Plant Cell Rep DOI 10.1007/s00299-013-1550-y

ORIGINAL PAPER

Molecular evidence of the involvement of heat shock protein 90 in brassinosteroid signaling in Arabidopsis T87 cultured cells Tomoaki Shigeta • Yuichi Zaizen • Tadao Asami • Shigeo Yoshida • Yasushi Nakamura • Shigehisa Okamoto • Tomoaki Matsuo • Yasushi Sugimoto

Received: 25 October 2013 / Revised: 28 November 2013 / Accepted: 6 December 2013 Ó Springer-Verlag Berlin Heidelberg 2013

Abstract Key message A closer association of HSP90s with brassinosteroid signaling is suggested by the brassinosteroid-triggered formation of an HSP90-containing macromolecular complex and the direct interaction between HSP90.3 and BES1. Abstract Heat shock protein 90 (HSP90) is a highly conserved molecular chaperone that is reportedly involved in the proper folding, stabilization, intracellular trafficking, maintenance and degradation of numerous proteins, as well as the facilitation of cellular signaling in various organisms including plants. Brassinosteroids (BRs), a class of unique steroidal hormones, play crucial roles in plant growth and development. The interaction between HSP90 proteins and BR action has been poorly understood. Here, we present molecular evidence suggesting that HSP90 proteins have a

Communicated by F. Sato.

Electronic supplementary material The online version of this article (doi:10.1007/s00299-013-1550-y) contains supplementary material, which is available to authorized users. T. Shigeta  S. Okamoto  T. Matsuo  Y. Sugimoto (&) The United Graduate School of Agricultural Sciences, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan e-mail: [email protected] Y. Zaizen Department of Biochemical Science and Technology, Faculty of Agriculture, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan

function(s) in BR signal transduction. First, blue native/ sodium dodecyl sulfate-polyacrylamide gel electrophoresis linked immunoblotting demonstrated that a bioactive BR, brassinolide (BL), promotes the formation of some HSP90containing macromolecular complexes with molecular weight more than 480 kDa in Arabidopsis T87 cultured cells. Second, HSP90.3, one of seven Arabidopsis HSP90 family proteins, was observed to interact in vitro with BRI1-EMS-SUPPRESSOR 1 (BES1), a transcription factor acting in BR signaling. Geldanamycin, an inhibitor of ATPase activity in HSP90, not only diminished HSP90.3 interaction with BES1 in vitro, but also suppressed BL-induced down-regulation of two BR biosynthesis genes, CONSTITUTIVE PHOTHOMORPHOGENESIS AND DWARFISM and DWARF4 in vivo. The results suggest the involvement of the HSP90/BES1 heterocomplexes in BR signaling-mediated feedback control in BR contents. Together, our results provide important clues to elucidate HSP90s’ functions in the BR signaling pathway in Arabidopsis.

S. Yoshida Kihara Institute for Biological Research, Yokohama City University, 641-12 Maioka-cho, Totsuka-ku, Yokohama 244-0813, Japan Y. Nakamura Department of Food Sciences and Nutritional Health, Kyoto Prefectural University, Shimogamo-Hangi-cho, Sakyo-ku, Kyoto 606-8522, Japan

T. Asami Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan

123

Plant Cell Rep

Keywords Brassinosteroid  Geldanamycin  HSP90.3  BES1  CPD  DWF4

Introduction Heat shock protein 90 (HSP90), a highly conserved molecular chaperone in eukaryotes, is essential for the survival of many organisms. HSP90 in animals and fungi interacts with numerous proteins (known as ‘‘clients’’) such as steroid receptors, transcription factors, protein kinases, chaperones, and other proteins (Taipale et al. 2010). HSP90 regulates the functions and stabilities of its clients through heterocomplex formation. The formation of an HSP90 heterocomplex with clients is highly dependent on the ATPase activity of HSP90, and thus its specific inhibitor, geldanamycin (GDA), causes prevention of complex formation and then destabilization of the clients (Obermann et al. 1998; Basso et al. 2002; Fang et al. 2009). HSP90s are crucial for plant life. Chemically or genetically induced deficiencies of HSP90 cause various morphological alterations such as epinastic cotyledons, asymmetric rosette leaves, radically symmetric leaves, and abnormal root hairs (Sangster et al. 2007). There are seven members of the HSP90 family that have important roles in the growth and development of Arabidopsis thaliana, and four of these (HSP90.1 to HSP90.4) are closely related to each other at the amino acid level and function in the cytoplasm and nucleus. The other three members, with less similarity to the four, act in different compartments: HSP90.5 in the chloroplast, HSP90.6 in the mitochondrion, and HSP90.7 in the endoplasmic reticulum (Krishna and Gloor 2001). Although HSP90 research in plants at the molecular and cellular levels has run rather behind that in animals, some interesting articles have been published. For example, Cle´ment et al. (2011) reported that HSP90.2 is involved in stomatal closure and modulates transcription and physiological processes in response to abscisic acid. In addition, several proteins were demonstrated to interact with HSP90s in plants, functioning in abiotic stress response and exhibiting defense responses such as pathogen recognition (Kadota and Shirasu 2012). These observations suggest that research on HSP90/client protein complexes is very important to understand the molecular mechanisms underlying various physiological events that occur throughout plants’ life cycle. Brassinosteroids (BRs) are polyhydroxylated steroidal hormones that regulate plant growth and development and also confer, in some plants, tolerance to abiotic stress such as cold, heat, drought, and nutrient deficiency (Clouse and Sasse 1998; Divi and Krishna 2009). BR signal transduc-

