Neuromol Med (2016) 18:134–145 DOI 10.1007/s12017-016-8383-0

ORIGINAL PAPER

Vorinostat Modulates the Imbalance of T Cell Subsets, Suppresses Macrophage Activity, and Ameliorates Experimental Autoimmune Uveoretinitis Sijie Fang1 • Xiangda Meng1 • Zhuhong Zhang1 • Yang Wang1 • Yuanyuan Liu1 Caiyun You1 • Hua Yan1

•

Received: 18 September 2015 / Accepted: 5 January 2016 / Published online: 21 January 2016 Ó Springer Science+Business Media New York 2016

Abstract The purpose of the study was to investigate the anti-inflammatory efficiency of vorinostat, a histone deacetylase inhibitor, in experimental autoimmune uveitis (EAU). EAU was induced in female C57BL/6J mice immunized with interphotoreceptor retinoid-binding protein peptide. Vorinostat or the control treatment, phosphate-buffered saline, was administrated orally from 3 days before immunization until euthanasia at day 21 after immunization. The clinical and histopathological scores of mice were graded, and the integrity of the blood–retinal barrier was examined by Evans blue staining. T helper cell subsets were measured by flow cytometry, and the macrophage functions were evaluated with immunohistochemistry staining and immunofluorescence assays. The mRNA levels of tight junction proteins were measured by qRT-PCR. The expression levels of intraocular cytokines and transcription factors were examined by western blotting. Vorinostat relieved both clinical and histopathological manifestations of EAU in our mouse model, and the BRB integrity was maintained in vorinostat-treated mice, which had less vasculature leakage and higher mRNA and protein expressions of tight junction proteins than controls. Moreover, vorinostat repressed Th1 and Th17 cells and increased Th0 and Treg cells. Additionally, the INF-c and IL-17A expression levels were significantly decreased, while the IL-10 level was increased by vorinostat treatment. Furthermore, due to the reduced TNF-a level, the macrophage activity was considerably inhibited in EAU

& Hua Yan [email protected] 1

Department of Ophthalmology, Tianjin Medical University General Hospital, No. 154, Anshan Road, Tianjin 300052, China

123

mice. Finally, transcription factors, including STAT1, STAT3, and p65, were greatly suppressed by vorinostat treatment. Our data suggest that vorinostat might be a potential anti-inflammatory agent in the management of uveitis and other autoimmune inflammatory diseases. Keywords Experimental autoimmune uveitis  Vorinostat  T lymphocyte  STAT  NF-jB

Introduction Autoimmune uveitis, one of the main causes of vision loss worldwide, is a group of complicated sight-threatening diseases (Li et al. 2013; Servat et al. 2012). It is estimated that uveitis affects at least 2 million people in the USA and accounts for 10–20 % of cases of blindness in native Americans (Selmi 2014; Horai and Caspi 2011). It is currently believed that self-activated T cells migrate into the eye and cause tissue damage when environmental stimuli break the intraocular immune balance (Prete et al. 2015). Experimental autoimmune uveoretinitis (EAU) induced by interphotoreceptor retinoid-binding protein (IRBP) in mice is an animal model that resembles human uveitis clinically and histopathologically in many aspects and provides an important method for studying the pathogenesis of as well as treatment strategies for human uveitis (Bousquet et al. 2011; Tian et al. 2012). It is widely acknowledged that self-reactive T cells play a key role in the inducement, progression, and recurrence of EAU. The immunopathologic process of EAU is composed of two consecutive stages: the immune activation phase and the immune effector phase (Jiang et al. 2014). In the first stage, lymphocytes are activated in the peripheral lymphoid organs, and in the second stage, these autoreactive T cells

Neuromol Med (2016) 18:134–145

infiltrate the eye and perform effector functions, resulting in autoimmune injury of the eye (Jiang et al. 2014; Caspi 1999, 2010). During the formation of central immunologic tolerance, the medullary thymic epithelial cells expressing the selfantigen IRBP can select and delete immature T cell clones from the developing T cell repertoire that are specific for retinal antigens. Some T cells escape this deletion, and they gradually mature and migrate into the periphery lymphoid organs. There, although they recognize retinal-specific antigens, they are rendered incapable of subsequent responses to these self-antigens. However, some innate immune stimuli, such as lipopolysaccharide, CpGisland, Mycobacterium tuberculosis, and pertussis toxin, and some pro-inflammatory cytokines, such as IL-12, IL-23, IL-6, and transforming growth factor-b (TGF-b), can induce these autoreactive T cell clones, in lymphoid organs or non-lymphoid tissues, to become activated in the presence of resident dendritic cells that express co-stimulators. This leads to a breakdown of peripheral immunologic tolerance, allowing immune reactions against autoantigens to inevitably occur (Caspi 2010). Physiologically, CD4?CD25?Foxp3? regulatory T cells (Tregs) can suppress these types of autoimmune responses and maintain self-tolerance. Sometimes these potential pathogenic T lymphocytes are not effectively controlled by Tregs, so they invade the eye, which should be an immune privileged site, and cause autoimmune disorders (Caspi 2010; Grajewski et al. 2006). The two dominant classes of effector T cells in EAU are the CD4? Th1 cell subset, which secretes interferon-c (IFNc), inhibiting the differentiation of the CD4? Th17 cell subset, and the CD4? Th17 cell subset, which secretes IL-17, inhibiting the differentiation of the CD4? Th1 cell subset (Li et al. 2013; Bousquet et al. 2011; Tian et al. 2012). Unsurprisingly, the clinical manifestations of Th1- or Th17-mediated EAU have some differences. In an S-antigen-induced EAU model in rats, Th17 cells appear to play a dominant role in the pathogenesis and progression of the disease (Bousquet et al. 2011). In this model, both autoreactive antigen-specific Th1 and Th17 cells proliferate, migrate to the retina, destruct the blood–retinal barrier (BRB), and recruit multiple inflammatory corpuscles, such as monocytes, macrophages, and eosinophils, into the eyes. These foreign inflammatory cells, which express and secrete tumor necrosis factor-a (TNF-a) as well as nitric oxide synthase-2 (NOS-2), will further expand the immunologic reactions, thus strengthening the damage to the photoreceptor cell layer (Bousquet et al. 2011; Caspi 2010; Yu et al. 2011). Currently, using glucocorticoids or immunosuppressive agents is still the main therapeutic strategy for treating human autoimmune uveitis (Selmi 2014). However, the long-term local or systemic application of such drugs can lead to severe ocular or systemic complications.

