CLINICAL

IMMUNOLOGY

AND

IMMUNOPATHOLOGY

Vol. 65, No. 2, November, pp. 152-160, 1992

Predominant Usage of Vp8.3 T Cell Receptor in a T Cell Line That Induces Experimental Autoimmune Uveoretinitis (EAU) CHARLES

E. EGWUAGU,’

Laboratory

of

SINA BAHMANYAR, RASHID M. MAHDI, AND RACHEL R. CASPI

Immunology,

National Eye institute,

National Institutes of Health, Bethesda, Maryland

Experimental autoimmune uveoretinitis (EAU) is a T cellmediated autoimmune diseaseinduced in animals by immunization with retinal proteins (or synthetic fragments derived from them) in adjuvant, and it is considered a model of human autoimmune diseasesof the eye. To study the T cell clonotypes that may be involved in EAU, we analyzed the T cell repertoire of three related T cell lines: the pathogenic line LR16, specific to the major uveitogenic epitope of IRBP; its pathogenic subline J; and its nonpathogenic subline A. We examined the expression of the genes coding for the variable regions of the 20 known Lewis rat T cell antigen receptor (TCR) VP families. The nonpathogenic subline was found to contain mostly T cells expressing VB5, VBS.2, and VP19 while the pathogenic subline consisted mainly of cells expressing VB8.3 TCRs. Genomic Southern blot analysis of DNA from the pathogenic subline showed that VRS.Sexpressing T cells were the dominant clonotype, and DNA sequenceanalyses of VB8.3 cDNAs revealed that two VB8.3 TCRs were expressed in the pathogenic subline. One of the Vp8.3 cDNAs encoded a variable region gene segment identical to previously reported rat Vl38.3 TCR while the other differed by two amino acids in the secondcomplementarity determining region (CDRB). Taken together with previous data showing overrepresentation of VBB-expression in T cell lines that induce EAU, hut not in nonuveitogenic T cell lines, our results suggest that VB8.3-expressing T cells represent a pathogenic clonotype in IRBP-induced EAU. 0 1992 Academic Press, Inc. INTRODUCTION

Autoimmune disease results when autoreactive T lymphocyte clones bypass immunoregulatory mechanisms that maintain self-tolerance and cause tissue injury (1). Attempts to control or prevent autoimmunity have consequently focused on identifying and elimi1 To whom correspondence and reprint requests should be addressed. ’ Abbreviations used: TCR, T cell antigen receptor; EAU, experimental autoimmune uveoretinitis; EAE, experimental allergic encephalomyelitis; IRBP, interphotoreceptor retinoid binding protein; SAg, retinal S-Antigen; MBP, myelin basic protein; PCR, polymerase chain reaction; RT-cDNA, reverse transcribed complementary DNA. 152 0090-1229/92

$4.00

Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved

ROBERT B. NUSSENBLATT,

IGAL GERY,

20892

nating T cell clonotypes involved in the pathogenesis of autoimmune diseases. Recent studies showing homogeneity in the antigen receptors of T cells implicated in experimental allergic encephalomyelitis (EAEj2 (2-5! have generated interest in immunotherapy by antibodies (6-8) and by peptide-based vaccines (g-11). Restricted usage of particular V-region genes has also been reported in multiple sclerosis CV812, V815, and V817) (12,131, Crohn’s disease (VP81 (141, spontaneous insulin-dependent diabetes in NOD mice (VP51 (15!, sarcoidosis CV88) (161, collagen-induced arthritis in mice (V86) (171, and rheumatoid arthritis CV88) (18’). We (19, 201 and others (21) had previously reported data suggesting that T cells expressing the TCR VP8 family may be involved in experimental autoimmune uveoretinitis (EAU). EAU is a predominantly T cell-mediated autoimmune disease that shares essential features with certain human intraocular diseases grouped under the term “uveitis” (22-24). It can be induced in susceptible animals by active immunization with ocular antigens, or by adoptive transfer of antigen-specific, CD4’ I and MHC class II restricted T lymphocytes (25-29). The ocular antigens most commonly used to induce EAU are S-antigen (SAgI, a 48-KDa protein involved in phototransduction (30) and interphotoreceptor retinoid binding protein (IRBP), a 140-KDa retinal glycoprotein thought to function in the transport of retinoids between the neural retina and the retinal pigment epithelium (31,321. During the course of studies aimed at characterizing the role of T cells in the pathogenesis of EAU, several T cell lines capable of adoptively transferring the disease to naive syngeneic animals were established (25, 33). Analyses of these lines for VP8 gene expression showed that VPS-expressing T cells were enriched in those lines that induce EAU, but not in nonpathogenic T cell lines with similar antigen specificity (19-21). Although these studies suggested that VPSexpressing cells may be involved in EAU, it was not clear whether T cells belonging to other VP families were also involved. Moreover, since the probe used in these analyses could hybridize to mRNAs from

T CELL

RECEPTOR

all three currently known members of the rat VP8 family, the particular VP8 members that may be directly correlated with disease induction is unknown. In this study we have analyzed the T cell repertoire of three related T cell lines: the pathogenic line LR16 (specific to the major pathogenic epitope of IRBP, aa 1177-1191) (28), its pathogenic subline J, and its nonpathogenic subline A. Our results show that Vp8.3expressing T cells are a dominant T cell type in the pathogenic but not the nonpathogenic subline, suggesting that V88.3 is a pathogenic clonotype in IRBPinduced EAU. MATERIALS

AND METHODS

Synthetic peptides. IRBP-derived synthetic peptides used in this study were synthesized and purified by Applied Biosystems, Inc. (Foster City, CA), using t-BOC chemistry, on a peptide synthesizer (430A; Applied Biosystems, Inc.). The peptide sequences were derived from the sequence of bovine IRBP as reported by Borst et al. (34). Table 1 shows the amino acid sequences of the various peptides and their relationships to IRBP. T cell lines and clone. T cell line LR16 was established from draining lymph nodes of Lewis rats immunized with the R16 peptide (representing the major pathogenic epitope of IRBP) and was maintained according to established procedures (25, 33). This line is CD4’ and MHC class II-restricted as assessed by flow cytometry and proliferation assays (25). Sublines J and A were derived by in vitro selection from T cell line LR16 by colony formation in soft agar. Before selection of the line, LR16 was reselected for three cycles with IRBP to enrich for cells recognizing the native conformation of the epitope. Both sublines were subsequently maintained in culture by propagation in the R16 peptide. Derivation of the R4 line (specific to a nondominant epitope of IRBP, aa 1158-1180) used for comparison in genomic Southern blot analysis (see below) has been reported (33). Clone C4 whose DNA was also used in Southern blot analysis is not pathogenic and was derived from the LR16 line by limiting dilution (unpublished data). Lymphocyte proliferation assay. The response of T cell line LR16 and its sublines J and A to proliferative stimuli was measured essentially as described elsewhere (25). Briefly, washed line cells (2 x 104) and irradiated thymocytes (APC) (4 x 105) in 0.2 ml supplemented RPM1 containing 1% syngeneic rat serum were seeded in triplicate cultures in 96-well, flatbottom microculture trays, with and without the tested antigen. The cultures were incubated for 60 hr and pulsed with 1 pCi[3H]thymidine/well during the last 12 to 16 hr. Cultures were harvested with a PhD harvester (Cambridge, MA) and counted with a Beckman Scintillation Counter.