123

tion commences when an extracellular domain of the plasma membrane-localized receptor BR-INSENSITIVE 1 (BRI1) perceives the corresponding hormone. The activated BRI1 then inhibits BR-INSENSITIVE 2 (BIN2) kinase, which negatively regulates two homologous transcription factors, BRI1-EMS-SUPPRESSOR 1 (BES1) and BRASSINAZOLE-RESISTANT 1 (BZR1) in the absence of BRs (Kim and Wang 2010). Concomitantly, protein phosphatase 2A removes phosphate groups from BES1 and BZR1 (Tang et al. 2011). The resulting hypophosphorylated forms of the two transcription factors accumulate in the nucleus and control their target genes’ expression, leading to numerous physiological outputs of BRs as well as the feedback regulation of endogenous BR levels (He et al. 2005; Vert and Chory 2006; Yan et al. 2009; Ryu et al. 2010; Sun et al. 2010; Yu et al. 2011). So far, only a few papers that suggest a relationship between BR signaling and molecular chaperones including HSP90 in Arabidopsis have been published. For instance, TWISTED DWARF1 (AtFKBP42/ULTRACURVATA2) is an FK506-binding protein known to interact with HSP90.1 (Kamphausen et al. 2002). T-DNA insertion mutant of the gene (twisted dwarf 1) is a phenocopy of BRinsensitive mutants (Pe´rez-Pe´rez et al. 2004), suggesting the involvement of HSP90 chaperone activity in BR signaling (Sangster and Queitsch 2005). Although this is not the case for HSP90, brassinazole-insensitive-long hypocotyls 2 (BIL2) is also reported to code for a novel mitochondrial DnaJ/HSP40 family protein acting downstream of BR signaling (Bekh-Ochir et al. 2013). These observations illustrate that research focusing on HSP90 complexes is valuable for a better understanding of BR signaling. In addition, HSP90s interact with many transcription factors and regulate their functions in animals (Taipale et al. 2012). On the other hands, BES1 has also been demonstrated to bind to various proteins including the following: BES1-INTERACTING MYC-LIKE 1 (BIM1), MYELOBLASTOSIS FAMILY TRANSCRIPTION FACTOR 30 (MYB30), and MYB-LIKE 2 (MYBL2) for transcriptional control, INTERACTING-WITH-SPT6-1 (IWS1) for RNA polymerase II post-recruitment and transcriptional elongation processes, EARLY FLOWER 6 (ELF6) and RELATIVE OF EARLY FLOWER 6 (REF6) for histone demethylation, and 14-3-3 proteins for intracellular trafficking (Yin et al. 2005; Yu et al. 2008; Li et al. 2009, 2010; Ryu et al. 2010; Ye et al. 2012). However, it remains unknown whether HSP90s commit themselves to complex formation with BES1. In this study, we present two types of evidence showing the involvement of HSP90 proteins in BR signal transduction: first, BRs altered the molecular profiles of HSP90containing macromolecular complexes, and second, an

Plant Cell Rep

isoform of the HSP90 family, HSP90.3, bound directly to BES1 in vitro. Both findings suggest that HSP90s are involved in BR signal transduction through protein complex formation.

Materials and methods Chemicals and oligonucleotides All reagents were purchased from Nacalai Tesque (Kyoto, Japan) unless otherwise specified. The bioactive BR, brassinolide (BL) was purchased from Brassino Co. (Toyama, Japan). The specific BR biosynthesis inhibitor, brassinazole 2001 (Brz), was synthesized and purified according to Sekimata et al. (2001). The phosphatase inhibitor okadaic acid was purchased from Merck (Darmstadt, Germany). GDA was purchased from Focus Biomolecules (Plymouth Meeting, PA). For the preparation of stock solutions, all of the chemicals were dissolved in 100 % dimethyl sulfoxide (DMSO). For the chemical treatments, these stock solutions were added to the cell culture or the in vitro reaction mixture at the indicated concentrations with 0.1 % DMSO. All of the oligonucleotides in Table 1 were used for cloning and expression analysis. Cell culture and growth conditions The Arabidopsis suspension-cultured cell line T87 was kindly provided by the RIKEN BioResource Center (Ibaraki, Japan) and maintained according to Shigeta et al. (2011). Seven-day-cultured cells were used for all chemical treatments in this study, which are at early logarithmic growth phase. Plasmid construction The construction of a BES1 fusion to 69 His and FLAG was performed as follows. A full-length BES1 cDNA was amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) using total RNA of Arabidopsis seedlings. The BES1 cDNA was cloned into the SmaI site in pUC118 and sequenced to confirm identity with the original mRNA. Two pairs of oligonucleotides were annealed to make the double-stranded (ds) sequences encoding 69 His and FLAG tags, respectively. After phosphorylation of their 50 ends by T4 polynucleotide kinase, the two phosphorylated ds-oligonucleotides were cloned together into the SmaI and ClaI restriction sites of pBluescript SK (?) and their sequence fidelity was confirmed. A stretch of sequence carrying 69 His and FLAG was then named as an HF tag.

The NcoI/ClaI fragment containing an HF tag and the 1.1 kb ClaI/NotI fragment carrying BES1 cDNA were inserted together into the NcoI and NotI sites of a pUC18 derivative carrying CaMV 35S::GFP::Nos-T (Chiu et al. 1996), causing the replacement of GFP with HF-BES1. The plasmid harboring a chimeric gene, CaMV 35S:: HFBES1::Nos-T, was then linearized by EcoRI and cloned into the same site of a binary vector, pCAMBIA1300 for Agrobacterium-mediated transformation. The construction of transcription templates used in wheat germ cell-free protein synthesis was performed as follows. A fragment of HF-BES1 cDNA was PCR amplified from the chimeric gene, CaMV 35S:: HF-BES1::NosT using PrimeSTARÒ max DNA polymerase (TaKaRa Bio, Shiga, Japan), and then inserted into the EcoRV site in pEU-E01-MCS plasmid (CellFree Sciences Co., Yokohama, Japan) using the InFusionÒ HD cloning kit (Clontech Laboratories, Mountain View, CA). An HSP90.3 template was constructed by the ‘‘split-primer’’ PCR technique according to Nemoto et al. (2011). Transformation of Arabidopsis cultured cells Arabidopsis cultured cells were transformed with Agrobacterium tumefaciens strain C58C1Rif carrying the pCAMBIA1300 derivative mentioned above according to Ogawa et al. (2008). Hygromycin was used to screen (final concentration 10 lg/mL) and maintain (5 lg/mL) transgenic cells. In vitro protein synthesis and dephosphorylation In vitro transcription-linked translation was performed using a wheat germ cell-free protein synthesis system to produce three proteins, HF-BES1, biotinylated HSP90.3, and FLAG-tagged dihydrofolate reductase (DHFR) of Escherichia coli according to Nemoto et al. (2011). Protein dephosphorylation was performed using calf intestine alkaline phosphatase (CIAP; TaKaRa) according to the supplier’s instructions. An equal volume of the 29 sodium dodecyl sulfate (SDS) sample buffer [125 mM Tris-HCl (pH 6.8), 4 % SDS, 20 % glycerol, 10 % 2-mercaptoethanol] was added to the mixture to stop the reaction. Cell fractionation and protein isolation Native proteins were prepared as described below. Total native proteins were obtained from Arabidopsis cultured cells using CelLyticTM P reagent (Sigma-Aldrich, St. Louis, MO). Cytosolic proteins, membrane proteins and nuclear proteins were prepared from the cultured cells

123

Plant Cell Rep Table 1 Oligonucleotides used Name

Locus

Sequence (50 –30 )

Purpose

BES1

At1g19350

CCATCGATGAAAAGATTCTTC TATAATTCCAGCG

Cloning

GGGCGGCCGCCATAACAGGTT CATGTATACTTC 50 half of HF tag

CCCATGGGACATCACCATCATC ACCACGGTGGAG

30 half of HF tag

GTgattataaggatgatgatgataagGGAGGTGGTGGAGGAGGT GGAATTGATGGAAGAT

Dual tag synthesis

aatcACCTCCACCGTGGTGATGATGGTGATGTCCCATGGG

CGATCTTCCATCAATTCCACCTCCTC CACCACCTCCcttatcatcatcatccttat CTACATCACCAAGATATCATGGGACATCACCA TCATCA

