Journal of Autoimmunity (1991)

4,315-324

T Cell Receptor @chain Usage in Experimental Autoimmune Uveoretinitis

Charles E. Egwuagu, Christopher Chow, Evelyne Beraud, Rachel R. Caspi, Rashid M. Mahdi, Antoine P. BrCzin, Robert B. Nussenblatt and Igal Gery Laboratory

of Immunology,

National Eye Institute, National Bethesda, MD 20892, USA

Institutes of Health,

(Received 183~1~ 1990 and accepted 22 October 1990) Genomic rearrangements to the T-cell receptor (TCR) VgS gene locus were examined in T cells derived from the lymph nodes of Lewis rats immunized with either S-Antigen or peptides derived from interphotoreceptor retinoid binding protein (IRBP). The cells used in these studies are from T-cell lines that have been selected by several cycles of antigen/IL-2 stimulations, or clones isolated from these lines. No apparent rearrangement of the Vg8 gene was observed by Southern analysis, suggesting that if indeed there are T cells using VgS gene elements they represent small proportions of the cells in these T-cell lines that induce EAU (uveitogenic T cells) and that the lines may consist of large numbers of clones. On the other hand, we have demonstrated VgS gene expression in uveitogenic T-cell populations by Northern analysis and by polymerase chain reaction (PCR). Although VgS gene transcripts were detectable in pathogenic, but not in non-pathogenic, T-cell lines using a VP cDNA probe, RNA from pathogenic T cell lines did not hybridize to another probe specific for rat Vgg.2. Taken together, these results suggest that, unlike the T-cell lines that mediate experimental allergic encephalomyelitis (EAE), some T-cell lines that induce BAU do not predominantly express VgS.2 gene but other member(s) of the VgS family.

Introduction Experimental autoimmune uveoretinitis (EAU) is an intraocular inflammatory disease induced in various species by immunization with ocular-specific antigens, such as S-Antigen or the interphotoreceptor retinoid binding protein (IRBP) [ 1, 21. Correspondence to: Charles E. Egwuagu, PhD, Laboratory NIH. Building 10, Room lOBlO, Bethesda, MD 20892, USA.

of Immunology,

National

Eye Institute,

0 1991 Academic

Press Limited

315 08968411/91/020315+10$03.00/0

316 Charles E. Egwuagu et al. Immunization with either protein or with peptides derived from them leads to the activation of MHC class II restricted, DTH-inducing helper T cells, resulting in the destruction of photoreceptor cells [3-5 1. The signs and symptoms of EAU share essential features with certain uveitic conditions in man, such as sympathetic ophthalmia, birdshot retinochoroidopathy, Behcet’s disease and the Vogt-KoyanagiHarada (VKH) syndrome [3]. Recent studies showing homogeneity in the receptors of the T cells implicated in several autoimmune diseases have generated interest in immunotherapy by peptidebased vaccines. For example, in experimental autoimmune encephalomyelitis (EAE), the T cells specific for myelin basic protein (MBP) and responsible for disease induction are found to predominantly use and express the Vp8.2 T-cell receptor (TCR) gene element [6-91. Vandenbark et al. [lo] and Howell et al. [ 111could protect rats from EAE induction by immunizing them with synthetic peptides based on the sequence of the CDR2 and CDR3 of the MBP-specific rat Vp8.2 element of the TCR. In this study, we have investigated the TCR expressed in T-cell lines and clones specific for S-Antigen and IRBP, and compared the V-region gene usage between T cells capable of transferring EAU and non-pathogenic T cells. A major goal of these analyses was to determine whether the uveitogenic T cells predominantly use a specific V-region gene, a prerequisite for design of synthetic peptide-based immunotherapy against uveitic conditions. Our results show that the uveitogenic T-cell lines, R4 and ThS8 express Vp8.2 gene while the other pathogenic T-cell lines that induce EAU express a member of the VP8 TCR family which appears to be distinct from Vp8.2. Transcripts of V/38 gene elements were not detectable in non-pathogenic T-cell clones and line.

