Exp. Eye Res. (1990)
50, 737-741
Partial Amino Acid Sequence of the Major Intrinsic of the Chicken Lens Deduced from the Nucleotide cDNA Clone RYUJI Division
KODAMA,
of Morphogenesis,
KIYOKAZU Department 38 Nishigonaka,
AGATA,
MAKOTO
of Developmental Myodaiji-cho,
MOCHII
Biology, Okazaki,
Protein Sequence GORO
AND
National Institute 444 Japan
(MIP) of a
EGUCHI for Basic
Biology,
A cDNA clone of the major intrinsic protein (MIP) of the chickenlenswasisolated.This clonecoversthe C-terminal half of the coding region and 3’-untranslated region including a polyadenylation signal. Comparisonwith the bovine MIP cDNA sequencerevealedthat: (1) the amphilphilic transmembrane helix in bovine MIP is highly hydrophobic in chicken MIP, and is thus unlikely to offer a hydrophilic lining of the transmembranepore, and (2) the possiblecalmodulinbinding siteis conservedespeciallyat amino acid residueswhich are postulatedto be important in its binding with calmodulin. Northern blotting revealedthe presenceof transcriptsof different lengths,two of which correspondcloselyto the transcripts
of bovine MIP.
Keywords:major intrinsic protein; MIP ; lensfiber: chicken: gapjunction ; aminoacidsequence ; cDNA clone.
1. Introduction The diameter of the lens is several thousand times larger than that of its constituent cells, yet it lacks blood vessels. The lens fiber cells are connected by special junctional structures, whose ultrastructure is very similar to that of the gap junction (Goodenough, 1979). The junctions must be very important for the maintenance of the cellular environment in the subcortical region of the lens. The major intrinsic protein (MIP) is a membrane protein which is expressed strongly and exclusively in the lens fiber cells (Waggoner and Maisel, 1978), and several lines of evidence suggest that it is the component molecule of the lens fiber gap junctions (Sas et al., 1985; Johnson et al., 1988), although the conclusion is still elusive (Paul and Goodenough, 1983). The bovine MIP was shown to have an amino acid sequence which may be able to form a transmembrane structure through which hydrophilic molecules can pass(Gorin et al., 1984; Revel and Yancey, 1985). Further analyses of the molecular structure of the MIP should be informative to elucidate whether the MIP is really a main component of the gap junction. The expression of the MIP is strictly limited to the lens fiber cells, and serves as a good marker of lens fiber cell differentiation. Cultured lens epithelial cells form small aggregates called lentoids (Okada, Eguchi and Takeichi, 1971) with ultrastructural and biochemical characteristics of the lens fiber cells. Gap junctions and the expression of the MIP molecules have been observed in lentoids (Menko et al., 1987; Fitzgerald and Goodenough, 1986). In vitro cell culture studies have shown that lentoids are formed not only from lens epithelial cells but also from neural retinal cells (Okada et al., 19 7 5) and retinal pigmented epithelial cells (Eguchi and Okada, 19 7 3). This process 00144835/90/060737$05
$03.00/O
is called transdifferentiation, because a once-established cellular phenotype of an original cell is lost and another one is shown by its progeny. Modification of the culture media enables transdifferentiation of retinal pigmented epithelial cells to occur promptly and uniformly, facilitating analyses of the transdifferentiation process (Itoh and Eguchi, 1986). We recently showed that the lentoids formed by the transdifferentiation of the retinal pigmented epithelial cells of the chicken embryo are identical to those formed by the lens epithelial cells with respect to the junctional structures and the expression of MIP (Kodama, Takeuchi and Eguchi, unpubl. res.). We further showed that the gap junction of the retinal pigmented epithelial cells has a different ultrastructure from that of the lentoids, indicating a change in the junctional structure during the transdifferentiation process (Kodama et al., unpubl. res.). In this respect, the observation that the intermediate state of transdifferentiation, i.e. the dediierentiated pigmented epithelial cells, lack the gap junction is important (Kodama et al., unpubl. res.). We have begun analyses of the MIP of the chicken lens as a first step of our studies on the role of the junctional structures in the processof transdifferentiation. This paper describesthe isolation of a cDNA clone of the chicken MIP by the use of antibodies. Comparisons of the deduced amino acid sequencewith those of the MIPS of other specieshave given implications on the structure of the MIP molecule and its relationship with the lens fiber gap junction. 2. Materials and Methods Antibodies
The chicken MIP was purified from the lens of newly hatched chicks through procedures described by 0 1990 Academic
Press Limited
738
R. KODAMA
Goodenough (I 979) with some modifications. A monoclonal antibody, named 6H4. was prepared by the hybridoma technique (Kodama et al., unpubl. res.) according to the methods described (Mochii et al., 1988b). ICR mice were injected with MIP by the same method used in the preparation of the monoclonal antibody. The raised antiserum was used after confirming the specificity by Western blotting (data not shown). cDNA Cloning and NucleotideSequencing Poly(A)+ RNAs were extracted from the lens fiber cells of newly hatched chicks as previously described (Mochii et al., 1988a). A cDNA library was constructed with hgtll phage using oligo dT primer. Clones bearing sequence of the MIP were screened with an antiserum against chicken MIP and horseradish peroxidase-labeledantibody against mouse IgG. The insert was excised with EcoRI restriction enzyme and recloned into pTZ19R plasmid (Pharmacia). The insert was further fragmented with Hpa II restriction enzyme and subcloned into pTZ19R plasmid. The nucleotide sequence of the insert and its fragments was determined by the dideoxy method using doublestranded DNA as a template. Preparation oJ‘PeptideFragment and Amino Acid Sequencing A plasma membrane fraction of the lens of newly hatched chicks was prepared and washed with 7 M
helix ch br
ET AL
urea as in the purification of the MIP. The membrane fraction was washed with 5 mM Tris-HCl (pH 9). 1 rnM EDTA and 1 rnM CaCI, and suspendedin 70’%,formic acid. Excessamount of cyanogen bromide (CNBr) was added and stirred at room temperature for 24 hr. The reaction mixture was diluted with water, lyophilized, dissolvedin Dulbecco’sphosphate buffered saline (PBS) and cleared by centrifugation at 16 000 g for 15 min. The specimenwas applied to an affinity column which contains protein A-purified 6H4 antibody coupled to Affigel 10 (Bio-Rad) according to the manufacturer’s recommendation. After washing with PBS and 0.1 ,V sodium phosphate buffer (pH 7.4), the column was eluted with 1 M acetic acid. The eluate was dried under vacuum, dissolved in 0.1 M ammonium acetate and applied to HPLC (GTi system, LKB) with a gel filtration column (TSK G3OOOSW. Toso). A single peak was obtained and sequenced by automated Edman degradation method on gas-phase protein sequencer 470A equipped with PTH analyzer 120A (Applied Biosystems). Northern Blotting Poly(A)+ RNA was isolated from the lens fiber cells of newly hatched chicks, electrophoresed, blotted onto nylon membrane, and probed with pTZ19R plasmid bearing chicken MIP cDNA insert (pCLG1) labelled by nick translation with 32Paccording to Agata, Yasuda and Okada (1983).