Vp8.3

USAGE

IN EAU

153

Adoptive transfer ofEAU. Line cells (2 X 105/ml) were stimulated in vitro with 2 pg/ml of R16 peptide in the presence of irradiated syngeneic antigenpresenting cells (6 x 106/ml) for 48 hr. The indicated number of Ficoll-purified cells was injected intravenously into naive Lewis rats. Disease was assessed clinically by the degree of anterior chamber infiltration (loss of red reflex). At 12-14 days eyes were removed and processed for histopathology as described (25). Pathology scores were read in a masked fashion by an independent observer on a scale of 0 to 4, using a semiquantitative grading system based on the extent of tissue damage (35). Preparation of high molecular weight DNA. Ficollpurified cells (4 x lo71 were resuspended in 25 ml of 100 mM NaCl, 10 mM Tris (pH 8.0),25 mM EDTA (pH 8.0). Proteinase K and SDS were added to a final concentration of 100 kg/ml and l%, respectively. The solution was incubated at 37°C for 3-12 hr and extracted twice with phenol/chloroform (l:l), where the chloroform contained isoamyl alcohol at 24:l. This was followed by one chloroform and one ether extraction, and the DNA was precipitated with 2 vol of cold absolute ethanol. DNA was spooled onto a glass rod and resuspended in 0.1 x SSC overnight at 4°C. The resuspended nucleic acid was then digested with heat-treated RNAse A (50 pg/ml) at 37°C for 30 min and extracted as described above. Sodium acetate (pH 5.2) was then added to a final concentration of 300 mM and DNA was precipitated with 2 vol of absolute ethanol. DNA was resuspended in 10 mM Tris (pH 8.01, 0.1 mM EDTA (pH 8.0) at 0.5 pg/ml. Southern hybridization. Ten micrograms each of rat liver DNA and T cell DNAs was digested to completion with EcoRl, separated on 0.7% agarose gels, and transferred onto nitrocellulose membranes as described (36). The filters were prehybridized at 65°C for 6 hr in 5~ SSPE (0.75 M NaCl, 0.05 M Na,HPO,, 0.0025 M EDTA, pH 8.01, 5x Denhardt’s (0.1% Ficoll, 0.1% polyvinylpyrolidone, 0.1% BSA), 100 kg/ml salmon sperm DNA, 0.1% SDS. A 177-bp Hi&/Mae11 fragment coding for amino acids 20-79 of rat Vp8.3 cDNA (see Fig. 2) was gel-purified and used as hybridization probe. The probe was labeled to high specific activity (>lO’ cpm/p. ) by the random-prime method (371, added at 2 x 10 !i cpm/ml, and hybridization was performed in the same solution for 16 hr. Filters were washed four times in 2 x SSPE, 0.1% SDS for 15 min each at room temperature followed by two 30-min high-stringency washes in 0.1 x SSPE, 0.1% SDS at 65°C. Autoradiography was performed overnight at - 70°C. with Kodak X-Omat AR film and Cronex intensifying screens. For analyses of polymerase chain reaction (PCR) amplified fragments, the amplification reaction (35 ~1) was electrophoresed on a 1.5% agarose gel, transferred,

154

EGWUAGU

and fixed onto nylon membranes (Hybond N + , Amersham, Arlington Heights, IL) as recommended by the manufacturer. Filters were prehybridized for 2 hr at 50°C in rapid hybridization solution (Amersham) and hybridization was performed in the same solution containing 5 x lo6 cpm/ml of end-labeled Cl3 oligonucleotide probe (5’CAAACAAGGAGACCTTGGGTGGAGTCACCGT-3) for 12 hr at 50°C. This sequence, internal to the antisense Cp primer used for amplification, and complementary to the rat TCR constant region (nucleotides 349-379, numbering according to Chothia et al. (38) of Lewis rat V88.2 TCR (41, was end-labeled with adenosine 5’-[y-32P]triphosphate and T4 polynucleotide kinase (GIBCO/BRL, Gaithersburg, MD) to high specific activity (>108 cpm/bg). Filters were washed three times at room temperature in 6x SSPE, 0.1% SDS followed by a lo-min high-stringency wash at 50°C. Autoradiography was performed as described above. RNA isolation. Total cellular RNA was isolated from Ficoll-purified T cells after 2 days of stimulation with R16 peptide and 2 days of expansion in IL2containing medium. Purified T cells (lo?, washed twice in ice-cold PBS, were immediately homogenized in 4 it4 guanidine isothiocynate and centrifuged through a cesium chloride cushion (36). After purification by two phenol/chloroform extractions followed by ethanol precipitation, the RNA was digested with RNAse-free DNAse (Promega, Madison, WI). RNA was subsequently purified by phenol, phenol/chloroform, and chloroform extractions, followed by ethanol precipitation, and was stored in ethanol at - 70°C until use. Analysis of TCR gene expression. Complementary DNA (cDNA) for the VP chains was synthesized by the anchor PCR method (39, 40). Briefly, the first strand was synthesized in a 40-~1 reaction containing total RNA (5.0 pg), 1 m&f each dNTP, 2.5 kg oligo(dT),,, 5 mM MgClz, 100 U AMV reverse transcriptase (Promega, Madison, WI), 40 U rRNasin ribonuclease inhibitor (Promega) in reverse transcription buffer (10 mMTris-HCl, pH 8.8,50 mikf KCl, 0.1% Triton X-100). A poly(dG) tail was then introduced with terminal deoxynucleotidyl transferase (Bethesda Research Laboratories, Gaithersburg, MD). The cDNA was diluted to 2 ml in TE 110 mMTris-HCl (pH 8.0), 0.2 mM EDTA (pH 8.011 and subjected to 30 min spin-dialysis using Centricon(Amicon, Danvers, MA) after which the reverse transcribed RNA CRT-cDNA) was suspended to a final volume of 500 ~1 TE. All PCR amplifications were performed in a Perkin-Elmer thermal cycler using 2.5 ~1 RT-cDNA in a total volume of 40 ~1 according to the GeneAmp protocol (Perkin-Elmer Cetus, Norwalk, CT). The PCR reaction buffer was modified to achieve a final MgCl, concentration of 3 mit4. Twentyone oligomers were synthesized and used to amplify all known Lewis rat VP gene family sequences: (1) The

