Vol. 28, No. 12
JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 1990, p. 2739-2743 0095-1137/90/122739-05$02.00/0 Copyright C 1990, American Society for Microbiology
Rapid Detection of Human Papillomavirus in Cervical Scrapes by Combined General Primer-Mediated and Type-Specific Polymerase Chain Reaction BRULE,1* CHRIS J. L. M. MEIJER,' VICTOR BAKELS,' PETER KENEMANS,2 AND JAN M. M. WALBOOMERS' of Molecular Pathology,' and Department of Gynecology,2 Section Pathology, of Department Free University Hospital, De Boelelaan 1117, 1081 HV Amsterdam, The Netherlands
ADRIAAN J. C.
VAN DEN
Received 30 April 1990/Accepted 14 September 1990
A two-step polymerase chain reaction (PCR) procedure was used as a new screening strategy for the detection of human papillomavirus (HPV) genotypes in cervical scrapes omitting prior DNA extraction. Sample preparation consisted of a freeze-thaw step followed by boiling the cells before the PCR mixture was added. This pretreatment was as efficient and reproducible for HPV DNA amplification as DNA purification. By using crude cell suspensions, a prescreening of the samples with the general primer-mediated PCR method (GP-PCR) was performed to detect a broad spectrum of sequenced and still unsequenced HPV types at the subpicogram level. HPV-containing scrapes by GP-PCR were subjected to HPV 6, 11, 16, 18, 31, and 33 type-specific PCR (TS-PCR) to identify the sequenced HPV types. This direct GP/TS-PCR method was tested on a large group of cervical scrapes (n = 459) from women visiting a gynecologic outpatient clinic. The results were compared with HPV data obtained by a method using modified filter in situ hybridization and TS-PCR in which the PCR was mainly used to confirm HPV positivity. A substantially higher HPV prevalence rate was found by direct GP/TS-PCR strategy. The results indicate that GP/TS-PCR is a rapid, sensitive, and reliable detection method for HPV in cervical scrapes. The easy performance on crude cell suspensions makes this strategy applicable for large HPV-screening programs.
logic outpatient clinic and compared with the presently used modified FISH/TS-PCR approach to test its value in practice.
Recent advances in tumor virology have shown a strong association between infection with certain human papillomavirus (HPV) types and dysplastic and neoplastic lesions of the cervix uteri (3, 17, 21). Different DNA hybridization techniques have been used for the detection of specific HPV types in cervical scrapes. For this latter purpose, the modified filter in situ hybridization (FISH) has previously been shown to be valuable as a screening method for the detection of HPV 6, 11, 16, 18, 31, and 33 (11, 18). However, the introduction of the polymerase chain reaction (PCR) has caused important developments in both virological research and diagnostics. The PCR is more sensitive in HPV detection in cervical scrapes compared with other known detection methods (12). Nevertheless, the laborious DNA extraction of samples is necessary, making the PCR not suitable for mass screening programs. As a consequence, for screening purposes in our laboratory, the PCR has previously been used only to confirm HPV positivity in FISH-positive and doubtful scrapes and scrapes with cytomorphological abnormalities (16). Using this FISH/PCR procedure not all scrapes have been tested by the sensitive PCR and only sequenced HPV genotypes have been studied. In this study, the PCR was made applicable to all cervical scrapes to determine HPV positivity in a simple test by direct amplification of HPV sequences in crude cervical cell suspensions, omitting the laborious DNA isolation step. General primer-mediated PCR (GP-PCR; 15, 17) in combination with type-specific PCR (TS-PCR) were used for detection and typing of sequenced and still unsequenced HPV types. This new PCR strategy has been applied to cervical scrapes derived from women attending a gyneco-
*
MATERIALS AND METHODS Study group and sample preparation. Cervical scrapes were derived from 459 women attending the Outpatient department of Gynecology, Free University Hospital, Amsterdam, The Netherlands, for a wide spectrum of gynecological complaints. The first smear was made for routine cytological examination. For HPV detection, the remaining material from the first spatula (Cervex brush; International Medical Products, Zutphen, The Netherlands) and an additional scrape were put in 5 ml of phosphate-buffered saline with 0.05% Merthiolate. The scrapes were vigorously vortexed, and the suspension was centrifuged for 10 min at 3,000 x g. The cells were resuspended in 1.0 ml of phosphate-buffered saline, of which 0.5 ml was used for DNA extraction (9). The DNA was finally suspended in 60 ,ul of 10 mM Tris hydrochloride-1 mM EDTA. Of the remaining cell suspension, 0.4 ml was used for the modified FISH, whereas 0.1 ml was reserved for direct PCR. HPV detection by direct PCR. To optimize the use of PCR directly on crude cell suspensions for HPV detection, several pretreatment methods were attempted. Briefly, cells were subjected to proteinase K incubation (8, 10), alkaline denaturation followed by neutralization (5, 11), or common protein fixation methods such as buffered Formalin (14), paraformaldehyde, ethanol, and acetone (13). The optimal protocol used cell suspensions that had been pelleted and resuspended in phosphate-buffered saline and then frozen at -40°C. After thawing, the cells were vortexed vigorously. Subsequently, 10 ,ul of the homogeneous cell suspension was
Corresponding author. 2739
2740
VAN DEN BRULE ET AL.