HF-BES1

Dual tag synthesis

Cloning

TCGAGAACTAGTGATATCTCAACTATGAGCTTTACCAT HSP90.3

At5g56010

CCACCCACCACCACCAATGGCGGA CGCAGAAACCTTTG

1st split-primer PCR

AODA2306

AGCGTCAGACCCCGTAGAAA

1st split-primer PCR

SPU

GCGTAGCATTTAGGTGACACT

2nd split-primer PCR

deSP6E02bls-S1

GGTGACACTATAGAACTCACCTATC TCTCTACACAAAAC-ATTTCCCTACA TACAACTTTCAACTTCCTATTATG GGCCTGAACGACATCTTCGAGGCCCAGAAGATC GAGTGGCACGAA CTCCACCCACCACCACCAATG

2nd split-primer PCR

AODA2303 CPD

At5g05690

GTCAGACCCCGTAGAAAAGA

2nd split-primer PCR

AGCAACTCGGTAACGACAGG

Real-time PCR

CTGTCACTAGGCGGTGAAGG DWF4

At3g50660

AAACAACGGAGCGTCATCCT

Real-time PCR

GCTAGCTCTGAACCAGCACA UBQ10

At4g05320

GGTGGTTTGTGTTTTGGGGC

Real-time PCR

AGTCGAGTCACTTTGCAGGC Restriction sites are underlined, 69 His tag sequences are in uppercase italics, and FLAG tag sequences are in lowercase italics

using the CelLyticTM PN kit (Sigma-Aldrich). Cytosolic proteins were collected as the supernatant of 1,2609g centrifugation. Membrane proteins were obtained by treating the precipitate containing cell membranes and nuclei with 0.3 % Triton X-100. The remaining nuclearenriched portion was sequentially treated with BenzonaseÒ nuclease (Merck) on ice for 1 h, and with 19 NativePAGETM sample buffer (Life Technologies, Carlsbad, CA) supplemented with 1 % Triton X-100 and 500 mM 6-aminohexanoic acid. After centrifugation at 12,0009g, nuclear proteins were obtained as the supernatant. The protein concentration was determined using the Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA). Total denatured proteins were prepared by boiling the homogenate of cultured cells in the 29 SDS sample buffer and centrifuging the lysate to remove cell debris. The concentration of denatured proteins was determined using the RC DCTM protein assay (Bio-Rad).

123

Immunoblot analysis Proteins were separated by 10 % SDS-polyacrylamide gel electrophoresis (PAGE), and electrophoretically transferred to an ImmobilonÒ-P membrane (Millipore, Bedford, MA). The membrane was serially probed with an antiHSP90 (at-115) rabbit polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA) or an anti-FLAGÒ rabbit polyclonal antibody (Sigma-Aldrich), and then with a goat anti-rabbit IgG secondary antibody-conjugated horseradish peroxidase (HRP) (Abcam, Cambridge, MA). Chemiluminescence was generated from HRP using an AmershamTM ECLTM prime western blotting detection reagent (GE Healthcare Life Sciences, Uppsala, Sweden) and detected by LAS-1000 (Fujifilm Co., Tokyo). Blue native (BN)/SDS-PAGE was performed using the NativePAGETM NovexÒ Bis-Tris gel system (Life Technologies), except for the reducing reaction at 65 °C instead

Plant Cell Rep

of room temperature. A 4–16 % gradient BN gel was used for one-dimensional electrophoresis, and a 10 % SDS polyacrylamide gel was used for two-dimensional electrophoresis. Protein purification We prepared the protein samples for a liquid chromatography–tandem mass spectrometry (LC–MS/MS) analysis as described below. Total native proteins extracted from BLtreated cultured cells were fractionated by gel-filtration on SephacrylTM S-200 (GE Healthcare) equilibrated in the buffer [50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-KOH (pH 7.5), 150 mM NaCl, 10 % glycerol, 1 % Triton X-100] prior to an immunoaffinity purification of HSP90-containing complexes. Proteins in the void fraction were pre-cleared with DynabeadsÒ protein G (Life Technologies) and incubated overnight at 4 °C with the anti-HSP90 (at-115) antibody. The antibody/protein complexes were precipitated with the beads for 1 h, washed three times with 50 mM HEPES-KOH (pH 7.5), 150 mM NaCl, 10 % glycerol, and 0.1 % Triton X-100, and eluted with the 29 SDS sample buffer. We used tandem affinity purification (TAP) to purify HF-BES1-containing complexes. Total native proteins prepared from the transgenic cells overexpressing HFBES1 were incubated with COSMOGELÒ His-Accept (Nacalai) for 2 h at 4 °C in the presence of PhosSTOP (Roche Applied Science, Mannheim, Germany) and 5 mM imidazole. The precipitate was washed with 30 bed volumes of the wash buffer [50 mM phosphate buffer (pH 8.0), 300 mM NaCl, 0.1 % Triton X-100, 5 mM imidazole] and eluted twice with 5 bed volumes of the elution buffer [50 mM phosphate buffer (pH 8.0), 300 mM NaCl, 0.1 % Triton X-100, 125 mM imidazole]. The eluates were then further incubated with anti-FLAGÒ M2 affinity gel (SigmaAldrich) for 4 h at 4 °C and cleaned up with 200 bed volumes of another wash buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1 % Triton X-100]. The HF-BES1containing complexes were eluted twice with 150 ng/lL FLAGÒ peptide (Sigma-Aldrich) for 30 min at 4 °C. Finally, the products were concentrated using StrataCleanTM resin (Agilent Technologies, Santa Clara, CA). In vitro co-immunoprecipitation Equal volumes of the in vitro-synthesized HSP90.3 and HF-BES1 were added together in the binding buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1 % Triton X-100] and incubated on ice for 1 h. The anti-FLAGÒ M2 affinity gel or a control mouse IgG-agarose (SigmaAldrich) was then added to the above mixture and further incubated at 4 °C for 1 h with rotation. Following four