ET AL

antisense rat Cl3 primer (5’-CAATGGATCCCGAGGGTAGCCTTTTGTTTGTCTGCAATCT-3’) containing a BamHl site (41) is specific to nucleotides 395-424 of Lewis rat TCR constant region segment (4). Because this sequence is common to both Lewis rat Cpl and C82, no bias toward amplification of TCR cDNAs encoding either constant region Cp gene element was expected (2). The VP primers were derived from published rat VP sequences (41) and each primer corresponded to a unique sequence located upstream of the 5’ coding region of one of the 20 Lewis rat VP TCR cDNAs. The VP primers were: VP1 (5’-TTCGCGGCCGCATGACCTTCAGGATTCTTCTCT-3’ ); (5’-TTCGCGGCCGCATGTGGCAGTTTTG02 CATTCTGT-3’); (5’-TTGCGGCCGCATGCGGTTTCTCTGCTGTVP3 GTAG-3’1; (5’-TTCGCGGCCGCATGGGTTACACGCTCT04 TCAGTT-3 ’ ); (5’-TTCGCGGCCGCATGTGTAACATTGCATVP5 TCCCTG-3’); (5’TTGCGGCCGCATGAGCAAGCAGGTTC 06 TCTGCT-3’); VP7 (5’-TTCGCGGCCGCATGAGAGTTAGGCTTCTCTCAG-3’); V88.1 (5’-TTGCGGCCGCATGTGTAACACTGACCTCCCTG-3’); Vp8.2 (5’-TTCGCGGCCGCATGTCAAACACTGCCCTCTCTA-3 ’ 1; V88.3 (5’-TTAAGCGGCCGCATGGGCTCCAGGACCTTCTTTG-3’); VP9 (5’-GCGCGGCCGCATGGATGCTAGACTTCTTTACT-3’1; VP10 (5’-TTCGCGGCCGCATGAGCTATAGGCTCCTAAGCT-3’); VP11 (5’-TTAAGCGGCCGCATGGCCACCAGGTTCCTTTGCT-3’); VP12 (5’-TTAAGCGGCCGCATGGGCATCCAGACCCTCTGTT-3’); VP13 (5’-TTATATGCGGCCGCATGGGCACCGGGCTTCTT-3’); VP14 (5’-TTGCGGCCGCATGCTCTACTCTCTCCTTGCCT-3’); V815 (5’-TTCGCGGCCGCATGTTGCTGCTTCTGCTACTTC-3’); V816 (5’-TTCGCGGCCGCATGGACAGCTGGCTGATTTTTA-3’); VP17 (5’-TTAAGCGGCCGCATGGGTACAAGGCTGCTGTGCT-3’); VP18 (5’-TTCGCGGCCGCATGTGGATTTTCCTGCTACTTC-3’); VP19 (5’-GCGCGGCCGCATGCACTGCAAACTTTTCTACT-3’); VP20 (5’-TTCGCGGCCGCATGCTGCTGTTATTCAGACGCC-3’). PCR was performed for a total of 30 cycles consisting of

T CELL RECEPTOR

denaturation at 95°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min, followed by a final lo-min extension at 72°C. VP DNA fragments ranging from 420 to 580 bp were amplified. After PCR, the amplification reaction mixtures were electrophoresed, transferred onto nylon membranes, and hybridized with a 5’ end-labeled oligonucleotide probe as described. Isolation and sequencing of VI38 TCR cDNAs. RTcDNAs were synthesized as described above (see Analysis of TCR gene expression) and Lewis rat VP8 (5’AGAACACATGGAAGCTGCAGTCACAC-3)’ and C6 (5’~g@tcgacTGCGATCTCTGCTTCTGAT-3’) primers were us amplification of VP8 sequences. PCR conditions consisted of denaturation (95”C), annealing (68”C), and extension (72°C) for 1 min each for a total of 30 cycles. This was followed by a final lo-min extension at 72°C to ensure fully duplexed DNA for optimal ligation efficiency. The underlined bases in the primer sequences delineate Pstl and SaII restriction sites incorporated in the primers to aid in cloning into sequencing vectors. Changes in small letters denote nucleotides added 5’ to the Cl3 primer to create the SaII restriction endonuclease site. After amplification, samples were chloroform extracted to remove the mineral oil, ethanol precipitated, and then digested with PstIl SaII restriction enzymes (Boehringer-Mannheim, Indianapolis, IN). DNA digests were resolved on a 1.5% agarose gel and the VP8 fragments were electroeluted, ethanol precipitated, and ligated into the PstI/ SaII sites of Bluescript [KS11 +] sequencing vector (Stratagene, La Jolla, CA). The ligated DNAs were transfected into competent maximum efficiency bacterial strain DH5aF’IQ (GIBCO/BRL, Gaithersburg, MD) and recombinants selected on agar plates containing X-gal and isopropyl-8-n-thio-galactopyranoside. Plasmid DNAs were sequenced on both strands by the dideoxy chain termination method (36) using T3/T7 promoter primers and Sequenase sequencing system

Proliferative

155

V88.3 USAGE IN EAU

(U.S. Biochemical, Cleveland, OH). Sequences were analyzed on a VAX computer using GenBank, EMBL, and NBRFNUC data files. RESULTS