Materials and methods T-cell lines and clones All T-cell lines (CD4+/CD8-) were derived from lymph nodes of Lewis rats immunized in complete Freund’s adjuvant with S-Antigen or with peptides corresponding to uveitogenic determinants of IRBP [4, 121. T cells in lines ThS8 and LR16 recognize S-Antigen or the immunodominant epitope 1177-I 191 of IRBP [ 121, respectively (immunodominance is as defined by Hu et al. [5]). These lines are highly pathogenic, requiring 5 x lo6 and 0.5 x lo6 cells, respectively, to adoptively transfer EAU to naive syngeneic recipients [4 and R. R. Caspi, unpublished results]. The R4 T-cell line recognizes a non-dominant epitope of IRBP and is considered to be mildly pathogenic. ThS4 is a non-uveitogenic T-cell line; even 2 x lo7 cells are insufficient for induction of disease [R. R. Caspi, unpublished results]. Clones C3 and C4 were isolated from line LR16 by limiting dilution and are non-pathogenic, even though they share the same antigenic fine specificities as the parental pathogenic LR16 line [E. Beraud, unpublished results]. A pathogenic T-cell line specific to myelin basic protein (MBP) and known to express Vp8.2 message was utilized as a positive control for the Northern analyses. This line was a generous gift from Dr Ofer Lider (Weizmann Institute of Science, Rehovot, Israel).

T cell receptors in EAU

317

Probes The murine

TCR VP8 cDNA probe is a 0.3 kb EcoRI/HindIII fragment that shares with the rat V88.2 segment [13]. The probe was labelled with deoxycytidine 5’-[a-32P]-triphosphate by the random priming method to high specific activity (> 10gcpm/ug). The TCR V88.2 specific 63-mer oligonucleotide probe is complementary to nucleotides coding for amino acids 39-59 of rat TCR V88.2 [7, 9, 141. This probe was end-labelled with adenosine 5’-[y-32P]-triphosphate and T4 polynucleotide kinase to high specific activity (> lo* cpm/pg).

87”,, homology

Northern and Southern blot analyses Genomic DNA and RNA were isolated by standard methods from T cells purified on Ficoll gradients [ 15 1. Twenty micrograms of RNA per sample were electrophoresed onto 1.2Oso agarose-formaldehyde gels and transferred to nylon filters. For Southern analysis, 10 l.tg of rat liver, thymus and T-cell DNAs were digested to completion with EcoRI and XbaI, separated on 0.7oi, agarose gels and transferred onto nylon membranes as previously described [ 151. The filters were prehybridized at 65°C for 1 h in 5 x SSPE (0.75 M NaCl, 0.05 M Na,HPO,, 0.005 M EDTA, pH S.O), 5 x Denhardt’s (0.19, Ficoll, 0.1 9/, polyvinylpyrolidone, 0.1 ?/, BSA), 100 pg/ml salmon sperm DNA, 0.1 ?, SDS. Murine VP8 cDNA probe was added at 2 x lo6 cpm/ml and hybridized overnight in the same solution. Filters were washed twice in 2 x SSPE, O.l”, SDS for 20 min at room temperature followed by two 15-min high stringency washes in 0.1 x SSPE, O.l’& SDS at 65°C. Autoradiography was performed at - 70°C with Kodak X-Omat AR film and Cronex intensifying screens. In analyses using synthetic oligonucleotide probes, filters were prehybridized in 6 x SSPE, 100 pg/ml salmon sperm DNA. Hybridization 5 x Denhardt’s, 0.1 Yb SDS, was performed in the same solution containing 5 x lo6 cpm/ml of end-labelled Vb8.2 oligonucleotide probe for 20 h at 65°C. Filters were washed three times at room temperature in 6 x SSPE, 0.1 ob SDS followed by a 1-min wash at 50°C. Autoradiography was performed as described above.