135

Additionally, blocking the same cytokine will not be suitable for all cases due to the heterogeneity among human uveitis (Li et al. 2013; Servat et al. 2012). Therefore, more effective, less noxious, novel medicines are needed to prevent irreversible visual impairment, which is the ultimate purpose of curing human uveitis. Histone deacetylase (HDAC) inhibitors (HDACi), a class of small molecules, are currently being tested as antitumor drugs in many clinical trials. They block the cell cycle and inhibit cell differentiation, thus resulting in cell apoptosis (Bosisio et al. 2008). There is growing evidence that HDACi also have anti-inflammatory effects, and they have been studied in multiple pre-clinical animal models of various inflammatory diseases, including rheumatoid arthritis, juvenile idiopathic arthritis, systemic lupus erythematous, chronic obstructive pulmonary disease, asthma, multiple sclerosis, systemic sclerosis, psoriasis, hepatitis, ulcerative colitis, Crohn’s disease, muscular dystrophy, and experimental autoimmune encephalomyelitis (EAE) (Bosisio et al. 2008; Woan et al. 2012; Ververis and Karagiannis 2011; Ge et al. 2013). In these studies, HDACi were shown to exert regulative effects on T lymphocytes and antigen-presenting cells. Both in vivo and in vitro experiments demonstrated that HDACi significantly downregulate a host of cytokines, such as IL-1b, IL-2, IL-6, IL12, IL-17, IL-23, TNF-a, and interferon-c (IFN-c). They also modulate different components involved in numerous signal transduction pathways, such as the STAT1, STAT3, and NF-jB pathways. However, the exact molecular mechanisms for these effects have yet to be elaborated (Bosisio et al. 2008; Woan et al. 2012; Ververis and Karagiannis 2011; Dinarello et al. 2011; Leng et al. 2006). The 18 human HDACs are subdivided into two families: the classical HDAC family of zinc-dependent metalloproteins, composed of classes I, II and IV; and the NAD?dependent Class III sirtuin family of HDACs. Vorinostat, the HDACi used in this study, is a representative of the hydroxamic acid group (Woan et al. 2012) and has already been used clinically as an anti-tumor drug. However, its therapeutic effect on autoimmune diseases like EAU is still poorly understood (Ge et al. 2013). Here, we investigated the anti-inflammatory effect of vorinostat on the mouse EAU model induced with human IRBP peptide 1–20 (IRBP1–20). Our findings support the possible use of vorinostat in the treatment of human uveitis.

Materials and Methods Animals The protocols for animal experiments were approved by the Laboratory Animal Care and Use Committee of the

123

136

Tianjin Medical University and are in compliance with the Association for Research in Vision and Ophthalmology animal policy (ARVO Statement for the Use of Animals in Ophthalmic and Vision Research). Female C57BL/6J wildtype mice aged between 6 and 8 weeks were purchased from the Academy of Military Medical Science (Beijing, China). They were housed in pathogen-free conditions with water and food available ad libitum and a 12-h light/12-h dark cycle. Reagents Human IRBP1–20 (GPTHLFQPSLVLDMAKVLLD) was synthesized and purified by Sangon (Shanghai, China). Complete Freund’s adjuvant was obtained from SigmaAldrich (St Louis, MO, USA). Heat-killed M. tuberculosis strain H37Ra was obtained from Difco (Detroit, MI, USA), and pertussis toxin was obtained from List Biological Laboratories (Campbell, CA, USA). Vorinostat was purchased from Higher Biotech Co., Ltd. (Shanghai, China). The primers used for real-time PCR were chemically synthesized by Sangon. The antibodies used for flow cytometry were as follows: FITC-anti-mouse CD4 (1:100, BD Biosciences, San Jose, CA, USA), PE-anti-mouse IFNc (1:100, BD Biosciences), PE-anti-mouse IL-17A (1:100, BD Biosciences), PerCP-Cy5.5-anti-mouse CD25 (1:100, BD Biosciences), PE-anti-mouse Foxp3 (1:100, eBioscience, San Diego, CA, USA), PerCP-Cy5.5-anti-mouse CD3 (1:100, BD Biosciences), and PE-anti-mouse CD62L (1:100, BD Biosciences) antibodies. The antibodies used for western blotting were as follows: mouse anti-mouse IFN-c (1:500, GeneTex, CA, US), rabbit anti-mouse IL17A (1:1000, Abcam, Cambridge, UK), rabbit anti-mouse TNF-a (1:1000, GeneTex), rabbit anti-mouse IL-10 (1:500, Abcam), rabbit anti-mouse TGF-b (1:250, Cell Signaling Technology, MA, USA), rabbit anti-mouse p65 (1:1000, Cell Signaling Technology), rabbit anti-mouse STAT1 (1:1000, Cell Signaling Technology), rabbit anti-mouse phospho-STAT1 (1:500, Cell Signaling Technology), mouse anti-mouse STAT3 (1:5000, Abcam), mouse antimouse phospho-STAT3 (1:2000, Cell Signaling Technology), and mouse anti-mouse b-actin (1:1000, Zhongshan Goldenbridge Biotechnology, Beijing, China) antibodies. Induction, Treatment, and Clinical Assessment of EAU Each female C57BL/6J mouse was subcutaneously immunized with 300 lg human IRBP1–20 in a 0.2-ml emulsion with complete Freund’s adjuvant supplemented with 2 mg/ml M. tuberculosis H37Ra (1:1 v/v) in one footpad and on the top of the tail head. Simultaneously, the mouse also received 1 lg Bordetella pertussis toxin