Derivation of T cell sublines A and J. In a previous report we described VP8 TCR gene usage by the uveitogenie T cell line LR16, which is specific to the major pathogenic epitope of IRBP (aa 1177-1191) (20). Southern analyses of DNA from this line using a 300-bp murine VP8 cDNA probe failed to reveal predominant genomic rearrangements, suggesting that the line was either very heterogeneous or contained few VPSexpressing T cells (19, 20). In an attempt to obtain populations of more limited heterogeneity, sublines J and A were derived from the LR16 line as described under Materials and Methods. The fine specificity of LR16, A, and J cells for IRBP-derived peptides was examined using a nested set of truncated peptides based on the immunizing sequence, IRBP1177-1191. As shown in Table 1, the minimal recognized epitope is the nonamer, W15. Adoptive transfer of line cells. LR16 and subline J were immunopathogenic, as demonstrated by their capacity to induce EAU in naive recipient rats (Table 2). The minimal number of cells required for disease induction was 0.5 x lo6 and 4 x lo6 for LR16 and subline J, respectively. Subline A is considered nonpathogenic, as no disease was detected even at 10 x lo6 cells/rat. The disease induced by the line cells was detected clinically as early as 5 days after injection of the cells. The clinical and histopathological changes observed in rats injected with either LR16 or line J cells resembled those seen in rats actively immunized with peptide R16 (28). Analysis of VP gene expression. Total RNAs were isolated from LR16, J, and A, and RT-cDNAs were de-

TABLE 1 Responses of Line LR16 and Sublines A and J to IRBP-Derived

Peptides

Percent-specific response” Line LR16 Stimulant* R16 (1177-1191) R15 (1181-1191) R22 (1182-1191) R21(1183-1191) R20 (1184-1191) W15 (1182-1190) W17 (1181-1189)

aa sequence ADGSSWEGVGVVPDV S WEGVGVVPDV WEGVGVVPDV EGVGVVPDV GVGVVPDV WEGVGVVPD SWEGVGVVP

Subline J

Subline A

Expt. 1

Expt. 2

Expt. 1

Expt. 2

Expt. 1

Expt. 2

100.0 64.2 42.3 0.0 -0.2 26.4 0.0

100.0 68.2 43.1 0.0 -0.2 9.6 -0.1

100.0 83.7 16.7 -0.8 -0.8 15.9 0.0

100.0 81.0 16.3 0.0 - 1.9 29.7 -1.1

100.0 36.6 2.0 0.2 0.4 12.1 0.2

100.0 48.5 3.3 0.0 0.1 7.2 0.0

D Percent-specific response to each peptide (relative to R16) was calculated from L3HIthymidine uptake as 100 x (peptide - PBS)/(RlG PBS). Responses are to peptides at 1 pM concentration. Counts ranged between 25,000 and 101,000 cpm with R16 and 100 and 700 cpm with PBS. b Numbers in parentheses show the location of the residues within the IRBP molecule.

156

EGWUAGU

TABLE2 Uveitogenie

Potential

of T

Cell Line LR16

and

Sublines A and J T cell line

Cells injected”

LR16 J A -__

0.5 x 106 4 x 106 10 x lo6

~--~~~~

EAU incidenceh 315 618 014

EAU severity’ 1.4 1.2

* The line cells were stimulated in uitro with peptide R16 for 48 hr just prior to the adoptive transfer, and the indicated number of cells was injected intravenously into naive recipients. ’ Disease was scored by histopathology 12-14 days after transfer in a masked fashion, by an independent observer, on a scale of 0 to 4, according to criteria previously described (35). ‘Severity represents mean scores of animals which developed EAU.

rived from them as described under Materials and Methods. The T cell repertoires of these lines were analyzed by examining the expression of rat VP TCR transcripts using the PCR method (39). Results of Southern blot analyses of cDNA fragments amplified using primers specific to all known Lewis rat TCR VP gene families are shown in Figs. 1A and 1B. The probe used in these analyses was an end-labeled constant region-specific oligonucleotide sequence, internal to the antisense C8 primer used for amplification. As shown in Fig. 1, the T cell repertoires of the sublines appear to be restricted to only a few VP families; while subline A expressed V85, Vp8.2, and VP19 transcripts (Fig. lA), only V88.3 TCR transcripts could be detected by this method in subline J (Fig. 1B). DNA sequence analysis of TCR from subline J. Because subline

VP8 cDNAs

isolated

J is pathogenic and is enriched in V@expressing T cells, it was of interest to further characterize its VP8 repertoire. RNA isolated from this line was used for first strand cDNA synthesis and the RT-cDNA was used as a substrate for amplification of VP8 fragments as described under Materials and Methods. The 5’ primer used in this analysis extends from nucleotides - 9 to 17 (numbering is according to Chothia et aZ. (38)) and codes for amino acids 1 through 6 of rat VP8 TCR (20, 42). This VP8

B

ET AL.

primer was expected to amplify all members of the rat VP8 family, since this sequence is conserved among the three known rat VP8 family members (41). The 3’ Cp primer is complementary to the rat TCR constant region (nucleotides 389-403) (4,20). This sequence of the constant region is common to both Cpl and Cp2, so that no bias toward amplification to TCR cDNAs coding for either constant region Cp gene elements should occur. Southern blot analysis of the amplification products (see Materials and Methods) showed hybridization of the expected 412-bp fragments to a synthetic oligonucleotide probe internal to the two primers used for amplification (data not shown). To control for possible errors introduced in either the reverse transcription or the Taq polymerization reactions, molecules were subcloned from five independent PCR reactions. After DNA sequence analyses of 25 VP8 cDNA clones and comparing them to published rat VP8 sequences (4,41-431, three distinct VP8 sequences were identified. These cDNAs coded for full-length TCRs, indicating that they are functional TCRs used in this subline. Two of these VP8 sequences were identical to published V88.2 (4) and V88.3 (41, 421 variable region gene segments respectively, and the third type was a VP8.3-like sequence not previously reported. The nucleotide sequences encoded by the two V88.3-, like cDNAs are shown in Fig. 2. As shown in the Figure, the two cDNAs encode variable region gene segments that are almost identical, except for a stretch of five nucleotides at positions 154-158 located in the region coding for the second complementarity determining region (CDRB). The Vp8.3 variant, designated here as VP8.3b, encodes leucine and asparagine instead of serine and glycine at amino acid positions 52 and 53. respectively. The V88.3b cDNA encodes rat Jp2.5 while the Vp8.3 cDNA utilized the J31.4 gene element Utilization of different junctional sequences by the two Vp8.3-like sequences indicates that they are distinct cDNA clones and supports the possibility that VpS.Sb is a new member of the VP8 family and not due to PCR. error. TCR VP8 gene rearrangements in subline J and other uveitogenic T cell lines. Although our PCR and DNA

..: c

FIG. 1. Autoradiograms represent Southern blot analyses of cDNA fragments amplified from RT-cDNAs by individual PCRs using primers specific to the 20 known rat VP TCR gene families (see Materials and Methods). The numbers at the top denote the individual members of the Lewis rat VP TCR families and the arrows to the right indicate the location of the expected PCR products. (A) The RT-cDNA was from T cell subline A. (B) RT-cDNA was from T cell subline J.