Polymerase chain reaction (PCR)

amplification

One million T cells were lysed in 300 ul lysis buffer: 140 mM NaCl, 10 mM Tris.Cl, pH 8.0,15 mM MgCl,, 0.5:; Nonidet (NP-40). Nuclei were removed by a lo-second centrifugation and the supernatant incubated at 37°C for 20 min followed by a 90°C incubation for 10 min. Ten microliters of the supernatant were then coprecipitated with 3 pmol oligo(dT) and reverse transcribed using Moloney murine leukemia virus reverse transcriptase for 30min at 37°C. The amplification cocktail consists of: cDNA (5 pl), Taq Polymerase (2.0 U), 1.5 mM MgCl,, 100 pmol each of Vp8.2 (5’-AGA ACA CAT GGA AGC TGC AGT CAC AC-3)’ and C8 (5-‘GTC GTC GAC TGC GAT CTC TGC TTC TGA T-3’) primers, in a total volume of 100 ul standard PCR buffer [9]. Denaturation (95”(Z), annealing (68°C) and extension (72°C) were 1 min each for 30 cycles in a Perkin Elmer Cetus Thermo-cycler. The very stringent conditions used allowed for specific amplification of VP8 sequences.

318 Charles E. Egwuagu ef al. I

2

3

4

5

6

7

a

Figure 1. Genomic Southern blot analysis. Ten micrograms of high molecular weight DNA were digested with the restriction endonucleases EcoRI (lanes 1,2,3,4) and XbaI (lanes 5,6,7,8), fractionated on a 0.70/l agarose gel, blotted onto a nylon membrane and hybridized to the VP8 cDNA probe (see Materials andmethods). Rat liver DNA is on lanes 1,5; rat thymus DNA, lanes 2,6; LR16 T cell line DNA, lanes 3,7 and ThS8 T cell line DNA is on lanes 4 and 8.

The resulting 407 bp fragment was gel purified and subcloned into the PstI and Sal1 sites of M13mpl9 and Bluescript [KSII+] sequencing vectors Results Genetic analysis of T-cell receptor P-chain usage

Because the encephalitogenic T-cell lines and clones that mediate EAE use predominantly the V88.2 gene element, Southern blot analysis was performed to determine whether the majority of uveitogenic T cells that mediate EAU also use this same Vregion gene. The restriction enzymes used in our analyses have all been shown by others to reveal genomic rearrangements with respect to VP8 [7,16]. A blot of EcoRI and XbaI digested high molecular weight genomic DNA, isolated from T-cell lines LR16 and ThS8, was screened with a VP8 probe that hybridizes to all three mouse VP8 genes (V88.1, V88.2 and V88.3). Rat liver and rat thymus DNAs were also digested with EcoRI and XbaI and served as markers for germline configuration of Vj38 gene restriction fragment length polymorphism (RFLP) pattern. In Figure 1, it

T cell receptors in EAU

319

c4 s.-

1

c3 THS4 THSB THS4 c3

ia)

(b) t 1.3 Kb

t 1.3 Kb

Figure 2. Expression of VP8 and V88.2 mRNA in rat S-Antigen and IRBP-specific T-cell lines and clones. Total RNA (20 pg/lane) was fractionated on 1.2y0 agarose-formaldehyde gels, transferred onto nylon membranes and hybridized as described in Materials and methods. (a) Hybridization is with the hexamer-primed 0.3 kb murine VP8 cDNA probe. Molecular weight marker (MW) is h DNA/Hind111 fragments. (b) Hybridization is with the end-labelled synthetic V88.2-specific oligonucleotide probe.

can be seen that DNAs from uveitogenic T-cell lines do not differ significantly from the germline configuration. Similar results were obtained using Hind111 and BglII digested DNAs (data not shown). Lack of clonal VP8 rearrangements suggests that the proportions of T cells using VP8 gene elements in these lines are quite small. Alternatively, it may be that the VP8 T cells are very heterogenous, with none of the clones constituting more than 5% of the total T-cell clones in each of the T-cell lines (lower limit of detection of a specific TCR V-region gene rearrangement [21]).