times washing with the same buffer, the immunologically precipitated proteins were eluted from the gels with the 29 SDS sample buffer and subjected to an immunoblot analysis. The treatment of GDA was performed as follows. The in vitro-synthesized HSP90.3 was pre-treated with 50 lM GDA for 1 h in the binding buffer prior to incubation with the same volume of the HF-BES1 for 1 h. Immunoprecipitation was done with the anti-FLAG antibody as described above. Liquid chromatography–tandem mass spectrometry Proteins prepared as described above were separated on the 10 % SDS-PAGE gel and visualized using the silver stain MS kit (Wako Pure Chemical Industries, Osaka, Japan). A protein band with molecular weight (MW) of 90 kDa was excised and digested with trypsin gold (mass spectrometry grade; Promega, Madison, WI). The digests were subjected to an LC–MS/MS analysis, and then all the MS/MS spectra were analyzed using the UniProt database as described previously (Shigeta et al. 2011). AlphaScreen assay An AlphaScreen assay was performed using in vitro-synthesized proteins as described (Nemoto et al. 2011; Takahashi et al. 2012). Briefly, biotinylated HSP90.3 and fivefold diluted HF-BES1 or FLAG-DHFR were added together in the binding mixture [100 mM Tris-HCl (pH 8.0), 0.01 % Tween 20, 1 mg/mL bovine serum albumin (BSA)] and incubated at 25 °C for 1 h, using a 384-well Optiplate (PerkinElmer Life and Analytical Sciences, Waltham, MA). This reaction mixture was further incubated with the detection mixture [100 mM Tris-HCl (pH 8.0), 0.01 % Tween 20, 1 mg/mL BSA, 1 ng/mL antiFLAG M2 monoclonal antibody (Sigma-Aldrich), protein A-conjugated acceptor beads (PerkinElmer), and streptavidin-coated donor beads (PerkinElmer)] at 25 °C for 1 h. The protein interaction was analyzed using an EnSpire alpha microplate reader (PerkinElmer). Quantitative real-time PCR Total RNA was prepared from the transgenic cells overexpressing HF-BES1 by use of the RNeasy plant mini kit (Qiagen, Venlo, The Netherlands) and then converted into cDNA using ReverTra AceÒ qPCR RT master mix with gDNA remover (Toyobo, Osaka, Japan). Quantitative PCR was performed with a Thermal Cycler DiceÒ real-time system TP800 (TaKaRa) using SYBRÒ premix Ex TaqTM II (TaKaRa). The relative expression levels of CONSTITUTIVE PHOTHOMORPHOGENESIS AND DWARFISM (CPD) and DWARF4 (DWF4) were calculated from three

123

Plant Cell Rep

replicates using the comparative Ct method after normalization to a POLYUBIQUITIN10 (UBQ10) expression.

Results and discussion Cellular distribution and molecular profile of HSP90 complexes in Arabidopsis cultured cells To address the molecular properties of HSP90 chaperone complexes in the simple and undifferentiated cultured cells, we determined the cellular distribution and dynamic states of HSP90 complexes using immunological techniques. Throughout this study, we used a commercial antiHSP90 (at-115) antibody purchased from Santa Cruz Biotechnology. This antibody is expected to react with several members of seven Arabidopsis HSP90 family proteins, because its epitope fragment corresponding to the amino acid sequence from M585 to D699 located at the C-terminus is highly conserved among the family members. The sequence is completely (100 %) identical to that of HSP90.3, 97 % identical to HSP90.2, 93 % identical to HSP90.4, 84 % identical to HSP90.1, 33 % identical to HSP90.5 and HSP90.6, and 42 % identical to HSP90.7. We therefore dealt with HSP90s detected by this antibody as a mixture of several family members, perhaps including at least four members, HSP90.3, HSP90.2, HSP90.4, and HSP90.1, sharing a high homology. Using this antibody, we first investigated the cellular distribution and abundance of HSP90s in the cultured cells (Fig. 1a). A single band was detected in three subcellular fractions in SDS-PAGE linked immunoblotting, which migrated at the position with MW of approximately 90 kDa, indicating that the detected band represented HSP90 family proteins. Although HSP90s were less abundant in nuclear proteins, ubiquitously distributed Fig. 1 Cellular distribution and molecular profiles of HSP90containing complexes. Native proteins differentially extracted from 7-day-cultured cells were subjected to a SDS-PAGE or b BN/SDS-PAGE linked immunodetection with the antiHSP90 (at-115) antibody. T total native proteins, C cytosolic proteins, M membrane proteins, N nuclear proteins. See ‘‘Materials and methods’’ for cell fractionation details

123

HSP90s in each fraction suggest their pleiotropic functions in the cultured cells. We then examined the dynamic states of HSP90-containing complexes using a combination of BN/SDS-PAGE with immunoblotting (Fig. 1b). Numerous protein spots were detected by the anti-HSP90 (at-115) antibody at the MW range from 146 kDa to over 1,000 kDa in the three fractions, indicating the existence of a series of HSP90containing complexes with different constitutions even in these simple and undifferentiated cells. Most of the major spots observed in each fraction were located at slightly larger than a 146-kDa size marker protein in the native mode. Since HSP90s are known to predominantly exist as a dimeric form (Wayne and Bolon 2007), the major spots with MWs of just over 146 kDa are likely the dimer-like forms. Additionally, faintly stained spots with MWs of over 720 kDa were detected in the total native proteins (Fig. 1b, top panel). In contrast, these extremely large spots were weakly detected in the cytosolic and nuclear proteins, while other spots with MWs of 480 kDa or less were observed in three fractions to the same degree (Fig. 1b, middle and lower panels). Altogether, our results suggest that HSP90-containing protein complexes are different in size and quantity, depending on the cellular compartments, and also that some HSP90s are involved in the formation of the macromolecular complexes. Brassinosteroid-induced changes of HSP90-containing macromolecular complexes in size and quantity We found previously that Arabidopsis cultured cells respond to the fluctuation of BR contents at the physiological level (Shigeta et al. 2011). In the present study, therefore, using BN/SDS-PAGE linked immunoblotting, we examined whether BL and Brz affect the dynamic states of HSP90-containing complexes in total native proteins

Plant Cell Rep

(Fig. 2). Interestingly, two spots of HSP90-containing complexes with high MWs of just \1,048 and 720 kDa emerged upon BL administration, and they were clearly observed in the long-exposure chemiluminescence image (right panel of Fig. 2). In contrast, the two spots were not increased to the same area as the Brz-treated samples, although Brz heavily affects morphology of Arabidopsis cultured cells (Shigeta et al. 2011). The profiles with MW less than 480 kDa barely changed in response to both BL and Brz treatments. These results indicate that some of the HSP90-containing macromolecular complexes qualitatively and quantitatively fluctuate in response to increased BR level. Since the amount of HSP90s detected by the antiHSP90 (at-115) antibody did not change much in response to these chemical treatments (Fig. S1), the results suggest that changes in the number, species, and combination pattern of the unidentified partner proteins contribute to the BR-dependent MW shift of HSP90-containing macromolecular complexes. Primary detection of HSP90.3 by the anti-HSP90 antibody As mentioned in the first section, the anti-HSP90 (at-115) antibody used in this study probably detects several members of Arabidopsis HSP90 family proteins. We therefore carried out an LC–MS/MS analysis to determine which HSP90 member(s) are captured by this antibody in protein samples purified from BL-administered cells (refer to ‘‘Materials and methods’’ for details). As shown in Table 2, the summary data of LC–MS/MS showed that the immunoprecipitated proteins with the anti-HSP90 (at-115) antibody contained mainly HSP90.3. Moreover, two