T CELL RECEPTOR 20 40 GTCACACAAAGCCCAAGAMCAAGGTGACAGTTACAGG :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: GTCACACAAAGCCCMGAAACAAGGTGACAGTTACAGGW V T Q SPRNKVTVTGKNVTPNC

157

V38.3 USAGE IN EAU 1234567

60 IdAAMTGTGACGlYCAACTGT

Kb

TGTGACGTTCAACTGT

-23

80 100 120 CACCAGACTGATMCCACMCTACATGTACTGGTATCGGCAGGACATGGGGCA~GTCTG :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: CACCAGACTGATMCCACMCTACATGTACTGGTATCGGCA~ACATGGGGCATGGTCTG HQTDNHNYMYWYRQDMGHGL 140 S G 180 AGGCTGATCCATTACTCATATGG~CTGGCAGCTTTG-T~AGATATCCCTGAGGGG .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. :::::::::::::::::::::::::i::::: AGGCTGATCCATTACTCATATGGTCT~MCADCTTTG-TGGAGATATCCCTGAG~G R L IHYSYGLNSPENGDI 200 220 TACAAGGKTCCAGACCAAACCMG-TTTCTTCCCTCTTCCCCC :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: TACMGGTtTCCAGACCAMCCMG-~TCTTCC~ACGCT~AGTCGGCTTCCCCC YRVSRPNQENPPLTLESASP

rD

-9.4 -6.5 -4.3 -2.0 P

E

G

240

-0.3

rJ

260 280 DWISNERLF TCTCAGACATCTGTGTACTTCTGTGCCAGCAGTGACTGGATT~CM~-GA~GTTT :::::::::::::::::::::::::::::::::: TCTCAGACATCTGTGTACTTCTDTCCCAGCAG~GGG~TGC-~CC~GGCAGC~A~AC SQTSVYFCASSGGANTGQLY

rc FGHGTKLSVL 360 TTCGGCCATGGMCCMGCTGTCTGTCCTGGAGGATCTG-CGGTGACTCCACC~G :: :: : :: : :::::: : :: ::::::::::::::i:::::::::::::::::: TTTGGTGAAGGCTCAMGCTGACAGTGCTGGAGGATCTGASAXGTGACTCCACCCMG FGEGSKLTVLEDLKTVTPPK 380 400 GTCTCCTTGTTTGAGCCATCAGAAGCAGAGATCGCAG ::::::::::::::::::::::::::::::::::::: GTCTCCTTGTTTGAGCCATCAGMGCAGAGATCGCAG VSLFEPSEAEIA

FIG. 2. Nucleotide and deduced amino acid sequences of Vp8.3 and V38.3b cDNAs isolated from uveitogenic T cell subline J. V68.3 sequence is shown at the top and below it is V38.3b. Identical nucleotides between the two sequences are indicated by colons. The predicted amino acid sequences encoded by the exons are shown below the nucleotide sequences in the one letter amino acid code. Where the amino acid sequences differ, the sequence encoded by V68.3 is shown above the nucleotide sequences while that for V68.3b is shown below. The D3, Jp, and C3 regions are indicated by arrows as D, J, and C respectively.

sequencing data suggested that V88.3-expressing T cells were relatively abundant in subline J, it was also possible that our results could have merely reflected the efficiency of the V88.3-specific PCR primer in amplifying V88.3 fragments in our PCR assay. Thus, we also examined whether V88.3 gene elements represent a predominant TCR rearrangement in subline J by genomic Southern blot analysis. Figure 3 shows the result of a Southern blot analysis of EcoRI-digested, high molecular weight genomic DNA from T cell line LR16 and from sublines A and J. EcoRI-digested DNAs from another T cell line, R4 (specific to a different IRBP epitope and currently nonpathogenic), and from a nonpathogenic T cell clone (C4; unpublished data), were also electrophoresed in the same gel used for Southern transfer. The Southern blot was screened with a Vp8.3specific cDNA probe as described under Materials and Methods and rat liver DNA was used as marker for germline configuration. The hybridization probe shares only 75% amino acid (81% nucleotide) sequence identity with V88.2 (even less homology with V88.1)

FIG. 3. Genomic Southern blot analysis of DNAs isolated from uveitogenic and non-uveitogenic T cell lines and clones. Ten micrograms of high molecular weight DNA was digested with the restriction enzyme EcoRI, fractionated on a 0.7% agarose gel, blotted onto nitrocellulose filter, and hybridized to V68.3a and Vp8.3b cDNA probes (see Materials and Methods). Lanes l-6, and 7 are T cell lines LR16, R4, subline J, clone C4, subline A, X/hind3 MW standard, and rat liver DNA, respectively.

and thus, was not expected to hybridize to other members of the rat VP8 gene family under the very stringent washing conditions used. As seen in Fig. 3, the restriction fragment length polymorphism (RFLP) pattern observed for lines LR16, R4, and subline A is identical to that of liver DNA, and even subline A which has a strong RT-PCR amplification with the Vp8.2 primer (Fig. 1A) did not show a specific V88.2 rearrangement, suggesting that the probe cross-hybridized only with germline V88.3 sequences. Thus, if indeed there were T cells using V88.3 gene elements, they represented a very small proportion of the cells in these lines. On the other hand, DNA from subline J shows evidence of a rearranged, non-germline, DNA band suggestive of predominant usage of V88.3 gene elements. DISCUSSION

In this report, we have characterized the T cell repertoire of three T cell lines which recognize the same minimal antigenic sequence (Table 1). The parental T cell line, LR16, is pathogenic at low numbers of cells, and analysis of its TCR repertoire showed that it is very heterogeneous and contains cells representing more than 12 TCR families (data not shown). This line was reselected and two T cell sublines were derived (sublines J and A). Subline A was not pathogenic and it contained cells expressing V85, Vp8.2, and VP19 TCRs, but not V88.3 (Fig. 1A). Subline J is weakly pathogenic and was found to contain mostly cells expressing Vp8.3 TCR. Although T cells belonging to other VP8 families could not be detected by autoradiography (Fig. lB), some cells expressing Vp8.2 are present in this line since we were able to amplify V88.2 fragments from RT-RNA derived from line J. The fact