Expression of V/B genes in uveitogenic and non-uveitogenic T-cell lines

Northern analysis of total RNA isolated from uveitogenic T cell lines (LR16 and ThSB), non-uveitogenic T-cell clones (C3 and C4) and the non-uveitogenic T-cell line ThS4 were performed to evaluate whether these T-cell lines and clones contained cells expressing mRNA transcripts of the VP8 gene family. An MBP-specific encephalitogenic T-cell line was included in this analysis as a positive control. Analysis using the 0.3 kb murine VP8 cDNA probe shows a positive hybridization signal in lanes 2, 3, 4 corresponding to the MBP-specific T-cell line and the two uveitogenic T-cell lines LR16 and ThS8 respectively. It is noteworthy that the intensity of the hybridization signal of the RNA from the uveitogenic lines is lower than that seen with the RNA from the encephalitogenic line. No hybridization signals were detected in lanes 1,5,6,7 corresponding to the molecular weight marker &DNA/Hind111 -fragments), the non-pathogenic T-cell line ThS4 and clones C3 and C4 respectively (Figure 2). This result suggests that VPB-expressing T cells may be enriched in pathogenic, but not in non-pathogenic, T cell populations. However, more pathogenic and non-pathogenic T-cell lines need to be examined to demonstrate that the VP8 family gene usage is found more often than predicted by chance in the former and absent in the latter and associated with disease.

320 Charles E. Egwuagu et al.

Because the Vf38cDNA probe hybridizes to all three members of the VP8 family, it was of interest to determine whether our T-cell lines express the Vp8.2 subfamily gene, as is the case in EAE [6-8]. In the mouse, the region between amino acids 39 and 62 of the VP8 genes shows the highest sequence variability between members of the VP8 family [ 141. Consequently, we synthesized a 63-mer oligonucleotide primer complementary to amino acids 39-59 of rat Vfl8.2 gene [7, 93, for use as a Vp8.2specific probe. Northern analysis using this probe is shown in Figure 2b. A positive hybridization signal is seen only in the lane corresponding to the MBP T-cell line, indicating that the pathogenic T cells which induce EAU do not express appreciable levels of the Vp8.2 gene. This result suggests that other members of the VP8 family are predominantly utilized by uveitogenic T-cell lines. Polymerase chain reaction (PCR)

amplification of V/38 cDNAs

To examine the possibility that our inability to detect V/38.2 transcripts was caused by the low sensitivity of the Northern method, we reverse-transcribed RNAs isolated from the various T cells described in Materials and methods and subjected the resultant cDNAs to 30 cycles of PCR amplification. The S’primer used for the PCR (AGAACACATGGAAGCTGCAGTCACAC) codes for the rat Vp8.2 TCR nucleotides 143-l 68 or amino acids 1 through 8 [9]. It is likely that this V/38.2-derived primer will amplify all members of the rat VP8 family, since the equivalent sequence in the mouse is conserved among murine VP8 family members. The 3’primer (GTCGTCGACTGCGATCTCTGCTTCTGAT) is specific to and complementary to the rat TCR constant region (nucleotides 326-346 [7]). These primers amplified a single 407 bp fragment in uveitogenic T-cell lines but not in non-pathogenic T cell clones. Southern analysis of the amplification products (Figure 3) shows that the 407 bp fragment hybridizes to the VP8 specific probe. This result provides further evidence that a VP8 gene is expressed in uveitogenic T cells but not in nonuveitogenic T-cell lines. Discussion