123

Neuromol Med (2016) 18:134–145

intraperitoneally. A dose of 50–100 mg/kg/day of vorinostat is required for it to have an anticancer effect (Ge et al. 2013; Butler et al. 2000), and no animal suffering was observed during the course of this study with our dose of 75 mg/kg/day vorinostat. Vorinostat dissolved in phosphate-buffered saline (PBS) was orally administrated daily for EAU treatment from 3 days before immunization, as in a previous study (Ge et al. 2013) (n = 30). Mice in the control group were treated with PBS daily in the same way (n = 30). From day 9 to day 21 after immunization, the fundus oculi of mice were examined daily by using a headmounted binocular indirect ophthalmoscope with a 90-diopter handheld condensing lens. Eye-ground photography was taken with an oto-endoscope (27018A, Karl Storz, Tuttlingen, Germany) computer imaging system after pupil dilation and topical corneal anesthesia. A coverslip and medical sodium hyaluronate gel (Bausch & Lomb Freda, Shandong, China) were used to counteract the influence of the corneal curvature. The clinical score of each mouse was assessed according to Caspi’s criteria (Agarwal et al. 2012) by two ophthalmologists on day 21 after immunization. Histopathological Analysis of EAU At day 21 after immunization, the mice were euthanized. The eyes were then enucleated and immersed in PBS with 10 % formaldehyde and 5 % glacial acetic acid. The fixed and dehydrated tissues were embedded in paraffin wax, and 5-lm-thick sections were made at different levels. Eye sections were stained with hematoxylin and eosin for histopathological assessment according to Caspi’s criteria (Agarwal et al. 2012). Evaluation of the BRB and Retinal Vasculature As previously described (Copland et al. 2012), mice were injected with 100 ll of 2 % (w/v) Evans blue (SigmaAldrich) through the tail vein and killed 2 h later. The eyes were enucleated and immediately fixed in 4 % paraformaldehyde for another 2 h. After removing the corneas, lenses, and scleras, the retinas were dissected and washed in cold PBS. Then, the retinas were spread on clean glass slides, vitreous side up, and mounted with mounting medium (Sangon). Photographs were taken on a confocal scanning laser imaging system fitted with krypton-argon lasers (FV1000, Olympus, Tokyo, Japan). Fluorescence-Activated Cell Sorter (FACS) of T Lymphocytes Cells were isolated from mouse spleen samples by mashing and passing through a cell strainer (40-lm nylon, BD

Neuromol Med (2016) 18:134–145

Falcon). For Th1 and Th17 subset analyses, the cells were stimulated with 500 ng/ml phorbol myristate acetate (Sigma-Aldrich), 500 ng/ml ionomycin (Sigma-Aldrich), and 1 lg/ml brefeldin A (BD Biosciences) for 4 h. The cells were then harvested and stained with anti-mouse CD4, anti-mouse-IFN-c, or anti-mouse-IL17A for Th1 and Th17 subset examination. For Th0 and Treg subset analyses, the cells were stained with anti-mouse CD3, antimouse CD4, and anti-mouse CD62L or anti-mouse CD4, anti-mouse CD25, and anti-mouse Foxp3, respectively. After staining, all the samples were examined using a BD FACSCalibur, and the data were analyzed with FlowJo 7.6. All samples were tested in triplicate. Immunohistochemical Staining Sections (5 lm thick) were prepared from paraffin-embedded tissues and incubated with rat anti-mouse F4/80 monoclonal antibody (1:200, GeneTex) at 4 °C overnight after deparaffinization with xylene, rehydration with descending concentrations of ethanol, quenching of endogenous peroxidase with 3 % H2O2 treatment, and blocking with 3 % bovine serum albumin in PBS at room temperature. Sections were then stained with biotinylated anti-rat IgG secondary antibody (1:200, Vector Laboratories, Burlingame, CA) for 2 h followed by incubation with horseradish peroxidase (HRP)-conjugated streptavidin for 1 h at room temperature. The location of F4/80 was visualized by using diaminobenzidine (Zhongshan Goldenbridge Biotechnology, Beijing, China). Sections were finally counterstained with hematoxylin and mounted. Images were captured on a Leica DMI4000B (Leica Microsystems, Hesse, Germany). Immunofluorescence The eyes were removed on day 21 post-immunization and immediately embedded in optimal cutting temperature compound. The frozen sections were cut with a freezing cryostat at -20 °C. The sections were then air-dried at room temperature, fixed in ice-cold acetone for 10 min, and blocked in 3 % bovine serum albumin in PBS. The sections were incubated overnight at 4 °C with primary antibodies (rat anti-mouse F4/80, dilution 1:200, GeneTex; rabbit anti-mouse p65, dilution 1:200, Cell Signaling Technology; mouse anti-mouse claudin-5, dilution 1:200, Invitrogen, CA, USA; mouse anti-mouse ZO-1, dilution 1:200, Invitrogen). After three washes in PBS, the sections were incubated with Alexa Fluor 488-conjugated donkey anti-rat IgG (H?L) antibody, Alexa Fluor 594-conjugated donkey anti-rabbit IgG (H?L) antibody, Alexa Fluor 488-conjugated donkey anti-mouse IgG (H?L) antibody, or Alexa Fluor 594-conjugated donkey anti-mouse IgG

137

(H?L) antibody (1:200, Life Technologies, Grand Island, New York, USA) for 1 h. Finally, the sections were stained with 40 ,6-diamidino-2-phenylindole for 1 min and mounted with mounting medium (Sangon). Sections were examined under a Nikon Coolscope (Nikon, Dusseldorf, Germany). RNA Isolation and Real-Time Quantitative Polymerase Chain Reaction The total RNA was extracted from retinas with Trizol reagent (Invitrogen), and cDNA was synthesized with TransScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). Mouse ZO-1, claudin5, and occludin transcripts were quantified by real-time quantitative PCR using b-actin as an internal control. The PCR conditions were 94 °C for 30 s, followed by 40 cycles at 95 °C for 20 s, 57 °C for 20 s, and 72 °C for 20 s. All the procedures were performed according to the manufacturers’ directions. The primers used are shown in Table 1. The relative expression of mRNA was evaluated by the 2-DDCt method and normalized to the expression of bactin. All reactions were run in triplicate. Western Blotting Retinas and choroids were carefully dissected from the mouse eyes. The quantification of total protein was performed using a protein assay according to the manufacturer’s instructions (Bradford Protein Assay; Bio-Rad, Hercules, CA, USA). Equal amounts of protein were separated by electrophoresis on a 10–12 % dodecyl sulfate– polyacrylamide gel and transferred electrophoretically onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). After blocking in 5 % skim milk in Tris-buffered saline with 0.1 % Tween-20 for 1 h, the membranes were incubated with the specific primary antibodies described above overnight at 4 °C. Then, the membranes were washed in Tris-buffered saline with 0.1 % Tween-20 and incubated with HRP-affinipure goat anti-rabbit IgG or HRP-affinipure goat anti-mouse IgG secondary antibodies (EarthOx, LLC, San Francisco, CA, USA) at room Table 1 Nucleotide sequences of primers used for quantitative RTPCR detection Gene ZO-1

Sequence(50 –30 ) ATTTACCCGTCAGCCCTTCT TCGCAAACCCACACTATCTC

Claudin-5

ATCGGTGAAGTAGGCACCAA CTGCCCTTTCAGGTTAGCAG

Occludin

TGAATGGCAAGCGATCATAC TGCCTGAAGTCATCCACACT

123

138

temperature for 1 h. Blots were visualized using an ECL ChemiDocTM MP System (Bio-Rad) according to the manufacturer’s instructions. b-actin was used as an internal reference. All experiments were repeated in triplicate.