158

EGWUAGU

that Vp8.2 mRNA were sequenced from this line even though Vp8.2 transcripts were not detected by autoradiography reflects the low number of cells expressing the Vp8.2 receptor in this line and suggests that the amounts of Vp8.2 transcripts present were below the detection limits of the PCR Southern method. Although V88.2 may have represented only a small fraction of the VP8 transcripts, they were nonetheless present in the amplified VP8 DNA band and so were easily cloned using the high efficiency transformationcompetent DH5aF’IQ cells. V88.2 expression was previously linked to pathogenicity in the EAE model (41, and suggestive evidence points to involvement of Vp8.2 TCRs in SAg-induced EAU (21). Based on the TCR repertoires expressed by sublines A and J, it would appear that this might not be the case in IRBP-induced EAU. However, our results do not exclude the possibility that only some V88.2 clones are pathogenic, and it may be the nonpathogenic one(s) that are represented in subline A. Similar to subline A, another T cell line specific to a nondominant epitope of IRBP and predominantly expressing Vp8.2 member in the IRBP system appears to be Vp8.3, expressed by the majority of cells in subline J. It is still too early to say whether V88.3 represents the only, or even the major, pathogenic clonotype in IRBP-induced EAU. If this were the case, it would be expected that subline J should be more pathogenic than LR16. As indicated by adoptive transfer experiments (Table 2), subline J is less pathogenic than LRl6. Several explanations can be given for this apparent discrepancy. The most prosaic possibility is that VPS.&expressing T cells do not constitute the major pathogenic clonotype in the LR16 line; the putative major pathogenic clonotype(s) may not be easily clonable or may have very slow growth rates which would account for their absence in our sublines. Another possibility is that the VP8.3-expressing T cells may require cooperation or help from other clonotypes to express full pathogenicity. This is a particularly attractive hypothesis in view of recent reports showing that TABLE3 Nucleotide and Amino Acid Substitutions CDR2 Region Nucleotide

VP8 subfamily Vp8.2 Vp8.3 VP8.3b

-GAT D GGT G GGT G

GTT V TCT S CTT L

and amino AAC GiC G AAC N

within the

acid sequence@ AGT S AGC S AGC s

ACT T ‘ITT F TTT F

D Nucleotide and predicted amino acid sequences are located at positions 151-165 and 51-55, respectively, in the TCR VP8 molecule {numbering according to Chothia et al. (38)).

ET AL

in S-Ag-induced EAU (27) and in MBP-induced EAE (441 in Lewis rats, there is a close spatial relationship between proliferative and pathogenic sites, with proliferative sites overlapping the pathogenic sites of these proteins. It has been argued that this association of proliferative and pathogenic sites is not coincidental but may indeed be of functional importance in these systems (27). Thus, the pathogenic cells may require factors or signals from proliferative cells to manifest their full pathogenic potential. Notwithstanding the correctness of these explanations, this is the first demonstration of oligoclonal amplification of a particular VP element in a uveitogenic T cell line, and it is the first time that the rat Vp8.3 gene element has been implicated in the etiology of an autoimmune disease. As mentioned above, it should be kept in mind that our study does not exclude the possibility that Vp8.3 is only one of several pathogenic clonotypes in IRBPinduced EAU. DNA sequence analyses of the Vp8.3 cDNAs expressed in the pathogenic subline revealed that the VP8.3-expressing T cells are not a homogeneous population. In addition to cells expressing the “classical” rat, Vp8.3, T cells expressing a variant of VB8.3 TCR, designated here as VP8.3b, were also detected; V88.3b differs from Vp8.3 by two amino acids at positions 52 and 53 of the VP8 molecule. As shown in Fig. 2 and Table 3, the nucleotide sequence extending from nucleotide 151 to nucleotide 165 varies among VP8 TCRs expressed in this line (as well as in VP8 TCRs expressed in other uveitogenic lines not shown here), and this sequence appears to be a hypermutable region of the rat VP8 molecule. A closer examination of the nucleotide and amino acid sequences shown in Table 3 reveals that of the two Vp8.3 sequences, V88.3b exhibits more homology to Vl38.2 than V88.3 within this region. It is tempting to speculate that the VP8.3b gene may be an evolutionarily earlier TCR gene element, which underwent further diversification to give rise to V88.3. The apparent exertion of selective evolutionary pressures at this region suggests that amino acids located at this portion of the receptor may be involved in interaction of TCRs with important ligands such as minor lymphocyte antigens or superantigens (44) and may be sites for future evolution of TCR genes, This conclusion is supported by a recent report of mutants of murine Vl38.2 TCR, which also differ in this region (45. 46). In addition to N-region differences (47), T cells expressing V88.3 and V88.3b gene elements used distinct junctional elements; Vl38.3b cDNA encoded rat Jp2.5 while the Vp8.3 cDNA utilized the Jp1.4 gene element. This is surprising since T cells elicited by a common antigenic determinant are thought to express identical CDR3 sequences (48). A possible explanation might be a difference in the fine specificity of epitope recognition, e.g., V88.3 and VBS.Sb-expressing T cells

TCELLRECEPTOR

might recognize different orientations of the same R16 peptide within the MHC antigen binding pocket (49). Taken together with previous data showing overrepresentation of VP&expression in T cell lines that induce EAU, but not in nonuveitogenic T cell lines (19 21), our results support the contention that VP8 expressing T cell populations may be important in the etiology of autoimmune disease of the eye. Our data also reveal an additional level of complexity in TCRs not previously reported; that is, T cells expressing TCRs of the same subfamily are not a homogenous population but may represent a continuum of closely related T cells which may differ by only one or a few amino acids in their TCRs. Variants of the Vp8.2 TCRs that differ by one or a few amino acids have been described in wild mice (45, 46) and these have been assumed to be alleles. Our data, in the inbred Lewis rat, raise the possibility that these mouse Vp8.2 TCRs may not be alleles but may instead represent distinct murine VP8 subfamilies. Given that VP8 TCRs have been implicated in a number of autoimmune diseases (11, 14, 16, 18) and that there is significant effort directed toward designing anti-TCR immunotherapy, heterogeneity within the VP8 subfamily TCRs should be taken into consideration in designing anti-TCR immunotherapies, because vaccines derived from only a single TCR sequence may not confer complete protection against closely related pathogenic T cells. The implication that pathology may result not only from a single clonotype but also from a cumulative effect of several closely related clonotypes is supported by our observation that clones and sublines of limited TCR heterogeneity are either nonpathogenic or less pathogenic than more heterogeneous lines such as LR16. ACKNOWLEDGMENTS