J. CLIN. MICROBIOL.
TABLE 1. Sequences of general primers, type-specific primers, and probes Primer or probe
Sequence
General primers GP .................. GP 6 ...................
+ 5' TTTGTTACTGTGGTAGATAC 3' -
Type-specific primers' 6.1 ................... + 6.2 ................... 11.1 ................... + 11.2 ................... 16.1 ................... + 16.2 ................... 18.1 ................... + 18.2 ................... 31.1 ................... + 31.2 ................... 33.1 ....................+ 33.2 ................... -
Type-specific oligonucleotide probes' HPV 6 ................. HPV HPV HPV HPV HPV
+ 11 ................. + 16 ..................+ 18 ................. + 31 .................+ 33 .................+
a Data from
reference 15. b Data from reference 16. HPV 31-specific primers direct for the amplification of 514-base pairs nucleotides 3371 to 3400. taken with a disposable pipette (Microman, Gilson, France), denatured at 100°C for 10 min, cooled on ice, and centrifuged for 1 min at 3,000 x g. Different primers were used in the PCR for HPV detection. The general primers GP 5 and 6 (15), which were highly homologous to the Li region of a broad spectrum of HPV genotypes, were used in the GP-PCR. In the TS-PCR, a mixture of HPV 6-, 11-, 16-, 18-, 31, and 33-specific cloning site-flanking primers (16) were used. Primer sequences are shown in Table 1, and oligonucleotides were synthesized on a Pharmacia LKB Gene Assembler Plus. The GP-PCR was performed in 50 ,ul of PCR solution containing 50 mM KCl, 3.5 mM MgCl2, 0.01% gelatin, 200 ,uM each deoxynucleoside triphosphate, 25 pmol of each general primer, 1 U of thermostable DNA polymerase (Amplitaq; Cetus), and 10 ,ul of denaturated cell suspension. The mixture was overlaid with several drops of paraffin oil to prevent evaporation and was incubated for 5 min at 95°C for DNA denaturation. Forty cycles of amplification were performed by using a PCR processor (Biomed, Theres, Federal Republic of Germany). Each cycle consisted of a denaturation step at 95°C for 1 min, followed by a primer annealing step at 40°C for 2 min and a chain elongation step at 72°C for 1.5 min. Finally, 10 ,ul of the amplification product was analyzed by 1.5% agarose gel electrophoresis. The TS-PCR was performed as described for the GP-PCR, except that 1.5 mM MgCl2, 25 pmol of each cloning siteflanking primer, and an annealing temperature of 55°C were used. Southern blot analysis of PCR products. For the analysis of the amplification products of GP-PCR, the DNA was transferred from the gel to a nylon membrane (Biotrace, Gelman Sciences) by diffusion blotting in 0.5 N NaOH-1.5 M NaCl overnight. Thereafter the membrane was saturated with 2x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and incubated for 2 h at 55°C in a prehybridization solution
5' GAAAAATAAACTGTAAATCA 3' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5'
TAGTGGGCCTATGGCTCGTC TCCATTAGCCTCCACGGGTG GGAATACATGCGCCATGTGG CGAGCAGACGTCCGTCCTCG TGCTAGTGCTTATGCAGCAA ATTTACTGCAACATTGGTAC AAGGATGCTGCACCGGCTGA CACGCACACGCTTGGCAGGT
3' 3' 3' 3' 3' 3' 3' 3' ATGGTGATGTACACAACACC 3' GTAGTTGCAGGACAACTGAC 3'
5'ATGATAGATGATGTAACGCC3' 5' GCACACTCCATGCGTATCAG 3'
5'CATTAACGCAGGGGCGCCTGAAATTGTGCC3' 5'CGCCTCCACCAAATGGTACACTGGAGGATA3' 5'GCAAACCACCTATAGGGGAACACTGGGGCA3' 5'TGGTTCAGGCTGGATTGCGTCGCAAGCCCA3' 5'ACCTGCGCCTTGGGCACCAGTGAAGGTGTG3' 5'CAAATGCAGGCACAGACTCTAGATGGCCAT3'
