ modulates expression of the ompF and ompC genes in Escherichia coli. Proc. Natl. Acad. Sci. USA 84:6952-6956. Friden, P., P. Tsui, K. Okamoto, and M. Freundlich. 1984. Interaction of cyclic AMP receptor protein with the ilvB biosynthetic operon in E. coli. Nucleic Acids Res. 12:8145-8160. Galas, D., and A. Schmitz. 1978. DNase footprinting: a simple method for the detection of protein-DNA binding specificity. Nucleic Acids Res. 5:3157-3170. Gibson, M. M., E. M. Ellis, K. A. Graeme-Cook, and C. F. Higgins. 1987. OmpR and EnvZ are pleiotropic regulatory proteins: positive regulation of the tripeptide permease (tppB) of Salmonella typhimurium. Mol. Gen. Genet. 207:120-129. Griggs, D. W., K. Kafka, C. D. Nau, and J. Konisky. 1990. Activation of expression of the Escherichia coli cir gene by an iron-independent regulatory mechanism involving cyclic AMPcyclic AMP receptor protein complex. J. Bacteriol. 172:35293533. Hall, M. N., and T. J. Silhavy. 1981. The ompB locus and the regulation of the major outer membrane porin proteins of Escherichia coli K-12. J. Mol. Biol. 146:23-43. Hall, M. N., and T. J. Silhavy. 1981. Genetic analysis of the ompB locus in Escherichia coli K-12. J. Mol. Biol. 151:1-15. Hawley, D. K., and W. R. McClure. 1983. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 11:2237-2255. Hemsley, A., N. Arnheim, M. D. Toney, G. Cortopassi, and D. J. Galas. 1989. A simple method for site-directed mutagenesis using the polymerase chain reaction. Nucleic Acids Res. 17: 6545-6551. Huang, L., and M. Freundlich. Unpublished data. Huang, L., P. Tsui, and M. Freundlich. 1990. Integration host factor is a negative effector of the in vivo and in vitro expression of ompC in Escherichia coli. J. Bacteriol. 172:5293-5298. Igo, M. M., A. J. Ninfa, and T. J. Silhavy. 1989. A bacterial environmental sensor that functions as a protein kinase and stimulates transcriptional activation. Genes Dev. 3:598-605. Igo, M. M., A. J. Ninfa, J. B. Stock, and T. J. Silhavy. 1989. Phosphorylation and dephosphorylation of a bacterial transcriptional activator by a transmembrane receptor. Genes Dev. 3:1725-1734. Ingham, C., M. Buechner, and J. Adler. 1990. Effect of outer membrane permeability on chemotaxis in Escherichia coli. J. Bacteriol. 172:3577-3583. Inouye, M. (ed.). 1979. Bacterial outer membranes: biogenesis and function, p. 1-12. John Wiley & Sons, Inc., New York. Kumar, S. 1976. Properties of adenyl cyclase and cyclic adenosine 3',5'-monophosphate receptor protein-deficient mutants of Escherichia coli. J. Bacteriol. 125:545-554. Lugtenberg, B., R. Peters, H. Bernheimer, and W. Berendsen. 1976. Influence of cultural conditions and mutations on the composition of the outer membrane proteins of Escherichia coli. Mol. Gen. Genet. 147:251-262. Magasanik, B. 1981. Catabolite repression. Cold Spring Harbor Symp. Quant. Biol. 26:249-256. Malan, T. P., and W. R. McClure. 1984. Dual promoter control

670

J. BACTERIOL.

HUANG ET AL.

of the Escherichia coli lactose operon. Cell 39:173-180. 36. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 37. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 38. Mizuno, T., K. Masashi, Y. Jo, and S. Mizushima. 1988. Interaction of OmpR, a positive regulator, with the osmoregulated ompC and ompF genes in Escherichia coli. J. Biol. Chem. 263:1008-1012. 39. Nikaido, H., and M. Vaara. 1987. Outer membrane, p. 7-22. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C. 40. Norioka, S., G. Ramakrishnan, K. Ikenaka, and M. Inouye. 1986. Interaction of a transcriptional activator, OmpR, with reciprocally osmoregulated genes, ompF and ompC, of Escherichia coli. J. Biol. Chem. 261:17113-17119. 41. Okamoto, K., S. Hara, R. Bhasin, and M. Freundlich. 1988. Evidence in vivo for autogenous control of the cyclic AMP receptor protein gene (crp) in Escherichia coli by divergent RNA. J. Bacteriol. 170:5076-5079. 42. Pharmacia LKB Biotechnology, Inc. 1991. Molecular and cell biology catalogue. Pharmacia LKB Biotechnology, Inc., Piscataway, N.J. 43. Ramani, N., R. Hedeshian, and M. Freundlich. Unpublished

observations. 44. Ramani, N., L. Huang, and M. Freundlich. Mol. Gen. Genet., in press. 45. Schnaitman, C., D. Smith, and M. Forn de Salas. 1975. Temper-

46. 47. 48. 49.

50.

51. 52.

53.

ate bacteriophage which causes the production of a new major outer membrane protein by Escherichia coli. J. Bacteriol. 115:1121-1130. Scott, N. W., and C. R. Harwood. 1980. Studies on the influence of the cyclic AMP system on major outer membrane proteins of Escherichia coli K12. FEMS Microbiol. Lett. 9:95-98. Shaw, W. V. 1975. Chloramphenical acetyltransferase from chloramphenicol resistant bacteria. Methods Enzymol. 57:737755. Tsui, P., V. Helu, and M. Freundlich. 1988. Altered osmoregulation of ompF in integration host factor mutants of Escherichia coli. J. Bacteriol. 170:4950-4953. Tsui, P., L. Huang, and M. Freundlich. 1991. Integration host factor binds specifically to multiple sites in the ompB promoter of Escherichia coli and inhibits transcription. J. Bacteriol. 173:5800-5807. Tsung, K., R. E. Brissette, and M. Inouye. 1989. Identification of the DNA-binding domain of the OmpR protein required for transcriptional activation of the ompF and ompC genes of Escherichia coli by in vivo DNA footprinting. J. Biol. Chem. 264:10104-10109. Ullmann, A., and A. Danchin. 1983. Role of cyclic AMP in bacteria. Adv. Cyclic Nucleotide Res. 15:1-53. van Alphen, W., and B. Lugtenberg. 1977. Influence of osmolarity of the growth medium on the outer membrane protein pattern of Escherichia coli. J. Bacteriol. 131:623-630. Wurtzel, E. T., M.-Y. Chou, and M. Inouye. 1982. Osmoregulation of gene expression. I. DNA sequence of the ompR gene of the ompB operon of Escherichia coli and characterization of its gene product. J. Biol. Chem. 257:13685-13691.