The major structure that discriminates between T cells of various specificities is the TCR for antigen [ 14, 161. TCR a and 8 chains are disulphide-linked heterodimeric glycoproteins that recognize antigen held in the cleft of a major histocompatibility complex molecule (class I MHC in the case of CD8 and class II in CD4 bearing T lymphocytes). Clonal deletion, selection of mutants, cell fusion and transfer experiments have implicated the p chain more often in MHC recognition than the a chain [16-191. As a result, most research efforts have focused on the 8 chain. The repertoire of the mouse TCR 8 chain consists of more than 50 germline V genes, each of which can randomly recombine with one of the two diversity, 13 junctional and two constant region elements to give rise to the functional V-D-J-C receptor [ 141. Despite this potential broad diversity, studies have shown that T cell responses to some autoantigens can be skewed towards the predominant selection of T cells of specific V-region genes. In EAE [6, 81, type II collagen-induced arthritis [20], sarcoidosis [21] and multiple sclerosis [22] a bias towards the use of VP8 gene elements has been reported. Several laboratories have also reported successful treatment of

T cell receptors in EAU

32 1

c4

c3

THS4

LIVER

LRl6

THS6

R4

MW

Figure 3. Autoradiograph of Southern blot analysis of PCR-amplified fragments from T cell clones C4, C3 (lanes 1 and 2 respectively); T-cell lines ThS4, LR16, ThS8 and R4 (lanes 3,5,6,7 respectively). Lane 4 is control liver DNA and lane 8 is molecular weight standard (1 DNA/Hind111 fragments). After 30 cycles of amplification, 15-microliter aliquots from each sample were fractionated on a 1.5% agarose gel, blotted onto Hybond (N+) nylon membrane and hybridized with the VP8 cDNA probe (see Materials and methods).

autoimmune diseases in animal models such as EAE, using monoclonal antibodies directed against TCRs involved in the recognition of autoantigens [23-251. We have investigated the presence of VpS+ TCRs from T lymphocytes that respond to uveitogenic determinants of IRBP and S-Antigen. Two approaches were used in our analyses. First, we performed genomic Southern analyses on DNAs from uveitogenic T cell lines to determine whether there was a bias towards the use of V/38 genes. Our results do not demonstrate predominant VP8 gene rearrangement even in our most pathogenic T-cell lines (Figure 1). A second approach was to examine RNA from two highly pathogenic T-cell lines, two non-pathogenic clones and from one non-pathogenic T-cell line, by Northern analysis. Our goal was to detect whether there was VP8 gene expression and to determine if the level of VP8 gene expression could be correlated with the relative abilities of the various T-cell lines and clones to induce EAU. It is clear from the results presented (Figure 2b) that T-cell clones that express VP8 elements are enriched in our pathogenic T-cell populations but not in the non-pathogenic populations. Although the limited number of cell lines and clones examined does not permit us to make a statistically relevant correlation, these data suggest that usage of VP8 gene elements may be associated with EAU, as has been shown for other autoimmune disease models [ 161. We are currently generating more pathogenic and nonpathogenic T-cell lines and clones for further analyses to allow us to ascertain

322

Charles E. Egwuagu et al.

whether the linkage between VP8 usage and pathogenicity of T cells observed in this study is statistically significant. Our results also show that, unlike EAE in the rat and possibly other autoimmune diseases where the majority of the pathogenic T cells seem to rearrange and express VP8 gene elements [16], only very small proportions of the cells in the T-cell lines that induce EAU use VP8 gene elements. Our Northern data indicate that the level of VP8 TCR gene expression in uveitogenic T-cell lines is very low relative to the encephalitogenic T-cell line which was tested in parallel (Figure 2). If indeed VP8 expressing T cells are important in the induction of EAU, the apparently low numbers of these T cells suggest that they mediate the disease in concert with the other T cells that dominate our various uveitogenic T cell lines. Whereas in EAE the encephalitogenic T cells preferentially express the V88.2 gene element, in our case, analysis of V/38 expression using a Vp8.2 specific probe suggests that the Vp8.2 gene element is not the predominant member of the V88 family used in EAU. None of the uveitogenic T-cell lines examined expressed sufficient amounts of the V88.2 gene transcripts to be detectable by Northern analysis (Figure 2b). VP8.2-like cDNAs in lines LR16, ThS8 and R4 have been amplified by PCR, cloned and sequenced (manuscript in preparation). The VP8.2-like TCR from the LR16 line shares N 90% DNA sequence identity with the rat V/38.2 TCR. This may have accounted for our inability to detect Vp8.2 transcripts in the pathogenic T-cell lines examined, since nucleotide substitutions occur within the region complementary to the rat VP8.2-specific oligonucleotide probe used in our analysis (Figure 2b). The VP8 TCR from lines R4 and ThS8 share 99.!l”i, sequence identity with rat TCR Vfi8.2, indicating that V88.2 sequences are expressed in uveitogenic T cells. We hope that lymphocytes or antibodies directed against selected epitopes of the VP8 TCRs used by uveitogenic T cells will provide a rational basis for idiotype regulation of autoreactive T cells and possible therapy for ocular autoimmune diseases. Acknowledgement We wish to thank Dr Francois