(nucleotides 3057 to 3570); the HPV 31 probe is localized at
(0.5 M sodium phosphate [pH 7.4], 7% sodium dodecyl sulfate, 1 mM EDTA). Hybridization under low-stringency conditions (T,,, - 33°C) with [ot-32P]dCTP random primerlabeled probe mixture was performed at 55°C for 16 h. The probe consisted of a mixture of the GP-PCR products of cloned HPV 6, 11, 16, 18, 31, and 33, which were electrophoretically separated in low-melting-point agarose (BioRad Laboratories) excised from the gel and labeled directly by the random primer method (Pharmacia, Uppsala, Sweden). After hybridization, washes were performed at low stringency (Tm - 33°C) by using 3 x SSC-0.5% sodium dodecyl sulfate at 55°C. Autoradiography was performed overnight at -80°C with Kodak Royal X-Omat film and intensifying screens. For the analysis of the HPV TS-PCR products, hybridization was performed with HPV 6, 16, and 33 and HPV 11-, 18-, and 31-specific [r-32P]end-labeled internal oligonucleotides (Table 1) as described above. Washes were performed by using 3x SSC-0.5% sodium dodecyl sulfate at 55°C. HPV detection by FISH/TS-PCR. The modified FISH procedure was performed as previously described (11). Briefly, cell suspensions were lysed and DNA was denatured directly in 0.4 N NaOH at 65°C for 10 min. After neutralization with 10 N ammonium acetate (pH 5.6) at 4°C, the specimens were spotted in duplicate on two different nylon membranes (Biotrace, Gelman Sciences) by using a Cito-spot apparatus (Spikker BV, Zevenaar, The Netherlands). Hybridization of the first membrane was performed under high-stringency conditions with an HPV 6- and 11-specific [oL-32P]dCTP random primer-labeled probe, autoradiographed, and subsequently hybridized with an HPV 18-specific probe. The second membrane was subsequently hybridized with an HPV 16- and HPV 31- and 33-specific probe. Autoradiography was performed for 3 days at -80°C with intensifying screens.
All scrapes with abnormal cytology and a selected group
RAPID DETECTION OF HPV IN CERVICAL SCRAPES BY PCR
VOL. 28, 1990 direct GP-PCR:
2741
direct TS-PCR:
*
c
2 11 13 16 17 19 20 22 23 25 34 38 3940 M
(bp) 1632 396 220 154
D
280 152
E 514
B
218
a
-140
l"
a
b
l i I i I I I I I 1I 31 X - 16 - X X 1616 X 6 18 - 16
HPV
-140
FIG. 1. Detection of HPV genotypes in cervical scrapes by direct PCR. (A) Crude cell suspensions of scrapes 1 to 40 were tested by GP-PCR. In addition, a positive control (Si; 103 SiHa cells which contain 1 to 10 copies of HPV 16 per genome) and a negative control (BI; distilled water) were analyzed. GP-PCR products are shown after electrophoresis on a 1.5% agarose gel and staining with ethidium bromide. (B) Southern blot analysis of GP-PCR products under weakly stringent hybridization conditions with labeled GP-PCR products derived from cloned sequenced HPV types 6, 11, 16, 18, 31, and 33. Washes were also performed under conditions of low stringency. (C) GP-PCR-positive and doubtful scrapes were subjected to TS-PCR using a mixture of HPV 6-, 11-, 16-, 18-, 31-, and 33-specific primers. TS-PCR products are shown after electrophoresis on a 1.5% agaîose gel and staining with ethidium bromide. (D) Southern blot analysis of TS-PCR products with labeled HPV type 6-, 16-, and 33-specific oligonucleotides. (E) Southern blot analysis with labeled HPV type 11-, 18-, and 31-specific oligonucleotides. M, pBR322 DNA digested with HinfI.