Fig. 2 Alteration in the molecular profiles of HSP90-containing complexes in response to BR level. Total native proteins (the same as the protein fraction ‘‘T’’ in Fig. 1) extracted from 7-day-cultured cells treated with either 1 lM BL or 5 lM Brz for 24 h were subjected to BN/SDS-PAGE linked immunodetection with the anti-HSP90 (at-115)

peptides matching HSP90.3 were identified (Fig. 3a, b): the first sequence, EVSHEWDLVNK, was present in HSP90.2 and HSP90.3 (theoretical mass 1,354.6517; experimental mass error 25 ppm; amino acid residues spanning E253– K263), while the second sequence, DTSGEALGR, matched only to that in HSP90.3 (theoretical mass 904.4251; experimental mass error 38 ppm; amino acid residues spanning D162–R170). These results indicate that HSP90.3 is the primary protein to be detected by the anti-HSP90 (at115) antibody in the HSP90 complex-enriched fraction from BL-treated cells. However, we cannot yet determine whether HSP90.3 is included in the BL-specific macromolecular complexes, because the protein sample used for LC–MS/MS contained a considerable amount of HSP90containing complexes with MW of less than 480 kDa. BR-dependent interaction of HSP90 and BES1 in Arabidopsis cultured cells Sangster and Queitsch (2005) predicted in their review that the activity of the HSP90 chaperone complex would be required for BR signal transduction. In addition, we found that HSP90-containing macromolecular complexes vary in size and quantity responding to BR level (Fig. 2). Thus, it is very important for a better understanding of BR signaling and functions to determine which BR-related proteins are the clients of HSP90s. To date, a transcription factor, BES1, acting in BR signaling has been most extensively investigated, and it is well known to form protein complexes with several proteins to regulate its target genes together (Yin et al. 2005; Yu et al. 2008; Li et al. 2009, 2010; Ye et al. 2012). In addition, HSP90s interact with various transcription factors in animals (Taipale et al.

antibody. Photographs show chemiluminescence images in different exposure times: short (left panels) and long (right panels). Arrows point to HSP90-containing macromolecular complexes specifically detected in BL-treated cells

123

Plant Cell Rep Table 2 LC–MS/MS proteins

analysis

of

immunoprecipitated

HSP90

Protein name

Locus

UniProt

UPSa

PMb

SCc

Heat shock protein 90.3

At5g56010

P51818

20.43

19

25.8

a

Unused ProtScore (UPS) from ProteinPilot software. UPS [2.0 indicates a confidence level of 99 %

b

Number of matched peptides

c

Percentage of sequence coverage

2012). We therefore chose BES1 as a candidate HSP90 client and examined whether HSP90s form a complex with BES1. Instead of its parental wild type, we used the transgenic cells overexpressing HF-BES1 for this purpose, because the expression of native BES1 is expected to be very low and the two tags, His and FLAG, on the transgenic proteins makes the purification easier. Before conducting a copurification experiment with TAP, we confirmed the BRdependent changes in the phosphorylation status of HFBES1. As shown in Fig. 4a, b (b, top panel), the HF-BES1 proteins in the BL-administered cells migrated faster in SDS-PAGE than those from the other treatments and their signal intensity was weak compared with those in BL-nontreated cells. Additionally, the pre-treatment with okadaic acids canceled the BL-induced faster migration of the proteins (Fig. 4a). Recently, Yan et al. (2009) and Ryu et al. (2010) reported that BES1 protein is hypophosphorylated in the presence of BL, while it is hyperphosphorylated in the absence of BL. Thus, our results indicate that

Fig. 3 Preferential binding of the anti-HSP90 antibody to HSP90.3. Immunoprecipitation with the anti-HSP90 (at-115) antibody was carried out to purify HSP90 proteins in total native proteins (the protein fraction ‘‘T’’ in Fig. 1) extracted from BL-treated cells. A silver-stained band with MW of 90 kDa in a gel of SDS-PAGE was excised and subjected to an in-gel digestion assay with trypsin and

123

HF-BES1 in the transgenic cells is hypophosphorylated in response to BL. As HF-BES1 behaved similarly to native BES1 in Arabidopsis seedlings regarding BL-dependent dephosphorylation (Vert and Chory 2006), we next addressed whether endogenous HSP90s are co-purified by the TAP of HF-BES1 proteins. Our immunoblot analysis with antiFLAG antibody showed that HF-BES1 proteins were specifically purified and concentrated from the transgenic cells regardless of whether with or without BL treatment (Fig. 4b, third panel), and that the obtained HF-BES1 proteins in BL-treated transgenic cells were less abundant than those in BL-non-treated transgenic cells. Interestingly, HSP90s were visualized by the anti-HSP90 (at-115) antibody more intensely in the BL-treated sample than those in the BL-non-treated control (Fig. 4b, fourth panel), although they were observed in both the samples. This result suggests that the hypophosphorylated BES1 would preferentially interact with HSP90 proteins in vivo, since HF-BES1 was hypophosphorylated in response to BL (Fig. 4a). ATP-dependent and direct interaction of HSP90.3 and BES1 in vitro Because HSP90s containing HSP90.3 were shown to interact with the HF-BES1 proteins in the BL-treated cells (Fig. 4b), we next examined whether HSP90.3 interacts with HF-BES1 in vitro. Immunoprecipitation was

then to an LC–MS/MS analysis. Two tandem mass spectra are shown in a and b; the first spectrum was obtained from a doubly charged ion with monoisotopic m/z = 1,354.6857 and corresponded to the sequence EVSHEWDLVNK, and the second one was obtained from a doubly charged ion with monoisotopic m/z = 904.3911 and corresponded to the sequence DTSGEALGR