Roberge

for a critical

reading

of the manuscript.

References 1. Wacker, W. B., L. A. Donoso, C. M. Kaslow, J. A. Yankeelov, Jr, and D. T. Organisciak.

1977. Experimental allergic uveitis. Isolation, characterization and localization of a soluble uveitopathogenic antigen from bovine retina. J. Zmmunol. 119: 1949-1958 2. Gery, I., B. Wiggert, T. M. Redmond, T. Kuwabara, M. A. Crawford, B. P. Vistica, and G. J. Chader. 1986. Uveoretinitis and pinealitis induced by immunization with interphotoreceptor retinoid-binding protein. Investigative Ophthalmology & Visual Science 27: 1296-1300 and R. B. Nussenblatt. 1986. Retinal specific antigens and 3. Gery, I., M. Mochizuki, immunopathogenic processes they provoke. In Progress in Retinal Research. N. Osborne and J. Chader, eds, 5: 75-109 M. El-Saied, T. Kuwabara, I. Gery, E. 4. Caspi, R. R., F. G. Roberge, C. G. McAllister, Harma, and R. B. Nussenblatt. 1986. T cell lines mediating experimental autoimmune uveoretinitis (EAU) in rat.3. Zmmunol. 136: 928-933 H. Sanui, T. Kuwabara, C. G. McAllister, B. Wiggert, G. J. 5. Hu, L., T. M. Redmond, Chader, and I. Gery. 1989. Rat T cell lines specific to a nonimmunodominant determinant

T cell receptors

6.

7.

8.

9.

10.

11.

12.

13. 14. 15. 16. 17.

18

19.

20.

21.

22.