of FISH-positive or doubtful scrapes with normal cytology subjected to TS-PCR. After extraction of DNA from the remaining cells, TS-PCR was performed as described above by using 1 ,ul of DNA. were
RESULTS AND DISCUSSION Much evidence has been collected that support a role of HPV in the development of cervical cancer (1, 19). Detection of HPV in cervical scrapes may therefore be the preferred method to identify cervical cells having oncogenic potential. To make PCR suitable for large HPV-screening programs, it is necessary to apply PCR directly on cervical scrapes, omitting the laborious DNA purification step. Therefore, different pretreatments of the cells were investigated and tested on cervical cells previously found to contain HPV 16, 18, and 33 by PCR performed on extracted DNA. Previous studies already reported the performance of PCR directly on single cells (8) and cell suspensions (6, 10). These and other methods used (see Materials and Methods) were not reproducible in our hands. However, a pretreatment that con-
sisted of a freeze-thaw step followed by boiling the cells before the PCR mixture was added consistently resulted in successful amplification of HPV target sequences. The efficiency of amplification was similar to PCR performed on purified DNA. Reduced PCR efficiency was not noted by using direct PCR when cervical scrapes containing blood were analyzed, probably because the serum components were lost during an initial pelleting of the cells. Although the direct PCR was performed in the presence of cellular components, a detection level of about 10 to 100 copies of HPV in a given sample was found as determined with a serial dilution of SiHa cells (1 to 10 copies of HPV per genome) in 105 human fibroblast cells (data not shown). The observed sensitivity was similar to previous findings (15, 16). Direct PCR was applied to all cervical scrapes as a screening method by using general primers known to permit the detection of sequenced and still unsequenced HPV types, followed by nonstringent hybridization (Fig. 1A and B). With this single assay, a simple selection can be achieved between HPV-positive and HPV-negative cervical scrapes.
2742
J. CLIN. MICROBIOL.
VAN DEN BRU LE ET AL.
TABLE 2. Comparison of FISH/PCR and direct PCR strategies for the detection of HPV in cervical scrapes Direct GP/TS-PCR
FISH/TS-PCR Cytology
n
No. HPV
No. ( HPV
nega- positive tive
411 394 Normal (Pap t, 11) 37 17 Mild dysplasia (Pap Illa) 2 7 Severe dysplasia (Pap lIlb) 1 4 CIS (Pap IV)
No. of HPV-positive scrapes
Double
19/38b 19 (51) 5 (71) 3 (75)
16/33 6/16
6
11
1 1
16
18
17 10 3 2
2 1
31
1 5
1
33
No. (%) HPV positive
No. of HPV-positive scrapes
Double
6
il 16 18 31 33
58 (14) 6/16/31, 16/31 1 1 30C (81) 16/33 (2x) 6 (86) 6/16 4 (100)
23 1 11 2 3 1 2
3 5 1
X" 28 9 1 1
'HPV X, Yet unsequenced HPV types, determined by low-stringent hybridization, which revealed strong hybridization signals. "PCR only performed on FISH-positive and doubtful scrapes. 'Two scrapes scored positive by direct PCR and not by PCR performed on purified DNA, namely, one HPV 16-positive and one HPV 16/33-positive scrape.