Neuromol Med (2016) 18:134–145

reaction, resulting in decreased histopathological scores (1.58 ± 0.74 vs. 0.50 ± 0.45, p \ 0.05; Fig. 1c, d). Vorinostat Maintains the Integrity of the BRB and the Retinal Vasculature

Statistical Analyses All the data are presented as the mean ± SD and were analyzed by SPSS 19.0 software. The p values were calculated using the Student’s t test, and the differences are considered statistically significant if p \ 0.05. Graphing was performed using GraphPad Prism 5.0 software (Graphpad software, San Diego, CA, USA).

Results Vorinostat Treatment Ameliorates the Clinical Manifestations in EAU Mice To investigate the therapeutic effect of vorinostat on the mouse EAU model, EAU mice were treated with PBS as a control or with vorinostat. All the mice in both groups were examined using a head-mounted binocular indirect ophthalmoscope with a 90-diopter handheld condensing lens from day 9 to day 21 after IRBP1–20 immunization. The clinical manifestation of EAU was scored according to Caspi’s criteria by two independent ophthalmologists before euthanasia on day 21 post-immunization. On the same day, eye-ground photography was taken with an otoendoscope. Our data suggest that mice in the control group suffered from severe retinal exudative lesions, while vorinostat treatment partially ameliorated retinopathy, resulting in significantly reduced clinical scores in the vorinostat-treated group (2.90 ± 0.88 vs. 0.95 ± 1.07, p \ 0.01; Fig. 1a, b). Vorinostat Treatment Attenuates the Histopathological Injuries of the Retinas Recently, vorinostat was tested as an immunomodulation agent in a mouse EAE model that has many similarities with EAU. Because EAE was previously confirmed to be clinically alleviated by vorinostat treatment (Ge et al. 2013), our group investigated the anti-inflammatory effect of vorinostat on the histopathological changes caused by EAU. On day 21 post-immunization with IRBP1–20, the mice in both groups were killed and tissue slices of their retinas underwent pathological assessment based on Caspi’s criteria. The microscopic appearance of retinas from PBS-treated mice was disorganized with vasculitis and inflammatory cellular infiltration. In contrast, the retinas from vorinostat-treated mice had less of an inflammatory

123

To further evaluate the protective effect of vorinostat on retinas, the BRB integrity was examined using Evans blue dye. In humans, the vascular beds supplying the retina may sustain injury as a result of underlying disease, such as diabetes, and/or the interaction of genetic predisposition, environmental insults, and age (Miller et al. 2013). Therefore, it was vital for us to appraise the BRB damage in EAU, which models many features of immune-mediated vasculitis. The Evans blue staining revealed a large amount of leakage around the retinal vessels in PBS-treated mice. In contrast, only mild leakage was seen in specimens from vorinostat-treated mice (Fig. 2a). Furthermore, both claudin-5 (green) and ZO-1 (red) expression levels were higher in the retinas from vorinostat-treated mice than in those from PBS-treated mice (Fig. 2b). Our results were further supported by the tight junction protein (ZO-1, claudin-5, and occludin) mRNA expression levels. Vorinostat treatment enhanced the level of ZO-1 (p \ 0.01) and claudin-5 (p \ 0.01) gene expression compared with the levels in the control group; however, the occludin gene expression level was not significantly different between the two groups (p [ 0.05; Fig. 2c). Vorinostat Regulates the Imbalance of T Lymphocyte Subsets in EAU Mice Th1 lymphocytes are one of the pathogenic effector cells in EAU (Bousquet et al. 2011). Additionally, a host of studies have reported that Th17 lymphocytes are involved in many forms of inflammatory disease, including autoimmune diseases, such as uveitis, and infection. Importantly, Th17 cells and Tregs are reciprocal subsets of CD4? T cells, and they exert opposite effects on immune responses (Fan et al. 2011). Consequently, we examined the T cell subsets in the spleens of vorinostat-treated and PBS-treated mice using flow cytometry. Our data indicate that vorinostat treatment suppresses the percentage of CD4?IFN-c?Th1 cells (1.04 ± 0.22 vs. 0.44 ± 0.19 %, p \ 0.01; Fig. 3a) as well as that of CD4?IL17?Th17 cells (0.75 ± 0.26 vs. 0.33 ± 0.12 %, p \ 0.01; Fig. 3b) and increases the percentage of CD4?CD25?Foxp3?Treg cells (19.22 ± 1.93 vs. 25.18 ± 3.76 %, p \ 0.01; Fig. 3c) compared with PBS treatment. Interestingly, the percentage of CD3?CD4?CD62L?Th0 cells (21.74 ± 2.52 vs. 30.56 ± 2.81 %, p \ 0.01; Fig. 3d) was also higher in vorinostattreated mice than in PBS-treated mice.

Neuromol Med (2016) 18:134–145

139

Fig. 1 Fundus and histopathological manifestations of EAU mice. a Fundus images of mice from the PBS- or vorinostat-treated groups. b Clinical score in mice from the vorinostat- or PBS-treated groups. Values represent the mean ± SD. (*p \ 0.05, **p \ 0.01; Student’s t test) (n = 6). c Images of hematoxylin and eosin-stained sections

A

Control

Vorinostat

B

from mice in the vorinostat- or PBS-treated groups (original magnification 9100). d Histological scores of sections from mice in the vorinostat- or PBS-treated groups. Values represent the mean ± SD. (*p \ 0.05, **p \ 0.01; Student’s t test) (n = 6)

Normal mouse

claudin-5

C

Normal mouse

ZO-1

Fig. 2 Effect of vorinostat treatment on the BRB. a Evans blue leakage in the vorinostat- or PBS-treated groups (original magnification 9200) (n = 6). b Images from immunohistochemistry showing claudin-5 (green) and ZO-1 (red) expression in the retinas of normal,

Control

Vorinostat

claudin-5

Control

claudin-5

Vorinostat

ZO-1

ZO-1

vorinostat- or PBS-treated mice (n = 6). c qRT-PCR data showing the transcription of tight junction proteins in vorinostat- or PBStreated mice. Values represent the mean ± SD. (*p \ 0.05, **p \ 0.01; Student’s t test) (n = 6) (Color figure online)