Plant Cell Rep

Fig. 4 Interaction of HSP90 with BES1 in vivo. a To examine the phosphorylation status of HF-BES1 proteins, we carried out immunoblotting with an anti-FLAG antibody using total denatured proteins extracted from 7-day-cultured transgenic cells harboring CaMV 35S::HF-BES1 genes, which were treated sequentially with or without 1 lM okadaic acids (OA) for 1 h and with or without 1 lM BL for 6 h. b TAP was used to purify HF-BES1 proteins in the total native proteins (the protein fraction ‘‘T’’ in Fig. 1) prepared from the BL-treated or BL-non-treated transgenic cells. The purified proteins were then subjected to immunoblotting analyses with the anti-FLAG and anti-HSP90 (at-115) antibodies, respectively. A nontransgenic parental cell line (WT) was used as a control. The brackets with the closed arrowhead and open arrowhead show the hyperphosphorylated and hypophosphorylated HF-BES1, respectively. An asterisk indicates a non-specific band

performed using the anti-FLAG antibody upon the mixture of in vitro-synthesized HSP90.3 and HF-BES1 proteins, both of which were separately produced in wheat germ cell-free protein production system. The anti-HSP90 (at115) antibody visualized HSP90.3 in the protein fraction precipitated by anti-FLAG antibody, but not by the preimmune mouse IgG (Fig. 5a), suggesting that HSP90.3 directly binds with HF-BES1. Additionally, silver-staining protein patterns in the immunoprecipitates also indicated specific interaction of HSP90.3 with HF-BES1 (Fig. S2). We then applied AlphaScreen technology, a luminescencebased binding assay (Fig. 5b), to further examine the direct interaction of HSP90.3 with BES1. As shown in Fig. 5c, an almost five times stronger luminescent signal was observed in a combination of biotinylated HSP90.3 with HF-BES1 compared to those in a combination of biotinylated HSP90.3 and FLAG-DHFR that was used as a negative control. These results strongly support that HSP90.3 interacts with BES1 in vitro. As mentioned in the section above entitled ‘‘BRdependent interaction of HSP90 and BES1 in Arabidopsis cultured cells’’, the results of the co-purification experiment (Fig. 4b) suggested that a BR-induced hypophosphorylated BES1 could preferentially make a heterocomplex(es) with HSP90 in vivo. Accordingly, we examined whether in vitro-synthesized HF-BES1 proteins are phosphorylated or dephosphorylated, using CIAP. As shown in Fig. 5d, CIAP treatment caused faster migration of the HF-BES1 band compared to those with the non-

treated and minus CIAP controls, indicating that in vitrosynthesized HF-BES1 existed as a hyperphosphorylated form, which led to the notion that the hyperphosphorylated HF-BES1 interacted with HSP90.3 in vitro. However, this result apparently disagrees with that obtained from our in vivo co-purification experiment (Fig. 4b). At the moment, the discrepancy between these results has remained unsolved, but there seem to be a few possible explanations for this conflict. Lachowiec et al. (2013) proposed that BES1 could interact with HSP90 proteins independent of its phosphorylation status, based on the in vivo co-immunoprecipitation assay data. Together with our data from in vivo co-purification (Fig. 4b), the findings indicate that both the hyperphosphorylated and hypophosphorylated BES1 forms bind to HSP90, although there is some preference of the hypophosphorylated BES1 for their interaction, since more HSP90s were co-purified with HF-BES1 in the BL-treated protein sample (Fig. 4b). Alternatively, the discrepancy in our results might be due to the different phosphorylation states of HF-BES1 produced in the two different protein synthesis systems: the heterogeneous wheat germ cell-free system and the cellular translation process in the homogeneous cultured cells. It is thus possible that the in vitro-synthesized BES1 with phosphate groups does not reflect the hyperphosphorylated form produced in the BL-non-treated transgenic cells; the former might behave just like the in vivo-synthesized hypophosphorylated BES1 regarding the interaction with HSP90. Although we cannot exclude yet other explanations, in any case, further studies are necessary to address whether the hyperphosphorylated, hypophosphorylated or both forms of BES1 can interact with HSP90 in plant cells to advance our current knowledge of the roles of HSP90/ BES1 complexes in BR signaling. To date, intensive studies have elucidated the important roles of ATP binding to and subsequent ATP hydrolysis by HSP90s in the interaction with their client proteins (Obermann et al. 1998). In addition, GDA is reported to suppress ATPase activity through docking with the N-terminal ATP binding pocket of HSP90s, leading to the suppression of HSP90s binding to their clients (Basso et al. 2002; Fang et al. 2009). Therefore, to investigate whether GDA affects the HSP90.3/BES1 interaction in vitro, we pre-incubated GDA with the protein fraction containing HSP90.3, in which there remained presumably an adequate amount of ATP used as an energy source for in vitro protein synthesis, prior to the same immunoprecipitation assay shown in Fig. 5a. As depicted in Fig. 5e, upon GDA treatment, HSP90.3 immunologically detected in the precipitate had not vanished but was largely diminished, suggesting that GDA suppressed the HSP90.3/BES1 interaction through the inhibition of the ATP binding to and ATPase activity of HSP90.3. Together, our results

123

Plant Cell Rep

Fig. 5 Interaction of HSP90.3 with BES1 in vitro. a In vitrosynthesized proteins of HSP90.3 and HF-BES1, separately expressed in a wheat germ cell-free system, were mixed and incubated for 1 h and then subjected to immunoprecipitation using the anti-FLAG antibody. Immunoblotting using the anti-HSP90 (at-115) antibody was performed to detect HSP90.3 in the precipitates. Mouse IgG was used as a control antibody. b A schematic diagram of the AlphaScreen assay for the detection of HSP90.3 binding to BES1. The interaction between biotinylated HSP90.3 and HF-BES1 bridges the streptavidincoated donor beads and the anti-FLAG antibody-conjugated acceptor beads. Upon excitation at 680 nm, singlet oxygen molecules are produced from the donor beads, which react with the acceptor beads, resulting in light emission with the wavelength between 520 and 620 nm. c Binding strength between HSP90.3 and BES1 was quantitatively estimated by measuring the luminescence. In vitrosynthesized FLAG-DHFR was used as a negative control. Luminescence values are plotted as average values with the standard error of

three measurements. Student’s t test (P \ 0.05) was performed to test the significance of differences in luminescence signal strength between HSP90.3 with BES1 and HSP90.3 with DHFR. d The immunoblot analyses using the anti-FLAG antibody were carried out on the in vitro-synthesized HF-BES1 proteins incubated with or without CIAP (left panel) and the total native protein fractions extracted from the WT and the transgenic cells overproducing HFBES1 (right panel). BL treatment was performed as explained in Fig. 4. NT non-treated control. The brackets with the closed arrowhead and open arrowhead show the hyperphosphorylated and hypophosphorylated HF-BES1, respectively. Coomassie brilliant blue-stained gel was used as a loading control. e To test the involvement of ATPase activity in the HSP90.3/BES1 interaction, HSP90.3 was first incubated with or without 50 lM GDA for 1 h, and then with HF-BES1 for 1 h. Immunoprecipitation and immunodetection were performed as described in a

imply that HSP90.3 can specifically bind to BES1 in vitro, and that ATPase activity of HSP90.3 is required for their direct interaction.