We thank Drs. Steve Kozlowski ical reading of the manuscript.

and Randall K. Ribaudo for crit-

REFERENCES

Schwartz, R. H., A cell culture model for T lymphocyte clonal anergy. Science 248, 1349, 1990. Zamvil, S. S., Mitchell, D. J., Lee, N. E., Moore, A. C., Waldor, M. K., Sakai, K., Rothbard, J. B., McDevitt, H. O., Steinman, L., and Acha-Orbea, H., Predominant expression of a T cell receptor VP gene subfamily in experimental autoimmune encephalomyelitis. J. Exp. Med. 167, 15861596, 1988. Acha-Orbea, H., Mitchell, D. J., Timmermann, L., Wraith, D. C., Trausch, G. S., Waldor, M. K., Zamvil, S. S., McDevitt, H. O., and Steinman, L., Limited heterogeneity of T cell receptors from lymphocytes mediating autoimmune encephalomyelitis allows specific immune intervention. Cell 54, 263-273, 1988. Burns, F. R., Li, X., Shen, N., Offner, H., Chou, Y. K., Vandenbark, A. A., and Heber-Katz, E., Both rat and mouse T cell receptors specific for the encephalitogenic determinant of myelin basic protein use similar Va and VP chain genes even though the major histocompartibility complex and encephalitogenic determinants being recognized are different. J. I&p. Med. 169, 2739. 1988.

V88.3 USAGE IN EAU

159

5. Acha-Orbea, H., Steinman, L., and McDevitt, H. O., T cell receptors in murine Autoimmune diseases. Annu. Rev. Immunol. 7, 371-405,1989. 6. Hashim, G. A., Vandenbark, A. A., Galang, A. B., Diamonduros, T., Carvalho, E., Srinivasan, J., Jones, R., Vainiene, M., Morrison, W. J., and Offner, H., Antibodies specific for VP8 receptor peptide suppress experimental autoimmune encephalomyelitis. J. Zmmunol. 144, 462141627,199O. 7. Owhashi, M., and Heber-Katz, E., Protection from experimental allergic encephalomyelitis conferred by a monoclonal antibody directed against a shared idiotype on rat T cell receptors specific for myelin basic protein. J. Exp. Med. 168, 2153-2164, 1988. 8. Zaller, D. M., Osman, G., Kanagawa, O., and Hood, L., Prevention and treatment of murine experimental allergic encephalomyelitis with a T cell receptor Vp-specific antibodies. J. Exp. Med. 171, 1943-1955, 1990. 9. Vandenbark, A. A., Hashim, G., and Offner, H., Immunization with a synthetic T cell receptor V-region peptide protects against experimental autoimmune encephalomyelitis. Nature 341, 541-544, 1989. 10. Offner, H., Hashim, G. A., and Vandenbark, A. A., T cell receptor therapy triggers autoregulation of experimental encephalomyelitis. Science 251, 430-432, 1991. 11. Howell, M. D., Winters, S. T., Olee, T., Powell, H. C., Carlo, D. J., and Brostoff, S. W., Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides. Science 246,668-670, 1989. 12. Wucherpfennig, K. W., Ota, K., Endo, N., Seidman, J. G., Rosenzweig, A., Weiner, H. L., and Hafler, D. A., Shared human T cell receptor VP usage to immunodominant regions of myelin basic protein. Science 248, 1016-1019, 1990. 13. Ben-Nun, A., Liblau, R. S., Cohen, L., Lehmann, D., TournierLasserve, E., Rosenzweig, A., Jingwu, Z., Raus, J. C. M., and Bach, M., Restricted T cell Receptor VP gene usage by myelin basic protein-specific T cell clones in multiple sclerosis: Predominant genes vary in individuals. Proc. Natl. Acad. Sci. USA 88, 2466-2470, 1991. 14. Posnett, D. N., Schmelkin, I., Burton, D. A., August, A., McGrath, H., and Mayer, L. F., T cell antigen receptor V gene usage. J. Clin. Invest. 85, 1776-1776, 1990. 15. Reich, E.-P., Sherwin, R. S., Kanagawa, O., and Janeway, Jr., C. A., Explanation for the protective effect of the MHC class II I-E molecule in murine diabetes. Nature 346, 326, 1989. 16. Moller, D. R., Konishi, K., Kirby, M., Balbi, B., and Crystal, R. G., Bias toward use of a specific T cell receptor p-chain variable region in a subgroup of individuals with sarcoidosis. J. Clin. Invest. 82, 1183-1191, 1988. 17 Haqqi, T. M., and David, C. S., T cell receptor VP genes repertoire in mice possible role in resistance and sucscepbility to type II collagen-induced arthritis. J. Autoimmun. 3, 113-121, 1990. Stamenkovic, I., Stegnagno, M., Wright, K. A., Krane, S. M., 18. Amento, P. E., Colvin, R. B., Dudquesnoy, R. J., and Kurnick, J. T., Clonal dominance among T lymphocyte infiltrates in arthritis. Proc. Natl. Acad. Sci. USA 85, 1179, 1988. 19. Egwuagu, C. E., Chow, C. C., Beraud, E. P., Caspi, R. R., Mahdi, R. M., Nussenblatt, R. B., and Gery I., Analysis of T cell receptor variable region genes in uveitogenic T cell lines. “Proceedings 5th International Symposium on the immunology and immunopathology of the eye,” pp. 223-226, Elsevier Press, Amsterdam, Netherlands, 1990. 20. Egwuagu, C. E., Chow, C. C. Beraud, E. P., Caspi, R. R., Mahdi, R. M., Brezin, A. P., Nussenblatt, R. B., and Gery, I., T cell receptor p-chain usage in experimental autoimmune uveoretinitis. J. Autoimmun. 4, 315-324, 1991. 21. Gregerson, D. S., Fling, S. P., Merryman, C. F., Zhang, X. M., Li,

160

EGWUAGU

X. B., and Heber-Katz, usage by uveitogenic 15&61, 1991. 22. Faure, J.-P., 215,198O.

E., Conserved T cell receptor V gene T cells. Clin. Immunol Zmmunopathol. 58,

Autoimmunity

in the retina.

Curr.