123

140

Neuromol Med (2016) 18:134–145

Vorinostat Down-Regulates Pro-Inflammatory Cytokines and Up-Regulates Anti-Inflammatory Cytokines To identify which vital cytokines are involved in the antiinflammatory effect of vorinostat treatment on EAU

Control

Vorinostat

IFN-

A

pathogenesis, the protein levels of pro-inflammatory mediators (TNF-a, IFN-c, and IL-17A) and anti-inflammatory mediators (TGF-b and IL-10) were measured by western blot assays. Compared with PBS-treated mice, vorinostat-treated mice had lower levels of TNF-a, IFN-c, and IL-17A protein expression (Fig. 4). Additionally, IL-

CD4

IL-17

B

CD4

Foxp3

C

CD25

CD62L

D

CD4 Fig. 3 T lymphocyte subsets in vorinostat- or PBS-treated EAU mice Lymphocyte samples were isolated from the spleens of mice in vorinostat- or PBS-treated groups on day 21 after immunization. For Th1 or Th17 analyses, cells were stained with anti-CD4 and anti-IFNc or anti-IL-17A antibodies. For Treg or Th0 analyses, cells were stained with anti-CD4, anti-CD25, and anti-Foxp3 or anti-CD3, anti-

123

CD4, and anti-CD62L antibodies. a Percentage of Th1 lymphocytes. b Percentage of Th17 lymphocytes. c Percentage of Treg lymphocytes (gated on CD4? cells). d Percentage of Th0 lymphocytes (gated on CD3? cells). Values represent the mean ± SD. (*p \ 0.05, **p \ 0.01; Student’s t test) (n = 6)

Neuromol Med (2016) 18:134–145

141

10 expression levels were elevated in vorinostat-treated mice, but TGF-b levels were not significantly different between the two groups (Fig. 4). Vorinostat Treatment Represses Pathogenic Macrophage Activity in Retinas Macrophage infiltration is an important feature in EAU pathology. These cells may increase the permeability of retinal and choroidal vessels, destroy the BRB, and lead to additional cell infiltration (Bousquet et al. 2011; Dick 2000). To explore whether the activity of pathogenic macrophages is repressed by vorinostat treatment, we conducted immunohistochemical staining to detect these effector cells. We observed fewer macrophages in the retinas of vorinostat-treated mice than in those of PBStreated mice (Fig. 5a). The results from additional experiments illustrate that vorinostat treatment suppresses both the number and the activity of pathogenic macrophages. Almost no p65-expressing (red) macrophages (green) were detected in samples from the vorinostat-treated group by immunofluorescence staining (Fig. 5b), which was congruent with the decreased TNF-a levels described above (Fig. 4). Additionally, consistent with the immunofluorescence staining results, the level of p65 protein expression was significantly decreased in vorinostat-treated mice compared with that in PBS-treated mice, as demonstrated by the western blotting results (Fig. 5c). Vorinostat Inhibits NF-jB and STAT Signaling Pathways in Inflammatory Cells To determine whether vorinostat treatment decreases proinflammatory cytokines, such as TNF-a, IFN-c, and ILFig. 4 Expression levels of pro-inflammatory cytokines and signal transduction proteins as assessed by western blotting The expression levels of IFN-c, IL-17A, TNF-a, TGF-b, IL-10, STAT1, p-STAT1, STAT3, and p-STAT3 in PBS- or vorinostattreated mice were assessed by western blot analyses, and representative blots are shown here. (n = 6)

Control

17A, through the down-regulation of the STAT1 or STAT3 cell signaling pathways, the expression levels of STAT1, STAT3, their phosphorylated forms, and p65 were tested with western blot assays. Our results show that STAT1, p-STAT1, and STAT3 were repressed by vorinostat treatment compared with PBS treatment, while p-STAT3 levels were similar between the vorinostat- and PBS-treated groups (Fig. 4).

Discussion Vorinostat is a hydroxamate that inhibits HDAC I and II, which are involved in the regulation of inflammatory reactions, cell proliferation, and differentiation, as well as HDAC IV, which modulates the balance between autoimmunity and immune tolerance (Woan et al. 2012; Licciardi and Karagiannis 2012). This drug has anti-tumor effects in non-small cell lung cancer, multiple myeloma, leukemia, lymphoma, and central nervous system tumors (Woan et al. 2012). Vorinostat is also the first HDACi approved by the US Food and Drug Administration for the clinical treatment of cutaneous T cell lymphoma. However, the therapeutic values of vorinostat for the treatment of autoimmune diseases, especially neurological ones, such as multiple sclerosis, and ophthalmological ones, such as uveitis, have been poorly defined. When vorinostat inhibits HDAC I and II, several intracellular histone and non-histone proteins, such as NF-jBs and STATs, are left in highly acetylated states, leading to chromatin structural changes and altered expressions of immune-related genes, which is the core mechanism of its immunomodulation. HDACi have multiple functions, including the activation of CD4?CD25?Foxp3? regulatory Control

Vorinostat

IFN-

IL-17A

IL-10

TGF-

STAT1

P-STAT1

STAT3

P-STAT3

TNF-

Vorinostat

-actin

123

142 Fig. 5 Macrophage number and activity in PBS- or vorinostat-treated EAU mice. a Immunohistochemical staining of retinas from PBS- or vorinostat-treated mice. The black arrow indicates macrophages. (n = 6) b Immunofluorescence results from PBS- or vorinostat-treated mice. The white arrows indicate the p65-positive (red) macrophages (green). (n = 6). c The p65 protein level was assessed by western blot in PBS- or vorinostat-treated mice. (n = 6) (Color figure online)

Neuromol Med (2016) 18:134–145

A

Control

B

Vorinostat

C

Control

Vorinostat

p65 -actin

T cells to constrain Th17 cell differentiation, the direct repression of Th1 cell activities, and the inhibition of antigen-presenting cell functions through the targeting of NF-jB signaling pathways (Licciardi and Karagiannis 2012). Here, we demonstrate that vorinostat alleviates EAU in mice and limits the development of inflammatory reactions in the retinas. Additionally, our research enriches the understanding of how vorinostat could be used in treating autoimmune diseases and opens up the potential for its application in ophthalmology. Beginning on day 9 after immunization, mice in both groups were examined with a binocular indirect ophthalmoscope daily until they were killed on day 21 post-immunization. The clinical manifestations were scored by two ophthalmologists from our department at day 21, which was the peak period of EAU onset. Our data show that the mice in the PBS group manifested more severe clinical signs, including retinal exudation, vasculitis, and bleeding, with significantly higher scores than the mice in the vorinostat group (Fig. 1a, b). Histopathological examination results further illustrate the retinal edema and thickening with a massive infiltration of mononuclear cells in the vitreous cavities in control mice. Comparatively, mice treated with vorinostat had less mononuclear cell infiltration and mostly normal retinal structures (Fig. 1c, d). Taken together, these findings suggest that vorinostat has a therapeutic effect on EAU. We also revealed that vorinostat has a protective effect on the retinal vascular barrier. Evans blue dye was widely dispersed from the retinal vessels into the peripheral