E
b 1 ~~~~~~CI~G~GCC~GCCC~GG~T~CICTCCCC~C~~C~~~~~CCCA~~~T~~~TCM~CCGC~ffiTCC~GCGCCCGCTGTCATCACCCCC § 55 5555 55 5 §I 555 §§§§5§5§§§§§§ 555 §§§f 55 §§5§§5555s5§§§ 5 55555555 §§§§§§l§S§§ 35 55 §S§§§§§§ CGAGAGCCCGAATGCCCGCCTGGGCTCCGTCGCCCTGCCCC~~CTCC~CACC~~CAC~~~AT~A~ATA~~~Affi~~G~CC~~CCGCTCCTTTGCTCCTCCCATTCTTACCAGA
55 55
5
5 555 5
§§§§§§§§§§§§§§~~33 "ALAVGTSLTLGHLFGnYYTGAGnNPARSFAPAILTR
ch bv
---~~GCGCCG~C~~~~CCCCGGCGG~CCGCTGGAGCTC~CACCCAGGGGCTCTAGGGC~G~~~~~CCATCCCCACCCCCTCCCCTCACCCC~GCCGGGCCCGCCTTTGCTGTCGCGGCCCC 5 5 §§§§§§ I §§ §§§§§§§ 5555 §§§§§ AGTGAGTCCAATCGACCAACCAGAGGTCACAGCGG~CCTGTTG~CTG~GACCCAGGCCCTGT~GCTCCAGCCGGATAGACGGAGTAGC~GCTTCTGGGTTTACATGGAGGGGCTGAGCCACCCCCCGG~TC~
CH
-
By
S ES
A
A A
P
P
N
G
Q
P E P PA E P 5 5 * 5 5 F E" T G E P
L * V
EL 55555 E L
KT
9
KT
9
G L § AL
ch
GATGCGGTGCGTGTCGTGCGTGCGTGT~GTGCGGCCCGGCGGGAGTGC~CGGCCACCGGCACCC~CGGGCGGCCCCGCCGCCCC~CGGGAGCTCCGTGTTCCGTG~CCTACGCTTTATTTTGGT.~
bv
~GAGACTGTGGCCAGGGGCATGTACTTCTTTATTTTT~TTTATGTCTGTTTTTTTTTT~GCCTTTTGCCGTGTG~TCTTTCAGGTTGCATTCT~
P;A
poly
Fro. 1. Nucleotide and amino acid sequence of the cDNA clone, pCLG1, of the chicken MIP and the comparison with those of the bovine MIP (Gorin et al.. 1984). ch, bv: nucleotide sequence of chicken and bovine MIP, respectively, CH, BV: deduced amino acid sequence of chicken and bovine MIP. respectively, (3) identical nucleotide or amino acid residues, (. ) amino acid residues with similar hydrophobicity and electric charge, (-) a gap inserted to visualize the maximum match. The underline in amino acid sequence of chicken MIP shows the sequence confirmed by the sequencing of the CNBr fragment. Helix E, helix F and calmodulin binding site show the presumptive functional domains of the MIP (Got-in et al., 1984 : Peracchia, 1988). The double underline shows the possible polyadenylation signals.
A cDNA
CLONE
OF
CHICKEN
LENS
739
MIP
3. Results A cDNA bank was prepared with poly(A)+ RNA extracted from the lens fiber cells of newly hatched chicken lens. The cDNA bank was amplified once before screening. Approximately 17 000 plaques were assayed with an antiserum against chicken MIP and 70 positive plaques were obtained. Four of them were further plaque purified twice. One clone, which produced a chimeric protein recognized by a monoclonal antibody (6H4) against chicken MIP, was chosen and the insert cDNA was subcloned and named pCLG 1. Plasmids containing fragments of the insert were also prepared and sequenced. Comparison with the sequence of bovine MIP (Gorin et al., 1984) showed that the insert in pCLG1 encodes the Cterminal half of the chicken MIP and contains the 3’ untranslated region of its mRNA, including a putative polyadenylation signal (Fig. 1). To confirm the deduced amino acid sequence, a polypeptide fragment which binds to 6H4 antibody was prepared and sequenced. Through CNBr-fragmentation and affinity chromatography, a single fragment was obtained and sequenced by automated Edman degradation. The sequence, included in Fig. 1 (underlined amino acid sequence), coincided with the predicted C-terminal amino acid sequence of the chicken MIP. Northern blot hybridization of poly(A)+ RNA-rich fraction from the lens fiber cells of newly hatched chicks probed with 32P-labeled pCLG1 showed the presence of transcripts whose lengths are approximately 1.4, 2.2 and 6.6 kb, respectively (Fig. 2), and the shortest one was the most abundant. These transcripts were not detected in poly(A)+ RNA-rich
FIG. 2. Northern blot hybridization of poly(A)+ RNA-rich fraction extracted from chicken lens fiber (left) and cultured chicken pigmented epithelial cells (right) probed with chicken MIP cDNA. One and ten microgram of RNA was loaded on the left and right lane, respectively. Three transcripts with approximate length of 1.4, 2.2 and 6.6 kb are observed only in the lens RNA (arrows on the right side). A band at 4.7 kb is probably a background reaction of contaminating ribosomal RNA.
fraction extracted from other cells such as retinal pigmented epithelial cells cultured in vitro.