the HSP90/BES1 interaction or the putative complexes containing the two proteins involved in BR signaling? To address this issue, we examined whether GDA affects the expression of CPD and DWF4, which are involved in BR biosynthesis and negatively regulated by the increase of BR contents (Tanaka et al. 2005). As shown in Fig. 6, our real-time PCR showed that the transcript levels of both CPD and DWF4 were very markedly reduced time dependently by BL in the transgenic cells, whereas pretreatment with GDA strongly suppressed the BL-induced feedback repression of the two genes. We also found that the HSP90.3/HF-BES1 complex was clearly diminished by

Implication of HSP90/BES1 complex in feedback regulation of BR biosynthesis genes As mentioned above, we demonstrated that HSP90s including HSP90.3 could interact with BES1 in a BRdependent manner in vivo (Fig. 4b) and HSP90.3 could bind to BES1 in an ATPase-dependent manner in vitro (Fig. 5). Then, a new question came to our mind: How is

123

Plant Cell Rep

Fig. 6 Geldanamycin-triggered suppression of negative feedback regulation in BR biosynthetic genes. Seven-day-cultured transgenic cells overproducing HF-BES1 were pre-treated with mock or 10 lM GDA for 30 min, and then incubated with 1 lM BL for 3, 6, and 12 h. Real-time PCR was performed to determine the transcript levels of

a CPD and b DWF4. The mRNA levels are shown as a relative value of expression to that of a control experiment incubated for 12.5 h total in the absence of GDA and BL (fold change 1). UBQ10 was used for the normalization of each mRNA level. Error bars indicate standard deviations (n = 3)

GDA pre-treatment in the in vitro binding assay (Fig. 5e). Originally, BZR1, a transcription factor homolog to BES1, was reported to down-regulate CPD and DWF4 (He et al. 2005). However, BES1 was recently demonstrated to bind to the promoter sequence of CPD and DWF4 and repress their expression (Sun et al. 2010; Yu et al. 2011; Ye et al. 2012). In addition, Lachowiec et al. (2013) reported that BZR1 is not a client of HSP90 because of the lesser sensitivity of BZR1 against GDA compared to BES1. The circumstantial evidence mentioned above suggests that GDA disturbs the proper feedback expression of CPD and DWF4 by inhibiting the HSP90/BES1 complex formation. However, it is also true that BES1 and BZR1 share high homology (87 % identity; 96 % similarity) in the amino acid level. Thus, we cannot yet exclude the possibility that GDA affects the HSP90 complexes with client protein(s) other than BES1, which are associated with the BR signal-mediated feedback regulation of BR biosynthetic genes. BZR1 is probably the primary candidate of such client proteins; thus further analyses are necessary to determine whether BZR1 makes a complex with HSP90s for establishment of the roles of the HSP90/BES1 complex in BR signaling. In conclusion, we have obtained findings showing the involvement of HSP90 chaperones in BR signaling as follows. First, HSP90-containing macromolecular complexes were generated in response to the increased BR level. Second, HSP90.3 formed a heterocomplex with HFBES1 in vitro and perhaps in vivo too, which depended on the ATPase activity of HSP90 proteins. Lastly, a specific inhibitor of HSP90, GDA, disturbed the BR-triggered feedback repression of two BR biosynthesis genes, CPD and DWF4, suggesting the involvement of the HSP90/ BES1 complexes in this process. Thus, our findings provide a starting point to further elucidate the molecular roles of

the HSP90/BES1 complex in BR signaling. Further studies are necessary to fill in the gaps created by our present findings; it is very important to identify other member protein(s) of the HSP90-containing macromolecular complexes as well as the HSP90/BES1 complexes to disclose the molecular properties and functions of these complexes in BR signaling as well as in the BR signaling-mediated feedback control of endogenous BR contents. Acknowledgments We thank Dr. Riichiro Yoshida at the Faculty of Agriculture of Kagoshima University for their technical assistance and valuable advice on the generation of transgenic cells and the realtime PCR analysis. We are grateful to Dr. Keiichiro Nemoto and Dr. Hirotaka Takahashi at Ehime University and Dr. Yuki Yanagawa at RIKEN for their technical advice regarding the wheat germ cell-free protein expression system and AlphaScreen assay. We also thank Dr. Yasuo Niwa at the Graduate School of Integrated Pharmaceutical and Nutritional Sciences of the University of Shizuoka for providing the pUC18 plasmid containing CaMV 35S::sGFP(S65T)::Nos-T. Conflict of interest The authors declare that they have no conflicts of interest.

References Basso AD, Solit DB, Chiosis G, Giri B, Tsichlis P, Rosen N (2002) Akt forms an intracellular complex with heat shock protein 90 (Hsp90) and Cdc37 and is destabilized by inhibitors of Hsp90 function. J Biol Chem 277:39858–39866 Bekh-Ochir D, Shimada S, Yamagami A, Kanda S, Ogawa K, Nakazawa M, Matsui M, Sakuta M, Osada H, Asami T, Nakano T (2013) A novel mitochondrial DnaJ/Hsp40 family protein BIL2 promotes plant growth and resistance against environmental stress in brassinosteroid signaling. Planta 237:1509–1525 Chiu W, Niwa Y, Zeng W, Hirano T, Kobayashi H, Sheen J (1996) Engineered GFP as a vital reporter in plants. Curr Biol 6:325–330 Cle´ment M, Leonhardt N, Droillard MJ, Reiter I, Montillet JL, Genty B, Laurie`re C, Nussaume L, Noe¨l LD (2011) The cytosolic/