123

vascular spaces in PBS-treated mice, indicating an increased retinal vascular permeability resulting from immune pathological injury (Fig. 2a). As mentioned above, the integrity of the BRB and the maintenance of ocular microvascular permeability mainly depend on the expressions of tight junction proteins, namely ZO-1, claudin-5, and occludin (Copland et al. 2012). Our immunofluorescence staining of claudin-5 and ZO-1 revealed higher expression levels of these proteins in the retinas of mice treated with vorinostat than in those treated with PBS (Fig. 2b). Moreover, we measured the mRNA level of each tight junction protein in both groups using qRT-PCR and found elevated expression levels of claudin-5 and ZO-1 in vorinostat-treated mice compared with their levels in PBStreated mice (Fig. 2c). These findings are in agreement with our results from the Evans blue staining and immunohistochemistry. Notably, the loss of tight junction proteins is not only present in the EAU model but is also a feature in many other ophthalmopathies, such as diabetic retinopathy and age-related macular degeneration (Erickson et al. 2007). Evidence is accumulating that caveolar transport is a major mechanism of pathological vascular barrier breakdown (Klaassen et al. 2013). Additionally, endothelial cells and pericytes contribute significantly to BRB maintenance (Klaassen et al. 2013). However, it is not yet clear how these are affected by vorinostat treatment. Therefore, additional studies on the exact role of vorinostat in maintaining BRB integrity are required. In the rodent EAU model, early studies suggested that Th1 cells were the effector T lymphocytes in this model,

Neuromol Med (2016) 18:134–145

but subsequent work has gradually shed light on the pathogenesis of Th17 cells in EAU (Yoshimura et al. 2013; Yadav et al. 2011; Amadi-Obi et al. 2007). The levels of IFN-c secreted by Th1 cells and IL-17A secreted by Th17 cells are increased sharply during the course of EAU, and they promote inflammatory injury in the retina. Reductions in the levels of these pro-inflammatory cytokines after treatment have been validated by a multitude of studies (Wang et al. 2012), which are analogous to our present research on vorinostat (Fig. 4). We identified the T lymphocyte phenotypes in mouse spleens by flow cytometry, and the percentages of CD4? Th1 cells and CD4? Th17 cells increased in PBS-treated mice, while the proliferations of these two cell subsets were effectively controlled in vorinostat-treated mice (Fig. 3a, b). Consequently, our findings suggest that vorinostat alleviates EAU severity by reducing the infiltration of specific T lymphocyte subsets into the eye. These results agree with the findings from a study conducted by Bosisio and his colleagues, which showed that vorinostat blocks the Th17 cell differentiation. Their study indicated that vorinostat treatment effectively suppressed IL-12 and IL-23, which inhibited T lymphocytes from differentiating into Th1 and Th2 cell subsets, respectively (Bosisio et al. 2008). The findings in our present study are also consistent with those reported by Ge et al. (2013), which delineated the effect of vorinostat on a mouse model of EAE, which is similar to EAU and is also mediated by Th17 cells. Interestingly, an increased level of homing receptor CD62 expression on CD4? T cells was observed in our vorinostat-treated group (Fig. 3d). Immune reactions are thought to decrease CD62L expression levels (Yoshimura et al. 2013; Mora and von Andrian 2006), so we hypothesize that the reduction of T cell activation and the inhibition of T cell migration into inflammatory sites following vorinostat treatment may be partially through the mechanism of enhancing CD62 receptor levels. Recently, it has been established that Tregs control almost all immune responses to some degree (Fan et al. 2011). Therefore, we focused on the role of Tregs in EAU pathogenesis and investigated whether vorinostat could enhance their functions. Tregs dominantly express Forkhead family transcription factor (Foxp3), which activates many suppressive genes in Tregs and inhibits many effector T cell genes (Fan et al. 2011). Acetylation is an essential factor for the manipulation of FOXP3 expression, and the application of HADCi to increase the level of FOXP3 acetylation is an efficacious method for relieving autoimmune diseases and transplant rejection (Wang et al. 2009a, b). The Wang group reported that HDACi might induce immune tolerance to allografts by enhancing Treg function (Wang et al. 2009a, b). In vivo, the population and activity of Treg cells can be enhanced by HDACi treatment. Recently, many studies

143

have investigated the involvement of HDACi in regulating alloimmunity and the potential of HDACi for treating different mouse models of autoimmune diseases, including the recombination-activating gene-2-deficient mouse and two adoptive transfer models. In each of these studies, HDACi treatment expanded the CD4?CD25?Foxp3? Treg population with a corresponding up-regulation of FOXP3 protein expression and acetylation. Simultaneously, the expression levels of some vital genes for Treg functions, such as CTLA4 and GITR, were increased as well (Choi and Reddy 2011). Prior studies have also demonstrated that treatment with either TsA, which is another HDACi, or vorinostat increases the FOXP3 mRNA level (Wang et al. 2009a, b). Our present study found that EAU in mice is alleviated by vorinostat treatment through Treg up-regulation, which agrees with the findings reported by these previous studies (Fig. 3c). Taken together, these findings suggest that vorinostat not only represses the two effector T lymphocyte subsets in the mouse EAU model, but it also enhances both CD62L and Treg cell functions, thus restoring immune balance and maintaining self-tolerance. Th1 cells are characterized by the secretion of IFN-c, which signals via phosphorylation of STAT1 by JAK1 and JAK2 (Romagnani et al. 2009; Ga´lvez 2014), while Th17 cell differentiation depends on the STAT3-activating cytokines, such as IL-6, IL-21, and IL-23 (Romagnani et al. 2009; Ga´lvez 2014). The JAK/STAT signaling pathway has been implicated in the pathogenesis of several diseases, such as inflammatory bowel disease (Ga´lvez 2014). As shown by our flow cytometry results, the pathogenic T cell clonal expansions were effectively controlled in vorinostattreated mice compared with those in PBS-treated mice. Based on those findings, we further examined whether the transcription factor STAT1, which stimulates the differentiation of naı¨ve CD4? T cells into the Th1 subset, and STAT3, which stimulates the differentiation of naı¨ve CD4? T cells into the Th17 subset, were down-regulated in vorinostat-treated mice. Our western blot results show that vorinostat treatment suppresses both STAT1 and STAT3 levels (Fig. 4). Furthermore, we found that STAT1 phosphorylation was also impeded by vorinostat treatment, which agrees with the findings from work on vorinostat treatment in graft-versus-host disease by Leng et al. (2006) (Fig. 4). Our study and previous publications collectively suggest that blocking activation of the signaling pathways responsible for effector T cell subset differentiation might be one mechanism for the effect of vorinostat treatment in autoimmune diseases. Macrophages are another important group of inflammatory cells in EAU, and they are recruited by IFN-c and IL-17A secreted by their corresponding effector T cells. These cells can amplify the immune response by producing TNF-a and other cytokines that directly cause tissue