4. Discussion The MIP is a major component of membrane intrinsic proteins of the Iens fiber cells and the amino acid sequence deduced from the nucleotide sequence of a full-length cDNA of bovine MIP suggests the presence of six transmembrane r-helix domains (Gorin et al., 1984: Revel and Yancey, 1985). A partial cDNA clone of rat MIP showed that the amino acid residues are 9 3 y0 identical for 130 residues from the C-terminal between bovine and rat MIP (Shiels et al.. 1988 ). When the nucleotide sequences and the amino acid sequences were compared between bovine and chicken MIP. a much higher degree of variation was observed. Close examination of these two sequences showed several interesting points which can be important clues to understand the molecular structure of MIP. The compared regions can be divided into domains whose possible functions have been considered in the bovine MIP. They are transmembrane helices E and F (according to the notation by Gorin et al., 1984) and calmodulin binding site (according to Peracchia, 1988). These notations are used in the following discussion. The helix F is claimed to be a very important domain because, in the bovine MIP, it can form an amphiphilic helix (i.e. a helix composed of hydrophobic and hydrophilic residues), with the hydrophilic residues aligned on one side (Gorin et al., 1984). When the MIP molecules gather in a circle, with the hydrophilic side contiguous, there should appear a transmembrane pore lined with hydrophilic residues. According to the deduced amino acid sequence of the chicken MIP, the hydrophobicity of the helix F is increased through many substitutions of nucleotide residues (Figs 1 and 3). Especially the substitutions of glycines and serine with alanines on the C-terminal half of the helix F raise the hydrophobicity so that there should be no hydrophilic face throughout its length. There can be several interpretations for this interspecific variation. ( 1) Helix F is not the only helix which lines the pore. In the bovine MIP, helix C is also considered as a possible amphiphilic helix (Revel and Yancey, 1985). Sequencing of the full-length cDNA of the chicken MIP is necessary for further inquiry of this possibility. (2) Chicken MIP cannot form a transmembrane pore by itself. but other molecule(s) is(are) needed for the construction of the complete pore. Bovine MIP was shown to possess an ability to construct a pore, when isolated and reconstituted into planar lipid bilayer (Zampighi et al., 1985; Ehring et al., 1988). Such a reconstruction study of the chicken MIP is needed to test this possibility. There is evidence suggesting the interaction of MIP and calmodulin. A consensus sequence for the binding site of calmodulin is found in the amino acid sequence
740
R. KODAMA CHICKEN
BOVINE
MIP
MIP
FIG. 3. Hydrophobicity/hydrophilicity plot for the Cterminal half of the chicken MIP compared with that of the bovine MIP. Calculation was according to Kyte and Doolittle (1982). Bold lines show the presumptive functional domains. They are helix E, helix F and calmodulin binding site, from left to right (see legend for Fig. 1).
of the bovine MIP. neighboring the helix F on the Cterminal side (Peracchia, 1988). A similar amino acid sequence exists in the chicken MIP. The conservation of hydrophobic and basic residues is very conspicuous in the amino acid sequence, although the nucleotide sequence is highly varied [Fig. 1, see Ala(6), Val( 15), Leu( 16), Arg( 7). Arg( 12), Arg( 17) in the chicken MIP amino acid sequence: the numbers in parentheses show the position of each residue when counted from the beginning of the calmodulin binding site]. This strongly suggests the importance of this domain for the function of the protein. The binding of calmodulin to chicken MIP was indirectly shown (Welsh et al., 1982). At the C-terminal of the bovine and chick MIP, there are well-conserved residues including glutamic acids and lysine. As this is the most conserved domain between bovine and chicken cDNA within the CNBr fragment binding the 6H4 monoclonal antibody, which reacts with both bovine and chicken MIP, this domain is a strong candidate for the binding site for the antibody. The polyadenylation signal of the chicken MIP cDNA is ATTAAA rather than the consensus sequence, AATAAA. This polyadenylation signal is also found in the chicken /1Bl crystallin cDNA clone (Hejtmancik et al., 1986) and known to be a functional signal (Wickens and Stephenson, 1984). The bovine MIP cDNA clone also has an unusual polyadenylation signal AAGAAA. and this lack of standard polyadenylation signal was suggested as a cause of the size heterogeneity of bovine MIP mRNAs (Gorin et al.. 1984). This may not be correct, however, because the
ET AL
chicken MIP mRNA. which has a different and probably effective polyadenylation signal, shows a very similar size heterogeneity. In conclusion, the present study of the chicken MIP provides another comparative aspect for the analysis of the function of the MIP. Further cloning of the fulllength cDNA of the chicken MIP is needed for more precise comparative analyses and for gene manipulation studies. such as gepe transfection. The identity of the MIP as a lens fiber gap junction protein is highly controversial. Kecent studies utilizing the immunofreeze fracture technique showed evidences for the identity of the MIP not as a lens fiber gap junction component, but as a component of a tetragonal array of intramembranous particles revealed by freezefracture method (Zampighi et al., 1989 1. Kegardless of the contribution of the MIP to the lens fiber gap junction, MIP seems to play an important role in the stabilization of the lens tissue. The inhibition or enhancement of the expression of MIP by gene manipulation techniques in the course of lens fiber formation from