Top. Eye Res. 2,

23. Gery, I., Wiggert, B., Redmond, T. M., Kuwabara, T., Crawford, M. A., Vistica B. P., and Chader, G. J., Uveoretinitis and pinealitis induced by immunization with interphotoreceptor retinoid-binding protein. Invest. Ophthalmol. Vis. Sci. 27, 129& 1300, 1986. 24. Wacker, W. B., Donoso, L. Jr., and Organisiak, D. T., tion, characterization and genie antigen from bovine

A., Kalsow, C. M., Yankeelov, J. A., Experimental allergic uveitis: isolalocalization of a soluble uveitopathoretina. J. Immunol. 119, 1949, 1977.

25. Caspi, R. R., Roberge, F. G., Mcallister, C. G., El-Saied, M., Kuwabara, T., Gery, Hanna, E., and Nussenblatt, R. B., T cell lines mediating experimental autoimmune uveoretinitis (EAU) in rat. J. Immunol. 136(3), 928-933, 1986. 26. Broekhuyse, R. M., Winkens, H. J., and Kuhlman, E. D., Induction of experimental autoimmune uveoretinitis and pinealitis by IRBP. Comparison to uveoretinitis induced by S-Antigen and opsin. Curr Eye Res. 5, 231, 1986 Gregerson, D. S., Merryman, C. F., Obritsch, W. F., and Donoso, L. A., Identification of potent new pathogenic site in human retinal S-Antigen which induces experimental autoimmune uveoretinitis in LEW rats. Cell. Immunol. 128, 209-219, 1990. Sanui, H., Redmond, T. M., Kotake, S., Wiggert, B., Hu., L., Margalit, H., Berzofsky, J. A., Chader, G. J., and Gery, I., Identification of an immunodominant and highly immunopathogenic determinant in the retinal interphotoreceptor retinoid-binding protein (IRBP). j. Exp. Med. 169, 1947-1960, 1989. Donoso, L. A., Merryman, C. F., Sery, T., Sanders, R., Vrabec, and Fong, S-L., Human interstitial retinoid binding protein; potent uveitopathogenic agent for the induction of experimental autoimmune uveitis. J. Zmmunol. 143, 7943, 1989. Wacker, W. B., Experimental mol. Vis. Sci. 32, 3119-3128, 31.

Chader, (IRBP): relevant

allergic 1991.

G. J., Interphotoreceptor A model protein for molecular studies. Invest. Ophthalmol.

uveitis.

Invest.

T., A

Ophthal-

retinoid-binding protein biological and clinically Vis. Sci. 30, 7, 1989.

32. Adler, A. J., Chader, G. J., and Wiggert, assay for Interphotoreceptor retinoid-binding eye. Methods Enzymol. 189, 213, 1990.

B., Purification protein from

and the

Hu, L., Redmond, T. M., Sanui, H., Kuwabara, T., McAllister, C. G., Wiggert, B., Chader, G. J., and Gery, I., Rat T cell lines specific to a nonimmunodominant determinant of a retinal protein (IRBP) produce uveoretinitis and pinealitis. Cell. Zmmunol. 122,251-261,1989. Borst, D. E., Redmond, T. M., Elser, J. E., Gonda, M. E., Wiggert, B., Chader, G. J., and Nickerson, J. M., Interphotoreceptor retinoid-binding protein (IRBP): Gene characterization, protein Received

February

3, 1992;

accepted

June

25, 1992

ET AL. repeat structure and its evolution. J. Biol. Chem. 263, 1115. 1989. 35. Roberge, F. G., Lorberboum-Galski, H., Le Hoang, P., De Smet. M., Chan, C. C., Fitzgerald, D., and Pastan, I., Selective immunosuppression of activated T cells with the chimeric toxin IL-2PE40: Inhibition of experimental autoimmune uveoretinitis. J Immunol. 143, 3498-3502. 1989. 36. Maniatis, T., Fritsch. E. F., and Sambrook, J., “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laborator?, Press, Cold Spring Harbor, New York, 1989. 37. Feinberg, A. P., and Vogelstein, B., A technique for radiolabel ling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6. 1983. 38. Chothia, C.. Boswell, D. R., and Lesk, A. M., The outhne strut ture of the T cell a/p receptor. EMBO J. 7:3745, 1988. 39. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi. R. G., Horn, G. H., Mullis, K. B., and Erlich, H. A., Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 4874191, 1988. 40. Loh, E. Y., Elliott, J. F., Cwirla, S., Lanier, L. L.. and Davis. M. M.. Polymerase chain reaction with single-sided specificity: analysis of T cell receptor fi chain. Science 243, 217-220. 1989. 41. Smith, L. R., Kono, D. H.. and Theofilopoulos, A. N.. Complexity and sequence identification of 24 rat VP genes. J. Immun.ol. 147. 375-379,199l. 42. Chluba, J.. Steeg, C., Becker, A., Wekerle, H., and Epplen, J. T , T cell receptor p-chain usage in myelin basic protein-specific rat T-lymphocytes. Eur. J. Immunol. 19, 279-284, 1989. 43. Hashim, G., Vandenbark, A. A., Gold, D. P., Diamanduros, ‘1, and Offner, H., T cell lines specific for an immunodominant epitope of human basic protein define an encephalitogenic determinant for experimental autoimmune encephalomyelitisresistant LOU/M rats. J. Immunol. 146, 515-520, 1991. 44. Offner, H., Hashim, G, A.. Chou. Y. K., Celnik, B., Jones, R,, and Vandenbark, A. A., Encephalitogenic T cell clones with variant receptor specificity. J. Immunol. 141, 3828-3832. 1988. 45. Pullen, A. M., Wade, T.. Marrack. P., and Kappler, J. W.. Identification of T cell receptor p chain that interacts with the selfsuperantigen MIS-1”. Cell 61, 1365-1374, 1990. 46. Pullen, A. M.. Potts, W.. Wakeland, E. K.. Kappler, J.. and Marrack. P., Surprisingly uneven distribution of the T cell receptor VP repertoire in wild mice. J. Exp. Med. 171. 49-62. 1990. 47. Davis, M. M., and Bjorkman, P. J., T cell antigen receptor genes and T cell recognition. Nature 334, 395402, 1988. 48. Danska, J. S., Livingstone. A. M., Paragas, V., Ishihara, I., anti Fathman, C. G.. The presumptive CDR3 regions of both T cell receptor a and b chains determine T cell specificity for myoglobin peptides. J. Erp. Med. 172, 27-33, 1990. 49. Berzofsky, J. A.. Cease, K. B., Cornette, J. L., Spouge, J. L.. Margalit, H., Berkower, I. J., Good, M. F., Miller, L. H., and Delisi. C.. Protein antigenic structures recognized by T cells: potential applications to vaccine design. Immunol Rev. 98, 9. 1987.