Different general or consensus primers localized in the El region (4, 17) and the Li region (10, 15) have been described. The L1-specific primer set GP 5 and 6 was preferred in this study because of its superior matching with the sequenced genital HPV types and the short length of the amplified segment, which might be advantageous in less efficient amplification conditions such as crude cell suspensions. Scrapes, strongly positive (Fig. 1B, lanes 2, 11, 16, 19, 20, 22, 23, 25, 34, and 40) and weakly positive (Fig. lB, lanes 13, 17, 38, and 39) by GP-PCR, were subjected to TS-PCR for the identification of sequenced HPV types (Fig. 1C). In this gynecological outpatient population, up to 20% of the scrapes were positive by GP-PCR and had to be tested by TS-PCR. Additional hybridization with type-specific internal oligonucleotide probes confirmed the HPV typing based on fragment size (16), as shown for HPV types 6, 16, 18, and 31 (Fig. 1D and E). Scrapes that were positive by GP-PCR but negative by TS-PCR were suspected to contain unsequenced HPV genotypes (HPV X in Fig. 1, lanes 11, 19, 20, and 25; Table 2). In this study, only HPV X giving hybridization signals equal or stronger than about 100 SiHa cells in GP-PCR was taken into account. False-positivity in detection of these HPV X genotypes due to contamination or cellular cross-hybridization is excluded by dot blot hybridization of the PCR products with cloned unsequenced HPV types and the loss of hybridization signals after additional washes under high-stringency conditions as previously demonstrated (17). Preliminary sequence analyses of several HPV X-assigned PCR products revealed strong homology with known HPV types and were not found in a data bank of known eucaryotic sequences (GenBank, release 61, Beckman). In addition, sequenced HPV X clones were used as probes in Southern blot experiments, which showed that these types were partially present among the other HPV X-containing scrapes, thereby arguing against false-positivity. However, samples with weaker signals than 100 SiHa cells after GP-PCR analysis (Fig. 1B, lanes 13, 17, and 39) and negative TS-PCR are considered HPV negative at this moment. Whether these signals originate from cellular crosshybridization or distantly related HPV genotypes is under investigation.
To study the
use
of the direct PCR
strategy for HPV in cervical scrapes,
as a new screening a comparison was
made with HPV detection by FISH/TS-PCR. The HPV prevalence rates found by both approaches in cervical scrapes of a gynecological outpatient population are summarized in Table 2. The increased HPV prevalence rates determined by the direct PCR in both scrapes with normal and abnormal cytology emphasize the strength of this new strategy. This increase can be explained since all scrapes with normal cytology were now screened by the sensitive
PCR and yet unsequenced HPV genotypes were detected as well. Furthermore, the same HPV genotypes were found in a given sample by the different methods used. In addition, some scrapes were HPV positive by direct TS-PCR and not after TS-PCR performed on purified DNA (Table 2), possibly due to trapping of DNA in the phenol interface during DNA extraction. The results presented herein show that the direct GP/TS-PCR strategy is superior to the FISH/PCR procedure. More women can be easily monitored in a single test for the presence or absence of a broad spectrum of HPV genotypes. The direct PCR is also fast; 120 samples can be processed for PCR within 2 h. In this way, one technician can routinely screen 500 samples of a patient population per week for HPV using the whole procedure. Rapidity is not restricted by sample pretreatment and can be enhanced by shortening of hybridization and autoradiography. Application of nonradioactive detection of PCR products and automation will further increase the use of direct PCR in routine HPV screening of cervical scrapes. Besides reduced falsenegativity in comparison with FISH/PCR, the direct PCR strategy is less sensitive to false-positive results due to contamination (2, 17), since DNA has not to be extracted. In conclusion, the described PCR procedure using crude cell suspensions is a simple, rapid, sensitive, and specific detection method, which is suitable for large HPV-screening programs, necessary to evaluate epidemiological aspects (20) as well as the clinical relevance of an HPV infection. The outcome of these studies may also be important for the eventual replacement of cytological screening (7) by HPV detection in population-based screening programs for cervical cancer. ACKNOWLEDGMENTS We thank E. Risse for cooperation in screening the cervical scrapes cytologically and P. Snijders for critically reading the
manuscript. This work was supported by grant 28-1502 from the Prevention Fund, The Netherlands. LITERATURE CITED 1. Campion, H. J., J. Cuzick, D. J. McCance, and A. Singer. 1986. Progressive potential of mild cervical atypia: prospective cytological, colposcopic and virological study. Lancet ii:237-240. 2. Clewly, J. P. 1989. The polymerase chain reaction, a review of the practical limitations for human immunodeficiency virus diagnosis. J. Virol. Methods 25:179-188. 3. Gissmann, L., and A. Schneider. 1986. The role of human papillomavirus in genital cancer, p. 15-25. In G. De Palo, F. Rilke, and H. zur Hausen (ed.), Herpes and papilloma viruses. New York Serzona Symposia Publications, Raven Press, New York. 4. Gregoire, L., M. Arella, J. Campione-Piccardo, and W. D.