the lens epithelial cells or of transdifferentiation from the retinal pigmented epithelial cells should provide new insights into the role of the MIP in tissue morphogenesis of the lens. Acknowledgments The authors wish to thank Dr T. S. Okada, President of Okazaki National Research Institutes, for encouragement. and Dr H. Maisel, Department of Anatomy and Cell Biology, Wayne State University, for critical reading of the manuscript. Thanks are also due to MS N. Sakurai for assistance in cDNA cloning and to MS H. Kajiura for the operation of the peptide sequencer, which belongs to the Common-Use Facility for NIBB. This study was supported by Grants-in-Aid from the Ministry of Education. Science and Culture. to R. K. and G. E., and Research Funds from the Institute for Cataract Research and the Naito Foundation to G.E. References Agata, K., Yasuda, K. and Okada. T. S. (1983). Gene coding for a lens-specific protein, S-crystallin. is transcribed in nonlens tissues of chicken embryo. Dev. Rio/. 100, 222-6. Eguchi, G. and Okada, T. S. (1973). Differentiation of lens tissue from the progeny of chick retinal pigment cells cultured in vitro: A demonstrationof a switch of cell types in clonal cell culture. Proc. NatI. Arad. Sci. U.S.A. 70. 1495-9. Ehring, G. R.. Zampighi, G. A. and Hall, J. E. (1988). Propertiesof MIP 26 channelsreconstitutedinto planar lipid bilayers.In Gapjunctions(EdsHertzberg,E. I,. and Johnson.R. G.). Pp. 335-46. Alan R. Liss.Inc. : New York. Fitzgerald. P. G. and Goodenough.D. A. (1986). Rat lens cultures: MIP expressionand domainsof intercellular coupling. Invest.Ophthalmol. Vis. Sci. 27. 755-71. Goodenough.D. A. (1979). Lensgapjunctions: a structural hypothesisfor nonregulatedlow-resistanceintercellular pathways. Invest. Ophthalmal.Vis. Sci. 18, 1104-22. Gorin. M. B.. Yancey,S.B.. Cline,J.. Revel,J.-P. and Horwitz. J. (1984). The major intrinsic protein (MIP) of the
A cDNA
CLONE
OF
CHICKEN
LENS
741
MIP
bovine lens fiber membrane : Characterization and structure based on cDNA cloning. Crll 39. 49-59. Hejtmancik. J. F.. Thompson, M. A., Wistow, G. and Piatigorsky, J. ( 1986). cDNA and deduced protein sequence for the /1I31-crystallin polypeptide of the chicken lens. Conservation of the PAPA sequence. 1. Biol. Chern. 261. 982-7.
Itoh. Y. and Eguchi. G. ( 1986). In vitro analysis of cellular metaplasia from pigmented epithelial cells to lens phenotypes: A unique model system for studying cellular and molecular mechanisms of ’ transdifferentiation’. Drv. Biol. 115. 353-62. Johnson, K. G., Klukas. K. A., Tze-Hong. I,. and Spray. D. C. (1988). Antibodies to MP28 are localized to lens junctions, alter intercellular permeability and demonstrate increased expression during development. In Gup lunctions (Eds Hertzberg, E. L. and Johnson. R. G.). Pp. 81-98. Alan K. Liss. Inc.: New York. Kyte, J. and Doolittle, R. F. (I 982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157. 105-32. Menko, A. S.. Klukas. K. A.. Liu. T.-F.. Quade, B.. Sas. D. F.. Preus. D. M. and Johnson, R. G. (1987). Junctions between lens cells in differentiating cultures: Structure, formation, intercellular permeability, and junctional protein expression. Dev. Biol. 123. 307-20. Mochii. M.. Agata. K.. Kobayashi, H.. Yamamoto, T. S. and Eguchi. G. (1988a). Expression of gene coding for a melanosomal matrix protein transcriptionally regulated in the transdifferentiation of chick embryo pigmented epithelial cells. (‘PII Difl 24, 67-74. Mochii. M.. Takeuchi. T., Kodama, R.. Agata, K. and Eguchi, G. (1988b). The expression of melanosomal matrix protein in the transdifferentiation of pigmented epithelial cells into lens cells. Cell Di;Ff.23, 13 3-42. Okada. T. S., Eguchi, G. and Takeichi, M. (1971). The expression of differentiation by chicken lens epithelium in irr vitro cell culture. Drv. Growth Difl. 13, 323-36. Okada. T. S.. Itoh. Y.. Watanabe, K. and Eguchi, G. (1975). Differentiation of lens in culture of neural retinal cells of chick embryos. &v. Biol. 45, 3 18-29.
Paul, D. I,. and Goodenough, D. A. (1983). Preparation, characterization, and localization of antisera against bovine MP26, an integral protein from lens fiber plasma membrane. J. Cell Biol. 96, 625-32. Peracchia, C. (1988). The calmodulin hypothesis for gap junction regulation six years later. In Gap junctions (Eds Hertzberg, E. L. and Johnson, R. G.). Pp. 267-82. Alan R. Liss, Inc.: New York. Revel, J. P. and Yancey. S. B. (1985). Molecular conformation of the major intrinsic protein of lens fiber membranes: Is it a junction protein? In Gap junctions (Eds Bennett. M. V. L. and Spray. D. C.). Pp. 3 348. Cold Spring Harbor Laboratory: New York. Sas. D. F., Sas. M. J.. Johnson, K. R.. Menko. A. S. and Johnson. R. G. (1985). Junctions between lens fiber cells are labeled with a monoclonal antibody shown to be specific for MP26. 1. Cell Biol. 100. 216-25. Shiels. A.. Kent. N. A., McHale, M. and Bangham, J. A. (1988). Homology of MIP26 to Nod26. Nut!. Acid Rrs. 16. 9348. Waggoner. P. R. and Maisel, H. (1978). Immunofluorescent study of a chick lens fiber cell membrane polypeptide. Exp. Eye Res. 27, 151-7. Welsh. M. J., Aster, J. C., Ireland, M., Alcala. J. and Maisel, H. (1982). Calmodulin binds to chick lens gap junction protein in a calcium-independent manner. Science 216, 642-4.
Wickens. M. and Stephenson, P. (1984). Role of the conserved AALJAAA sequence: Four AAUAAA point mutations prevent messenger RNA 3’ end formation. Sciencr 226. 1045-j 1. Zampighi. G. A., Hall. J. E., Ehring. G. R. and Simon, S. A. ( 1989). The structural organization and protein composition of lens fiber junctions. 1. Cell Biol. 108, 2255-75.
Zampighi, G. A., Hall, J. E. and Krenan, M. (198 5). Purified lens junctional protein forms channels in planar lipid films. Proc. .RlRtl. Acad. Sci. U.S.A. 82. 8468-72.