123

Plant Cell Rep nuclear HSC70 and HSP90 molecular chaperones are important for stomatal closure and modulate abscisic acid-dependent physiological responses in Arabidopsis. Plant Physiol 156:1481–1492 Clouse S, Sasse J (1998) BRASSINOSTEROIDS: essential regulators of plant growth and development. Annu Rev Plant Physiol Plant Mol Biol 49:427–451 Divi UK, Krishna P (2009) Brassinosteroid: a biotechnological target for enhancing crop yield and stress tolerance. N Biotechnol 26:131–136 Fang S, Fu J, Yuan X, Han C, Shi L, Xin Y, Luo L, Yin Z (2009) Heat shock protein 90 regulates the stability of MEKK3 in HEK293 cells. Cell Immunol 259:49–55 He JX, Gendron JM, Sun Y, Gampala SS, Gendron N, Sun CQ, Wang ZY (2005) BZR1 is a transcriptional repressor with dual roles in brassinosteroid homeostasis and growth responses. Science 307:1634–1638 Kadota Y, Shirasu K (2012) The HSP90 complex of plants. Biochim Biophys Acta 1823:689–697 Kamphausen T, Fangha¨nel J, Neumann D, Schulz B, Rahfeld JU (2002) Characterization of Arabidopsis thaliana AtFKBP42 that is membrane-bound and interacts with Hsp90. Plant J 32:263–276 Kim TW, Wang ZY (2010) Brassinosteroid signal transduction from receptor kinases to transcription factors. Annu Rev Plant Biol 61:681–704 Krishna P, Gloor G (2001) The Hsp90 family of proteins in Arabidopsis thaliana. Cell Stress Chaperones 6:238–246 Lachowiec J, Lemus T, Thomas JH, Murphy PJ, Nemhauser JL, Queitsch C (2013) The protein chaperone HSP90 can facilitate the divergence of gene duplicates. Genetics 193:1269–1277 Li L, Yu X, Thompson A, Guo M, Yoshida S, Asami T, Chory J, Yin Y (2009) Arabidopsis MYB30 is a direct target of BES1 and cooperates with BES1 to regulate brassinosteroid-induced gene expression. Plant J 58:275–286 Li L, Ye H, Guo H, Yin Y (2010) Arabidopsis IWS1 interacts with transcription factor BES1 and is involved in plant steroid hormone brassinosteroid regulated gene expression. Proc Natl Acad Sci USA 107:3918–3923 Nemoto K, Seto T, Takahashi H, Nozawa A, Seki M, Shinozaki K, Endo Y, Sawasaki T (2011) Autophosphorylation profiling of Arabidopsis protein kinases using the cell-free system. Phytochemistry 72:1136–1144 Obermann WM, Sondermann H, Russo AA, Pavletich NP, Hartl FU (1998) In vivo function of Hsp90 is dependent on ATP binding and ATP hydrolysis. J Cell Biol 143:901–910 Ogawa Y, Dansako T, Yano K, Sakurai N, Suzuki H, Aoki K, Noji M, Saito K, Shibata D (2008) Efficient and high-throughput vector construction and Agrobacterium-mediated transformation of Arabidopsis thaliana suspension-cultured cells for functional genomics. Plant Cell Physiol 49:242–250 Pe´rez-Pe´rez JM, Ponce MR, Micol JL (2004) The ULTRACURVATA2 gene of Arabidopsis encodes an FK506-binding protein involved in auxin and brassinosteroid signaling. Plant Physiol 134:101–117 Ryu H, Cho H, Kim K, Hwang I (2010) Phosphorylation dependent nucleocytoplasmic shuttling of BES1 is a key regulatory event in brassinosteroid signaling. Mol Cells 29:283–290 Sangster TA, Queitsch C (2005) The HSP90 chaperone complex, an emerging force in plant development and phenotypic plasticity. Curr Opin Plant Biol 8:86–92 Sangster TA, Bahrami A, Wilczek A, Watanabe E, Schellenberg K, McLellan C, Kelley A, Kong SW, Queitsch C, Lindquist S

123

(2007) Phenotypic diversity and altered environmental plasticity in Arabidopsis thaliana with reduced Hsp90 levels. PLoS One 2:e648 Sekimata K, Kimura T, Kaneko I, Nakano T, Yoneyama K, Takeuchi Y, Yoshida S, Asami T (2001) A specific brassinosteroid biosynthesis inhibitor, Brz 2001: evaluation of its effects on Arabidopsis, cress, tobacco, and rice. Planta 213:716–721 Shigeta T, Yasuda D, Mori T, Yoshimitsu Y, Nakamura Y, Yoshida S, Asami T, Okamoto S, Matsuo T (2011) Characterization of brassinosteroid-regulated proteins in a nuclear-enriched fraction of Arabidopsis suspension-cultured cells. Plant Physiol Biochem 49:985–995 Sun Y, Fan XY, Cao DM, Tang W, He K, Zhu JY, He JX, Bai MY, Zhu S, Oh E, Patil S, Kim TW, Ji H, Wong WH, Rhee SY, Wang ZY (2010) Integration of brassinosteroid signal transduction with the transcription network for plant growth regulation in Arabidopsis. Dev Cell 19:765–777 Taipale M, Jarosz DF, Lindquist S (2010) HSP90 at the hub of protein homeostasis: emerging mechanistic insights. Nat Rev Mol Cell Biol 11:515–528 Taipale M, Krykbaeva I, Koeva M, Kayatekin C, Westover KD, Karras GI, Lindquist S (2012) Quantitative analysis of HSP90– client interactions reveals principles of substrate recognition. Cell 150:987–1001 Takahashi H, Takahashi C, Moreland NJ, Chang YT, Sawasaki T, Ryo A, Vasudevan SG, Suzuki Y, Yamamoto N (2012) Establishment of a robust dengue virus NS3–NS5 binding assay for identification of protein–protein interaction inhibitors. Antiviral Res 96:305–314 Tanaka K, Asami T, Yoshida S, Nakamura Y, Matsuo T, Okamoto S (2005) Brassinosteroid homeostasis in Arabidopsis is ensured by feedback expressions of multiple genes involved in its metabolism. Plant Physiol 138:1117–1125 Tang W, Yuan M, Wang R, Yang Y, Wang C, Oses-Prieto JA, Kim TW, Zhou HW, Deng Z, Gampala SS, Gendron JM, Jonassen EM, Lillo C, DeLong A, Burlingame AL, Sun Y, Wang ZY (2011) PP2A activates brassinosteroid-responsive gene expression and plant growth by dephosphorylating BZR1. Nat Cell Biol 13:124–131 Vert G, Chory J (2006) Downstream nuclear events in brassinosteroid signalling. Nature 441:96–100 Wayne N, Bolon DN (2007) Dimerization of Hsp90 is required for in vivo function. Design and analysis of monomers and dimers. J Biol Chem 282:35386–35395 Yan Z, Zhao J, Peng P, Chihara RK, Li J (2009) BIN2 functions redundantly with other Arabidopsis GSK3-like kinases to regulate brassinosteroid signaling. Plant Physiol 150:710–721 Ye H, Li L, Guo H, Yin Y (2012) MYBL2 is a substrate of GSK3-like kinase BIN2 and acts as a corepressor of BES1 in brassinosteroid signaling pathway in Arabidopsis. Proc Natl Acad Sci USA 109:20142–20147 Yin Y, Vafeados D, Tao Y, Yoshida S, Asami T, Chory J (2005) A new class of transcription factors mediates brassinosteroidregulated gene expression in Arabidopsis. Cell 120:249–259 Yu X, Li L, Guo M, Chory J, Yin Y (2008) Modulation of brassinosteroid-regulated gene expression by Jumonji domaincontaining proteins ELF6 and REF6 in Arabidopsis. Proc Natl Acad Sci USA 105:7618–7623 Yu X, Li L, Zola J, Aluru M, Ye H, Foudree A, Guo H, Anderson S, Aluru S, Liu P, Rodermel S, Yin Y (2011) A brassinosteroid transcriptional network revealed by genome-wide identification of BESI target genes in Arabidopsis thaliana. Plant J 65:634–646