in EAU

323

of a retinal protein (IRBP) produce uveoretinitis and pinealitis. Cell. Immunol. 122: 251-261 Zamvil, S. S., D. J. Mitchell, N. E. Lee, A. C. Moore, M. K. Waldor, K. Sakai, J. B. Rothbard, H. 0. McDevitt, L. Steinman, and H. Acha-Orbea. 1988. Predominant expression of a T cell receptor VP gene subfamily in experimental autoimmune encepha1omyelitis.J. Exp. Med. 167: 1586-1596 Burns, F. R., X. Li, N. Shen, H. Offner, Y. K. Chou, A. A. Vandenbark, E. Heber-Katz. 1989. Both rat and mouse T cell receptors specific for the encephalitogenic determinant of myelin basic protein use similar Va and V p chain genes even though the major histocompatibility complex and encephalitogenic determinants being recognized are different. J. Exp. Med. 169: 27-39 Acha-Orbea, H., D. J. Mitchell, L. Timmermann, D. C. Wraith, G. S. Trausch, M. K. Waldor, S. S. Zamvil, H. 0. McDevitt, and L. Steinman. 1988. Limited heterogeneity of T cell receptors from lymphocytes mediating autoimmune encephalomyelitis allows specific immune intervention. Cell 54: 263-273 Chluba, J., C. Steeg, A. Becker, H. Wekerle, and J. T. Epplen. 1989. T cell receptor p-chain usage in myelin basic protein-specific rat T-lymphocytes. Eur. 3. Immunol. 19: 279-284 Vandenbark, A. A., G. Hashim, and H. Offner. 1989. Immunization with a synthetic T cell receptor V-region peptide protects against experimental autoimmune encephalomyelitis. Nature 341: 541-544 Howell, M. D., S. T. Winters, T. Olee, H. C. Powell, D. J. Carlo, and S. W. Brostoff. 1989. Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides. Science 246: 668-670 Sanui, H., T. M. Redmond, S. Kotake, B. Wiggert, L. Hu, H. Margalit, J. A. Berzofsky, G. J. Chader, and I. Gery. 1989. Identification of an immunodominant and highly immunopathogenic determinant in the retinal interphotoreceptor retinoid-binding protein (IRBP). 3. Exp. Med. 169: 1947-1960 Hedrick, S. M., D. I. Cohen, E. A. Nielsen, and M. M. Davis. 1984. Isolation of cDNA clones encoding T cell specific membrane associated proteins. Nature 308: 145-148 Kronenberg, M., G. Sui, and L. E. Hood. 1986. The molecular genetics of the T cell antigen receptor and T cell antigen recognition. Ann. Rev. Immunol. 4: 529-59 1 Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989. Molecular cloning: a laborarory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Acha-Orbea, H., L. Steinman, and H. 0. McDevitt. 1989. T cell receptors in murine autoimmune diseases. Arm. Rev. Zmmunol. 7: 371-405 Caforio, A. L. I?., J. T. Stewart, E. Bonifacio, M. Burke, M. J. Davies, W. J. McKenna, and G. F. Bottazzo. 1990. Inappropriate major histocompatibility complex expression on cardiac tissue in dilated cardiomyopathy. Relevance for autoimmunity. 3. Autoimmunity 3: 187-200 Kappler, J. W., T. Wade, J. White, E. Kushnir, M. Blackman, J. Bill, N. Roehm, and P. Marrack. 1987. A T cell receptor VP segment that imparts reactivity to a class II MHC product. Cell 49: 263-27 1. Saito, T. and R. N. Germain. 1987. Predictable acquisition of a new MHC recognition specificity following expression of a transfected T cell receptor P-chain gene. Nature 329: 256-259 Haqqi, T. M. and C. S. David. 1990. T cell receptor VP genes repertoire in mice possible role in resistance and susceptibility to type II collagen-induced arthritis.3. Autoimmunity 3: 113-121 Moller, D. R., K. Konishi, M. Kirby, B. Balbi, and R. G. Crystal. 1988. Bias toward use of a specific T cell receptor P-chain variable region in a subgroup of individuals with sarcoidosis.3. C/in. Invest. 82: 1183-1191 Wucherpfennig, K. W., K. Ota, N. Endo, J. G. Seidman, A. Rosenzweig, H. L. Weiner, and D. A. Hafler. 1990. Shared human T cell receptor VP usage to immunodominant regions of myelin basic protein. Science 248: 1016-1019

324 Charles E. Egwuagu et al. 23. Hashim, G. A., A. A. Vandenbark, A. B. Galang, T. Diamonduros, E. Carvalho, J. Srinivasan, R. Jones, M. Vainiene, W. J. Morrison, and H. Offner. 1990. Antibodies specific for VJ38 receptor peptide suppress experimental autoimmune encephalomyelitis. J. Immunol. 144: 4621-4627 24. Owhashi, M. and E. Heber-Katz. 1988. Protection from experimental allergic encephalomyelitis confered by a monoclonal antibody directed against a shared idiotype on rat T cell receptors specific for myelin basic protein. J. Exp. Med. 168:2153-2164 25. Zaller, D. M., G. Osman, 0. Kanagawa, and L. Hood. 1990. Prevention and treatment of murine experimental allergic encephalomyelitis with a T cell receptor VS-specific antib0dies.J. Exp. Med. 171: 19421955