50, 737-741
Partial Amino Acid Sequence of the Major Intrinsic of the Chicken Lens Deduced from the Nucleotide cDNA Clone RYUJI Division
KODAMA,
of Morphogenesis,
KIYOKAZU Department 38 Nishigonaka,
AGATA,
MAKOTO
of Developmental Myodaiji-cho,
MOCHII
Biology, Okazaki,
Protein Sequence GORO
AND
National Institute 444 Japan
(MIP) of a
EGUCHI for Basic
Biology,
A cDNA clone of the major intrinsic protein (MIP) of the chickenlenswasisolated.This clonecoversthe C-terminal half of the coding region and 3’-untranslated region including a polyadenylation signal. Comparisonwith the bovine MIP cDNA sequencerevealedthat: (1) the amphilphilic transmembrane helix in bovine MIP is highly hydrophobic in chicken MIP, and is thus unlikely to offer a hydrophilic lining of the transmembranepore, and (2) the possiblecalmodulinbinding siteis conservedespeciallyat amino acid residueswhich are postulatedto be important in its binding with calmodulin. Northern blotting revealedthe presenceof transcriptsof different lengths,two of which correspondcloselyto the transcripts
of bovine MIP.
Keywords:major intrinsic protein; MIP ; lensfiber: chicken: gapjunction ; aminoacidsequence ; cDNA clone.
1. Introduction The diameter of the lens is several thousand times larger than that of its constituent cells, yet it lacks blood vessels. The lens fiber cells are connected by special junctional structures, whose ultrastructure is very similar to that of the gap junction (Goodenough, 1979). The junctions must be very important for the maintenance of the cellular environment in the subcortical region of the lens. The major intrinsic protein (MIP) is a membrane protein which is expressed strongly and exclusively in the lens fiber cells (Waggoner and Maisel, 1978), and several lines of evidence suggest that it is the component molecule of the lens fiber gap junctions (Sas et al., 1985; Johnson et al., 1988), although the conclusion is still elusive (Paul and Goodenough, 1983). The bovine MIP was shown to have an amino acid sequence which may be able to form a transmembrane structure through which hydrophilic molecules can pass(Gorin et al., 1984; Revel and Yancey, 1985). Further analyses of the molecular structure of the MIP should be informative to elucidate whether the MIP is really a main component of the gap junction. The expression of the MIP is strictly limited to the lens fiber cells, and serves as a good marker of lens fiber cell differentiation. Cultured lens epithelial cells form small aggregates called lentoids (Okada, Eguchi and Takeichi, 1971) with ultrastructural and biochemical characteristics of the lens fiber cells. Gap junctions and the expression of the MIP molecules have been observed in lentoids (Menko et al., 1987; Fitzgerald and Goodenough, 1986). In vitro cell culture studies have shown that lentoids are formed not only from lens epithelial cells but also from neural retinal cells (Okada et al., 19 7 5) and retinal pigmented epithelial cells (Eguchi and Okada, 19 7 3). This process 00144835/90/060737$05
$03.00/O
is called transdifferentiation, because a once-established cellular phenotype of an original cell is lost and another one is shown by its progeny. Modification of the culture media enables transdifferentiation of retinal pigmented epithelial cells to occur promptly and uniformly, facilitating analyses of the transdifferentiation process (Itoh and Eguchi, 1986). We recently showed that the lentoids formed by the transdifferentiation of the retinal pigmented epithelial cells of the chicken embryo are identical to those formed by the lens epithelial cells with respect to the junctional structures and the expression of MIP (Kodama, Takeuchi and Eguchi, unpubl. res.). We further showed that the gap junction of the retinal pigmented epithelial cells has a different ultrastructure from that of the lentoids, indicating a change in the junctional structure during the transdifferentiation process (Kodama et al., unpubl. res.). In this respect, the observation that the intermediate state of transdifferentiation, i.e. the dediierentiated pigmented epithelial cells, lack the gap junction is important (Kodama et al., unpubl. res.). We have begun analyses of the MIP of the chicken lens as a first step of our studies on the role of the junctional structures in the processof transdifferentiation. This paper describesthe isolation of a cDNA clone of the chicken MIP by the use of antibodies. Comparisons of the deduced amino acid sequencewith those of the MIPS of other specieshave given implications on the structure of the MIP molecule and its relationship with the lens fiber gap junction. 2. Materials and Methods Antibodies
The chicken MIP was purified from the lens of newly hatched chicks through procedures described by 0 1990 Academic
Press Limited
738
R. KODAMA
Goodenough (I 979) with some modifications. A monoclonal antibody, named 6H4. was prepared by the hybridoma technique (Kodama et al., unpubl. res.) according to the methods described (Mochii et al., 1988b). ICR mice were injected with MIP by the same method used in the preparation of the monoclonal antibody. The raised antiserum was used after confirming the specificity by Western blotting (data not shown). cDNA Cloning and NucleotideSequencing Poly(A)+ RNAs were extracted from the lens fiber cells of newly hatched chicks as previously described (Mochii et al., 1988a). A cDNA library was constructed with hgtll phage using oligo dT primer. Clones bearing sequence of the MIP were screened with an antiserum against chicken MIP and horseradish peroxidase-labeledantibody against mouse IgG. The insert was excised with EcoRI restriction enzyme and recloned into pTZ19R plasmid (Pharmacia). The insert was further fragmented with Hpa II restriction enzyme and subcloned into pTZ19R plasmid. The nucleotide sequence of the insert and its fragments was determined by the dideoxy method using doublestranded DNA as a template. Preparation oJ‘PeptideFragment and Amino Acid Sequencing A plasma membrane fraction of the lens of newly hatched chicks was prepared and washed with 7 M
helix ch br
ET AL
urea as in the purification of the MIP. The membrane fraction was washed with 5 mM Tris-HCl (pH 9). 1 rnM EDTA and 1 rnM CaCI, and suspendedin 70’%,formic acid. Excessamount of cyanogen bromide (CNBr) was added and stirred at room temperature for 24 hr. The reaction mixture was diluted with water, lyophilized, dissolvedin Dulbecco’sphosphate buffered saline (PBS) and cleared by centrifugation at 16 000 g for 15 min. The specimenwas applied to an affinity column which contains protein A-purified 6H4 antibody coupled to Affigel 10 (Bio-Rad) according to the manufacturer’s recommendation. After washing with PBS and 0.1 ,V sodium phosphate buffer (pH 7.4), the column was eluted with 1 M acetic acid. The eluate was dried under vacuum, dissolved in 0.1 M ammonium acetate and applied to HPLC (GTi system, LKB) with a gel filtration column (TSK G3OOOSW. Toso). A single peak was obtained and sequenced by automated Edman degradation method on gas-phase protein sequencer 470A equipped with PTH analyzer 120A (Applied Biosystems). Northern Blotting Poly(A)+ RNA was isolated from the lens fiber cells of newly hatched chicks, electrophoresed, blotted onto nylon membrane, and probed with pTZ19R plasmid bearing chicken MIP cDNA insert (pCLG1) labelled by nick translation with 32Paccording to Agata, Yasuda and Okada (1983).