123

144

Neuromol Med (2016) 18:134–145

damage (Bousquet et al. 2011). In this study, we used immunohistochemical staining and immunofluorescence to investigate the activities of macrophages, and we found fewer macrophages in the retinas of vorinostat-treated mice than in PBS-treated mice (Fig. 5a), suggesting that vorinostat treatment limits the damage normally induced by macrophages during EAU in mice. The transcription factor NF-jB is present in the cytoplasm of macrophages in a resting state, consisting of a heterodimer of p50 and p65 sequestered by the inhibitor of jB (IjB). After the degradation of IjB, the p50/p65 component is subsequently released and translocated into the nucleus, where it activates the transcription of genes involved in innate immunity and inflammation (de Kozak et al. 2007). This signaling pathway plays a vital role in the activation of a wide range of inflammatory molecules, such as TNF-a and NOS-2 (Hayden and Ghosh 2012; Bousquet et al. 2011; de Kozak et al. 2007). Vorinostat treatment reduced the number of p65-expressing macrophages in the retinas compared with PBS treatment (Fig. 5b). Similarly, the TNF-a expression level was reduced considerably by vorinostat treatment (Fig. 4). Additionally, our data suggest that the p65 protein expression was also significantly decreased in vorinostat-treated mice (Fig. 5c). Based on these findings, we posit that vorinostat attenuates macrophage activities by down-regulating the p65 level, leading to less p65 translocation into the nucleus with a subsequent decrease in TNF-a transcription.

Conclusion Vorinostat is a very effective drug for treating the experimental mouse model of autoimmune uveoretinitis. Our results provide evidence that vorinostat suppresses CD4? Th1 and Th17 cells, increases FOXP3? Tregs, and inhibits macrophage activities, thus ameliorating EAU in mice. Vorinostat may induce its anti-inflammatory effects by regulating the STAT and NF-jB signaling pathways. This study presents encouraging evidence for the use of HDACi such as vorinostat for the therapeutic intervention in inflammatory diseases like uveitis. As its immunosuppressive mechanisms have not yet been completely determined, additional studies are needed before vorinostat treatment of these diseases can be used in clinical practice. Acknowledgments This study was supported by National Natural Science Foundation of China (Grant Numbers 81371038 and 91442124). Compliance with Ethical Standards Conflict of interest of interest.

123

The authors declare that they have no conflict

Ethical Approval All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

References Agarwal, R. K., Silver, P. B., & Caspi, R. R. (2012). Rodent models of experimental autoimmune uveitis. Methods in Molecular Biology, 900, 443–469. Amadi-Obi, A., Yu, C. R., Liu, X., Mahdi, R. M., Clarke, G. L., Nussenblatt, R. B., et al. (2007). TH17 cells contribute to uveitis and scleritis and are expanded by IL-2 and inhibited by IL-27/ STAT1. Nature Medicine, 13(6), 711–718. Bosisio, D., Vulcano, M., Del Prete, A., Sironi, M., Salvi, V., Salogni, L., et al. (2008). Blocking TH17-polarizing cytokines by histone deacetylase inhibitors in vitro and in vivo. Journal of Leukocyte Biology, 84(6), 1540–1548. Bousquet, E., Camelo, S., Leroux les Jardins, G., Goldenberg, B., Naud, M. C., Besson-Lescure, B., et al. (2011). Protective effect of intravitreal administration of tresperimus, an immunosuppressive drug, on experimental autoimmune uveoretinitis. Investigative Ophthalmology & Visual Science, 52(8), 5414–5423. Butler, L. M., Agus, D. B., Scher, H. I., Higgins, B., Rose, A., Cordon-Cardo, C., et al. (2000). Suberoylanilide hydroxamic acid, an inhibitor of histone deacetylase, suppresses the growth of prostate cancer cells in vitro and in vivo. Cancer Research, 60(18), 5165–5170. Caspi, R. R. (1999). Immune mechanisms in uveitis. Springer Seminars in Immunopathology, 21(2), 113–124. Caspi, R. R. (2010). A look at autoimmunity and inflammation in the eye. Journal of Clinical Investigation, 120(9), 3073–3083. Choi, S., & Reddy, P. (2011). HDAC inhibition and graft versus host disease. Molecular Medicine, 17(5–6), 404–416. Copland, D. A., Liu, J., Schewitz-Bowers, L. P., Brinkmann, V., Anderson, K., Nicholson, L. B., & Dick, A. D. (2012). Therapeutic dosing of fingolimod (FTY720) prevents cell infiltration, rapidly suppresses ocular inflammation, and maintains the blood-ocular barrier. The American Journal of Pathology, 180(2), 672–681. de Kozak, Y., Omri, B., Smith, J. R., Naud, M. C., ThillayeGoldenberg, B., & Crisanti, P. (2007). Protein kinase Czeta (PKCzeta) regulates ocular inflammation and apoptosis in endotoxin-induced uveitis (EIU): Signaling molecules involved in EIU resolution by PKCzeta inhibitor and interleukin-13. The American Journal of Pathology, 170(4), 1241–1257. Dick, A. D. (2000). Immune mechanisms of uveitis: Insights into disease pathogenesis and treatment. International Ophthalmology Clinics, 40(2), 1–18. Dinarello, C. A., Fossati, G., & Mascagni, P. (2011). Histone deacetylase inhibitors for treating a spectrum of diseases not related to cancer. Molecular Medicine, 17(5–6), 333–352. Erickson, K. K., Sundstrom, J. M., & Antonetti, D. A. (2007). Vascular permeability in ocular disease and the role of tight junctions. Angiogenesis, 10(2), 103–117. Fan, H., Liu, Z., & Jiang, S. (2011). Th17 and regulatory T cell subsets in diseases and clinical application. International Immunopharmacology, 11(5), 533–535. Ga´lvez, J. (2014). Role of Th17 cells in the pathogenesis of human IBD. ISRN Inflammation, 25(2014), 928461. Ge, Z., Da, Y., Xue, Z., Zhang, K., Zhuang, H., Peng, M., et al. (2013). Vorinostat, a histone deacetylase inhibitor, suppresses