VOL. 28, 1990
5.
6. 7.
8.
9. 10.
11.
12.
13.
RAPID DETECTION OF HPV IN CERVICAL SCRAPES BY PCR
Lancaster. 1989. Amplification of human papillomavirus DNA sequences by using conserved primers. J. Clin. Microbiol. 27:2660-2665. Jiwa, N. M., G. W. van Gemert, A. K. Raap, F. M. RUke, A. Mulder, P. F. Lens, M. M. M. Salimans, F. E. Zwaan, W. van Dorp, and M. van der Ploeg. 1989. Rapid detection of human cytomegalovirus DNA in peripheral blood leucocytes of viremic transplant recipients by the polymerase chain reaction. Transplantation 48:72-76. Kogan, S. C., M. Doherty, and J. Gitschier. 1987. An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences. N. Engl. J. Med. 317:985-990. Koss, L. G. 1989. The Papanicolaou test for cervical cancer detection: a triumph and a tragedy. J. Am. Med. Assoc. 261:737-743. Li, H., U. B. Gyllensten, X. Cui, R. K. Saiki, H. A. Erlich, and N. Arnheim. 1988. Amplification and analysis of DNA sequences in single human sperm and diploid cells. Nature (London) 335:414-417. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Manos, M. M., Y. Ting, D. K. Wright, A. J. Lewis, T. R. Broker, and S. M. Wolinsky. 1989. Use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells 7:209-214. Melchers, W. J. G., P. Herbrink, J. M. M. Walboomers, C. J. L. M. Meyer, H. van de Drift, and W. G. V. Quint. 1989. Optimization of human papillomavirus genotype detection in cervical scrapes by a modified filter in situ hybridization test. J. Clin. Microbiol. 27:106-110. Melchers, W., A. van den Brule, J. Walboomers, M. de Bruin, P. Herbrink, C. Meijer, J. Lindeman, and W. Quint. 1989. Increased detection rate of human papillomavirus in cervical scrapes by the polymerase chain reaction as compared to modified FISH and Southern blot analysis. J. Med. Virol. 27:329-335. Muliink, H., J. M. M. Walboomers, T. M. Tadema, D. J. Jansen, and C. J. L. M. MeiJer. 1989. Combined immuno- and non-
14. 15.
16.
17.
18.
19. 20. 21.