E
b 1 ~~~~~~CI~G~GCC~GCCC~GG~T~CICTCCCC~C~~C~~~~~CCCA~~~T~~~TCM~CCGC~ffiTCC~GCGCCCGCTGTCATCACCCCC § 55 5555 55 5 §I 555 §§§§5§5§§§§§§ 555 §§§f 55 §§5§§5555s5§§§ 5 55555555 §§§§§§l§S§§ 35 55 §S§§§§§§ CGAGAGCCCGAATGCCCGCCTGGGCTCCGTCGCCCTGCCCC~~CTCC~CACC~~CAC~~~AT~A~ATA~~~Affi~~G~CC~~CCGCTCCTTTGCTCCTCCCATTCTTACCAGA
55 55
5
5 555 5
§§§§§§§§§§§§§§~~33 "ALAVGTSLTLGHLFGnYYTGAGnNPARSFAPAILTR
ch bv
---~~GCGCCG~C~~~~CCCCGGCGG~CCGCTGGAGCTC~CACCCAGGGGCTCTAGGGC~G~~~~~CCATCCCCACCCCCTCCCCTCACCCC~GCCGGGCCCGCCTTTGCTGTCGCGGCCCC 5 5 §§§§§§ I §§ §§§§§§§ 5555 §§§§§ AGTGAGTCCAATCGACCAACCAGAGGTCACAGCGG~CCTGTTG~CTG~GACCCAGGCCCTGT~GCTCCAGCCGGATAGACGGAGTAGC~GCTTCTGGGTTTACATGGAGGGGCTGAGCCACCCCCCGG~TC~
CH
-
By
S ES
A
A A
P
P
N
G
Q
P E P PA E P 5 5 * 5 5 F E" T G E P
L * V
EL 55555 E L
KT
9
KT
9
G L § AL
ch
GATGCGGTGCGTGTCGTGCGTGCGTGT~GTGCGGCCCGGCGGGAGTGC~CGGCCACCGGCACCC~CGGGCGGCCCCGCCGCCCC~CGGGAGCTCCGTGTTCCGTG~CCTACGCTTTATTTTGGT.~
bv
~GAGACTGTGGCCAGGGGCATGTACTTCTTTATTTTT~TTTATGTCTGTTTTTTTTTT~GCCTTTTGCCGTGTG~TCTTTCAGGTTGCATTCT~
P;A
poly
Fro. 1. Nucleotide and amino acid sequence of the cDNA clone, pCLG1, of the chicken MIP and the comparison with those of the bovine MIP (Gorin et al.. 1984). ch, bv: nucleotide sequence of chicken and bovine MIP, respectively, CH, BV: deduced amino acid sequence of chicken and bovine MIP. respectively, (3) identical nucleotide or amino acid residues, (. ) amino acid residues with similar hydrophobicity and electric charge, (-) a gap inserted to visualize the maximum match. The underline in amino acid sequence of chicken MIP shows the sequence confirmed by the sequencing of the CNBr fragment. Helix E, helix F and calmodulin binding site show the presumptive functional domains of the MIP (Got-in et al., 1984 : Peracchia, 1988). The double underline shows the possible polyadenylation signals.
A cDNA
CLONE
OF
CHICKEN
LENS
739
MIP
3. Results A cDNA bank was prepared with poly(A)+ RNA extracted from the lens fiber cells of newly hatched chicken lens. The cDNA bank was amplified once before screening. Approximately 17 000 plaques were assayed with an antiserum against chicken MIP and 70 positive plaques were obtained. Four of them were further plaque purified twice. One clone, which produced a chimeric protein recognized by a monoclonal antibody (6H4) against chicken MIP, was chosen and the insert cDNA was subcloned and named pCLG 1. Plasmids containing fragments of the insert were also prepared and sequenced. Comparison with the sequence of bovine MIP (Gorin et al., 1984) showed that the insert in pCLG1 encodes the Cterminal half of the chicken MIP and contains the 3’ untranslated region of its mRNA, including a putative polyadenylation signal (Fig. 1). To confirm the deduced amino acid sequence, a polypeptide fragment which binds to 6H4 antibody was prepared and sequenced. Through CNBr-fragmentation and affinity chromatography, a single fragment was obtained and sequenced by automated Edman degradation. The sequence, included in Fig. 1 (underlined amino acid sequence), coincided with the predicted C-terminal amino acid sequence of the chicken MIP. Northern blot hybridization of poly(A)+ RNA-rich fraction from the lens fiber cells of newly hatched chicks probed with 32P-labeled pCLG1 showed the presence of transcripts whose lengths are approximately 1.4, 2.2 and 6.6 kb, respectively (Fig. 2), and the shortest one was the most abundant. These transcripts were not detected in poly(A)+ RNA-rich
FIG. 2. Northern blot hybridization of poly(A)+ RNA-rich fraction extracted from chicken lens fiber (left) and cultured chicken pigmented epithelial cells (right) probed with chicken MIP cDNA. One and ten microgram of RNA was loaded on the left and right lane, respectively. Three transcripts with approximate length of 1.4, 2.2 and 6.6 kb are observed only in the lens RNA (arrows on the right side). A band at 4.7 kb is probably a background reaction of contaminating ribosomal RNA.
fraction extracted from other cells such as retinal pigmented epithelial cells cultured in vitro.