Neuromol Med (2016) 18:134–145 dendritic cell function and ameliorates experimental autoimmune encephalomyelitis. Experimental Neurology, 241, 56–66. Grajewski, R. S., Silver, P. B., Agarwal, R. K., Su, S. B., Chan, C. C., Liou, G. I., & Caspi, R. R. (2006). Endogenous IRBP can be dispensable for generation of natural CD4? CD25? regulatory T cells that protect from IRBP-induced retinal autoimmunity. The Journal of Experimental Medicine, 203(4), 851–856. Hayden, M. S., & Ghosh, S. (2012). NF-jB, the first quarter-century: Remarkable progress and outstanding questions. Genes & Development, 26(3), 203–234. Horai, R., & Caspi, R. R. (2011). Cytokines in autoimmune uveitis. Journal of Interferon and Cytokine Research, 31(10), 733–744. Jiang, G., Sun, D., Yang, H., Lu, Q., Kaplan, H. J., & Shao, H. (2014). HMGB1 is an early and critical mediator in an animal model of uveitis induced by IRBP-specific T cells. Journal of Leukocyte Biology, 95(4), 599–607. Klaassen, I., Van Noorden, C. J., & Schlingemann, R. O. (2013). Molecular basis of the inner blood–retinal barrier and its breakdown in diabetic macular edema and other pathological conditions. Progress in Retinal and Eye Research, 34, 19–48. Leng, C., Gries, M., Ziegler, J., Lokshin, A., Mascagni, P., Lentzsch, S., & Mapara, M. Y. (2006). Reduction of graft-versus-host disease by histone deacetylase inhibitor suberonylanilide hydroxamic acid is associated with modulation of inflammatory cytokine milieu and involves inhibition of STAT1. Experimental Hematology, 34(6), 776–787. Li, G., Yuan, L., Ren, X., Nian, H., Zhang, L., Han, Z. C., et al. (2013). The effect of mesenchymal stem cells on dynamic changes of T cell subsets in experimental autoimmune uveoretinitis. Clinical and Experimental Immunology, 173(1), 28–37. Licciardi, P. V., & Karagiannis, T. C. (2012). Regulation of immune responses by histone deacetylase inhibitors. ISRN Hematology, 2012, 690901. Miller, J. W., Le Couter, J., Strauss, E. C., & Ferrara, N. (2013). Vascular endothelial growth factor a in intraocular vascular disease. Ophthalmology, 120(1), 106–114. Mora, J. R., & von Andrian, U. H. (2006). T-cell homing specificity and plasticity: New concepts and future challenges. Trends in Immunology, 27(5), 235–243. Prete, M., Dammacco, R., Fatone, M. C., & Racanelli, V. (2015). Autoimmune uveitis: Clinical, pathogenetic, and therapeutic features. Clinical and Experimental Medicine. doi:10.1007/ s10238-015-0345-6. Romagnani, S., Maggi, E., Liotta, F., Cosmi, L., & Annunziato, F. (2009). Properties and origin of human Th17 cells. Molecular Immunology, 47(1), 3–7.

145 Selmi, C. (2014). Diagnosis and classification of autoimmune uveitis. Autoimmunity Reviews, 13(4–5), 591–594. Servat, J. J., Mears, K. A., Black, E. H., & Huang, J. J. (2012). Biological agents for the treatment of uveitis. Expert Opinion on Biological Therapy, 12(3), 311–328. Tian, L., Lei, B., Shao, J., Wei, L., Kijlstra, A., & Yang, P. (2012). AAV2-mediated combined subretinal delivery of IFN-a and IL-4 reduces the severity of experimental autoimmune uveoretinitis. PLoS One, 7(6), e37995. Ververis, K., & Karagiannis, T. C. (2011). Potential non-oncological applications of histone deacetylase inhibitors. American Journal of Translational Research, 3(5), 454–467. Wang, L., de Zoeten, E. F., Greene, M. I., & Hancock, W. W. (2009a). Immunomodulatory effects of deacetylase inhibitors: Therapeutic targeting of FOXP3? regulatory T cells. Nature Reviews Drug Discovery, 8(12), 969–981. Wang, L., Tao, R., & Hancock, W. W. (2009b). Using histone deacetylase inhibitors to enhance Foxp3(?) regulatory T-cell function and induce allograft tolerance. Immunology and Cell Biology, 87(3), 195–202. Wang, R. X., Yu, C. R., Mahdi, R. M., & Egwuagu, C. E. (2012). Novel IL27p28/IL12p40 cytokine suppressed experimental autoimmune uveitis by inhibiting autoreactive Th1/Th17 cells and promoting expansion of regulatory T cells. Journal of Biological Chemistry, 287(43), 36012–36021. Woan, K. V., Sahakian, E., Sotomayor, E. M., Seto, E., & Villagra, A. (2012). Modulation of antigen presenting cells by HDAC inhibitors: Implications in autoimmunity and cancer. Immunology and Cell Biology, 90(1), 55–65. Yadav, U. C., Shoeb, M., Srivastava, S. K., & Ramana, K. V. (2011). Amelioration of experimental autoimmune uveoretinitis by aldose reductase inhibition in Lewis rats. Investigative Ophthalmology & Visual Science, 52(11), 8033–8041. Yoshimura, T., Benny, O., Bazinet, L., & D’Amato, R. J. (2013). Suppression of autoimmune retinal inflammation by an antiangiogenic drug. PLoS One, 8(6), e66219. Yu, C. R., Mahdi, R. R., Oh, H. M., Amadi-Obi, A., Levy-Clarke, G., Burton, J., et al. (2011). Suppressor of cytokine signaling-1 (SOCS1) inhibits lymphocyte recruitment into the retina and protects SOCS1 transgenic rats and mice from ocular inflammation. Investigative Ophthalmology & Visual Science, 52(9), 6978–6986.

123