4. Discussion The MIP is a major component of membrane intrinsic proteins of the Iens fiber cells and the amino acid sequence deduced from the nucleotide sequence of a full-length cDNA of bovine MIP suggests the presence of six transmembrane r-helix domains (Gorin et al., 1984: Revel and Yancey, 1985). A partial cDNA clone of rat MIP showed that the amino acid residues are 9 3 y0 identical for 130 residues from the C-terminal between bovine and rat MIP (Shiels et al.. 1988 ). When the nucleotide sequences and the amino acid sequences were compared between bovine and chicken MIP. a much higher degree of variation was observed. Close examination of these two sequences showed several interesting points which can be important clues to understand the molecular structure of MIP. The compared regions can be divided into domains whose possible functions have been considered in the bovine MIP. They are transmembrane helices E and F (according to the notation by Gorin et al., 1984) and calmodulin binding site (according to Peracchia, 1988). These notations are used in the following discussion. The helix F is claimed to be a very important domain because, in the bovine MIP, it can form an amphiphilic helix (i.e. a helix composed of hydrophobic and hydrophilic residues), with the hydrophilic residues aligned on one side (Gorin et al., 1984). When the MIP molecules gather in a circle, with the hydrophilic side contiguous, there should appear a transmembrane pore lined with hydrophilic residues. According to the deduced amino acid sequence of the chicken MIP, the hydrophobicity of the helix F is increased through many substitutions of nucleotide residues (Figs 1 and 3). Especially the substitutions of glycines and serine with alanines on the C-terminal half of the helix F raise the hydrophobicity so that there should be no hydrophilic face throughout its length. There can be several interpretations for this interspecific variation. ( 1) Helix F is not the only helix which lines the pore. In the bovine MIP, helix C is also considered as a possible amphiphilic helix (Revel and Yancey, 1985). Sequencing of the full-length cDNA of the chicken MIP is necessary for further inquiry of this possibility. (2) Chicken MIP cannot form a transmembrane pore by itself. but other molecule(s) is(are) needed for the construction of the complete pore. Bovine MIP was shown to possess an ability to construct a pore, when isolated and reconstituted into planar lipid bilayer (Zampighi et al., 1985; Ehring et al., 1988). Such a reconstruction study of the chicken MIP is needed to test this possibility. There is evidence suggesting the interaction of MIP and calmodulin. A consensus sequence for the binding site of calmodulin is found in the amino acid sequence
740
R. KODAMA CHICKEN
BOVINE
MIP
MIP
FIG. 3. Hydrophobicity/hydrophilicity plot for the Cterminal half of the chicken MIP compared with that of the bovine MIP. Calculation was according to Kyte and Doolittle (1982). Bold lines show the presumptive functional domains. They are helix E, helix F and calmodulin binding site, from left to right (see legend for Fig. 1).
of the bovine MIP. neighboring the helix F on the Cterminal side (Peracchia, 1988). A similar amino acid sequence exists in the chicken MIP. The conservation of hydrophobic and basic residues is very conspicuous in the amino acid sequence, although the nucleotide sequence is highly varied [Fig. 1, see Ala(6), Val( 15), Leu( 16), Arg( 7). Arg( 12), Arg( 17) in the chicken MIP amino acid sequence: the numbers in parentheses show the position of each residue when counted from the beginning of the calmodulin binding site]. This strongly suggests the importance of this domain for the function of the protein. The binding of calmodulin to chicken MIP was indirectly shown (Welsh et al., 1982). At the C-terminal of the bovine and chick MIP, there are well-conserved residues including glutamic acids and lysine. As this is the most conserved domain between bovine and chicken cDNA within the CNBr fragment binding the 6H4 monoclonal antibody, which reacts with both bovine and chicken MIP, this domain is a strong candidate for the binding site for the antibody. The polyadenylation signal of the chicken MIP cDNA is ATTAAA rather than the consensus sequence, AATAAA. This polyadenylation signal is also found in the chicken /1Bl crystallin cDNA clone (Hejtmancik et al., 1986) and known to be a functional signal (Wickens and Stephenson, 1984). The bovine MIP cDNA clone also has an unusual polyadenylation signal AAGAAA. and this lack of standard polyadenylation signal was suggested as a cause of the size heterogeneity of bovine MIP mRNAs (Gorin et al.. 1984). This may not be correct, however, because the
ET AL
chicken MIP mRNA. which has a different and probably effective polyadenylation signal, shows a very similar size heterogeneity. In conclusion, the present study of the chicken MIP provides another comparative aspect for the analysis of the function of the MIP. Further cloning of the fulllength cDNA of the chicken MIP is needed for more precise comparative analyses and for gene manipulation studies. such as gepe transfection. The identity of the MIP as a lens fiber gap junction protein is highly controversial. Kecent studies utilizing the immunofreeze fracture technique showed evidences for the identity of the MIP not as a lens fiber gap junction component, but as a component of a tetragonal array of intramembranous particles revealed by freezefracture method (Zampighi et al., 1989 1. Kegardless of the contribution of the MIP to the lens fiber gap junction, MIP seems to play an important role in the stabilization of the lens tissue. The inhibition or enhancement of the expression of MIP by gene manipulation techniques in the course of lens fiber formation from the lens epithelial cells or of transdifferentiation from the retinal pigmented epithelial cells should provide new insights into the role of the MIP in tissue morphogenesis of the lens. Acknowledgments The authors wish to thank Dr T. S. Okada, President of Okazaki National Research Institutes, for encouragement. and Dr H. Maisel, Department of Anatomy and Cell Biology, Wayne State University, for critical reading of the manuscript. Thanks are also due to MS N. Sakurai for assistance in cDNA cloning and to MS H. Kajiura for the operation of the peptide sequencer, which belongs to the Common-Use Facility for NIBB. This study was supported by Grants-in-Aid from the Ministry of Education. Science and Culture. to R. K. and G. E., and Research Funds from the Institute for Cataract Research and the Naito Foundation to G.E. References Agata, K., Yasuda, K. and Okada. T. S. (1983). Gene coding for a lens-specific protein, S-crystallin. is transcribed in nonlens tissues of chicken embryo. Dev. Rio/. 100, 222-6. Eguchi, G. and Okada, T. S. (1973). Differentiation of lens tissue from the progeny of chick retinal pigment cells cultured in vitro: A demonstrationof a switch of cell types in clonal cell culture. Proc. NatI. Arad. Sci. U.S.A. 70. 1495-9. Ehring, G. R.. Zampighi, G. A. and Hall, J. E. (1988). Propertiesof MIP 26 channelsreconstitutedinto planar lipid bilayers.In Gapjunctions(EdsHertzberg,E. I,. and Johnson.R. G.). Pp. 335-46. Alan R. Liss.Inc. : New York. Fitzgerald. P. G. and Goodenough.D. A. (1986). Rat lens cultures: MIP expressionand domainsof intercellular coupling. Invest.Ophthalmol. Vis. Sci. 27. 755-71. Goodenough.D. A. (1979). Lensgapjunctions: a structural hypothesisfor nonregulatedlow-resistanceintercellular pathways. Invest. Ophthalmal.Vis. Sci. 18, 1104-22. Gorin. M. B.. Yancey,S.B.. Cline,J.. Revel,J.-P. and Horwitz. J. (1984). The major intrinsic protein (MIP) of the
A cDNA
CLONE
OF
CHICKEN
LENS
741
MIP
bovine lens fiber membrane : Characterization and structure based on cDNA cloning. Crll 39. 49-59. Hejtmancik. J. F.. Thompson, M. A., Wistow, G. and Piatigorsky, J. ( 1986). cDNA and deduced protein sequence for the /1I31-crystallin polypeptide of the chicken lens. Conservation of the PAPA sequence. 1. Biol. Chern. 261. 982-7.
Itoh. Y. and Eguchi. G. ( 1986). In vitro analysis of cellular metaplasia from pigmented epithelial cells to lens phenotypes: A unique model system for studying cellular and molecular mechanisms of ’ transdifferentiation’. Drv. Biol. 115. 353-62. Johnson, K. G., Klukas. K. A., Tze-Hong. I,. and Spray. D. C. (1988). Antibodies to MP28 are localized to lens junctions, alter intercellular permeability and demonstrate increased expression during development. In Gup lunctions (Eds Hertzberg, E. L. and Johnson. R. G.). Pp. 81-98. Alan K. Liss. Inc.: New York. Kyte, J. and Doolittle, R. F. (I 982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157. 105-32. Menko, A. S.. Klukas. K. A.. Liu. T.-F.. Quade, B.. Sas. D. F.. Preus. D. M. and Johnson, R. G. (1987). Junctions between lens cells in differentiating cultures: Structure, formation, intercellular permeability, and junctional protein expression. Dev. Biol. 123. 307-20. Mochii. M.. Agata. K.. Kobayashi, H.. Yamamoto, T. S. and Eguchi. G. (1988a). Expression of gene coding for a melanosomal matrix protein transcriptionally regulated in the transdifferentiation of chick embryo pigmented epithelial cells. (‘PII Difl 24, 67-74. Mochii. M.. Takeuchi. T., Kodama, R.. Agata, K. and Eguchi, G. (1988b). The expression of melanosomal matrix protein in the transdifferentiation of pigmented epithelial cells into lens cells. Cell Di;Ff.23, 13 3-42. Okada. T. S., Eguchi, G. and Takeichi, M. (1971). The expression of differentiation by chicken lens epithelium in irr vitro cell culture. Drv. Growth Difl. 13, 323-36. Okada. T. S.. Itoh. Y.. Watanabe, K. and Eguchi, G. (1975). Differentiation of lens in culture of neural retinal cells of chick embryos. &v. Biol. 45, 3 18-29.
Paul, D. I,. and Goodenough, D. A. (1983). Preparation, characterization, and localization of antisera against bovine MP26, an integral protein from lens fiber plasma membrane. J. Cell Biol. 96, 625-32. Peracchia, C. (1988). The calmodulin hypothesis for gap junction regulation six years later. In Gap junctions (Eds Hertzberg, E. L. and Johnson, R. G.). Pp. 267-82. Alan R. Liss, Inc.: New York. Revel, J. P. and Yancey. S. B. (1985). Molecular conformation of the major intrinsic protein of lens fiber membranes: Is it a junction protein? In Gap junctions (Eds Bennett. M. V. L. and Spray. D. C.). Pp. 3 348. Cold Spring Harbor Laboratory: New York. Sas. D. F., Sas. M. J.. Johnson, K. R.. Menko. A. S. and Johnson. R. G. (1985). Junctions between lens fiber cells are labeled with a monoclonal antibody shown to be specific for MP26. 1. Cell Biol. 100. 216-25. Shiels. A.. Kent. N. A., McHale, M. and Bangham, J. A. (1988). Homology of MIP26 to Nod26. Nut!. Acid Rrs. 16. 9348. Waggoner. P. R. and Maisel, H. (1978). Immunofluorescent study of a chick lens fiber cell membrane polypeptide. Exp. Eye Res. 27, 151-7. Welsh. M. J., Aster, J. C., Ireland, M., Alcala. J. and Maisel, H. (1982). Calmodulin binds to chick lens gap junction protein in a calcium-independent manner. Science 216, 642-4.
Wickens. M. and Stephenson, P. (1984). Role of the conserved AALJAAA sequence: Four AAUAAA point mutations prevent messenger RNA 3’ end formation. Sciencr 226. 1045-j 1. Zampighi. G. A., Hall. J. E., Ehring. G. R. and Simon, S. A. ( 1989). The structural organization and protein composition of lens fiber junctions. 1. Cell Biol. 108, 2255-75.
Zampighi, G. A., Hall, J. E. and Krenan, M. (198 5). Purified lens junctional protein forms channels in planar lipid films. Proc. .RlRtl. Acad. Sci. U.S.A. 82. 8468-72.