2743
radioactive hybridocytochemistry on cells and tissue sections: influence of fixation, enzyme pretreatment, and choice of chromogen on detection of antigen and DNA sequences. J. Histochem. Cytochem. 37:603-609. Shibata, D. K., N. Arnheim, and W. J. Martin. 1988. Detection of human papillomavirus in paraffin-embedded tissue using the polymerase chain reaction. J. Exp. Med. 167:225-230. Snijders, P. J. F., A. J. C. van den Brule, H. F. J. Schrinemakers, G. Snow, C. J. L. M. Meijer, and J. M. M. Walboomers. 1990. The use of general primers in the polymerase chain reaction permits the detection of a broad spectrum of human papillomavirus genotypes. J. Gen. Virol. 71:173-181. Van den Brule, A. J. C., H. C. J. Claas, M. du Maine, W. J. G. Melchers, T. Helmerhorst, W. G. V. Quint, J. Lindeman, C. J. L. M. Meijer, and J. M. M. Walboomers. 1989. Use of anti-contamination primers in the polymerase chain reaction for the detection of human papillomavirus genotypes in cervical scrapes and biopsies. J. Med. Virol. 29:20-27. Van den Brule, A. J. C., P. J. F. Sniyders, R. L. J. Gordijn, O. P. Bleker, C. J. L. M. Mejer, and J. M. M. Walboomers. 1990. General primer mediated polymerase chain reaction permits the detection of both sequenced and still unsequenced human papillomavirus genotypes in cervical scrapes and carcinomas. Int. J. Cancer 45:644-649. Wagner, D., H. Ikenberg, N. Boehm, and L. Gissmann. 1984. Identification of human papillomavirus in cervical swabs by deoxyribonucleic acid in situ hybridization. Obstet. Gynecol. 64:767-772. Zur Hausen, H. 1989. Papillomaviruses in anogenital cancer as a model to understand the role of viruses in human cancers. Cancer Res. 49:4677-4681. Zur Hausen, H. 1989. Papillomavirus in anogenital cancer: the dilemma of epidemiologic approaches. J. Natl. Cancer Inst. 81:1680-1682. Zur Hausen, H., and A. Schneider. 1987. The role of papillomaviruses in human anogenital cancer, p. 245-263. In N. P. Salzman and P. M. Howley (ed.), The papovaviridae-the papillomavirus. Plenum Publishing Corp., New York.
JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 1990, p. 2739-2743 0095-1137/90/122739-05$02.00/0 Copyright C 1990, American Society for Microbiology
Rapid Detection of Human Papillomavirus in Cervical Scrapes by Combined General Primer-Mediated and Type-Specific Polymerase Chain Reaction BRULE,1* CHRIS J. L. M. MEIJER,' VICTOR BAKELS,' PETER KENEMANS,2 AND JAN M. M. WALBOOMERS' of Molecular Pathology,' and Department of Gynecology,2 Section Pathology, of Department Free University Hospital, De Boelelaan 1117, 1081 HV Amsterdam, The Netherlands
ADRIAAN J. C.
VAN DEN
Received 30 April 1990/Accepted 14 September 1990
A two-step polymerase chain reaction (PCR) procedure was used as a new screening strategy for the detection of human papillomavirus (HPV) genotypes in cervical scrapes omitting prior DNA extraction. Sample preparation consisted of a freeze-thaw step followed by boiling the cells before the PCR mixture was added. This pretreatment was as efficient and reproducible for HPV DNA amplification as DNA purification. By using crude cell suspensions, a prescreening of the samples with the general primer-mediated PCR method (GP-PCR) was performed to detect a broad spectrum of sequenced and still unsequenced HPV types at the subpicogram level. HPV-containing scrapes by GP-PCR were subjected to HPV 6, 11, 16, 18, 31, and 33 type-specific PCR (TS-PCR) to identify the sequenced HPV types. This direct GP/TS-PCR method was tested on a large group of cervical scrapes (n = 459) from women visiting a gynecologic outpatient clinic. The results were compared with HPV data obtained by a method using modified filter in situ hybridization and TS-PCR in which the PCR was mainly used to confirm HPV positivity. A substantially higher HPV prevalence rate was found by direct GP/TS-PCR strategy. The results indicate that GP/TS-PCR is a rapid, sensitive, and reliable detection method for HPV in cervical scrapes. The easy performance on crude cell suspensions makes this strategy applicable for large HPV-screening programs.
logic outpatient clinic and compared with the presently used modified FISH/TS-PCR approach to test its value in practice.
Recent advances in tumor virology have shown a strong association between infection with certain human papillomavirus (HPV) types and dysplastic and neoplastic lesions of the cervix uteri (3, 17, 21). Different DNA hybridization techniques have been used for the detection of specific HPV types in cervical scrapes. For this latter purpose, the modified filter in situ hybridization (FISH) has previously been shown to be valuable as a screening method for the detection of HPV 6, 11, 16, 18, 31, and 33 (11, 18). However, the introduction of the polymerase chain reaction (PCR) has caused important developments in both virological research and diagnostics. The PCR is more sensitive in HPV detection in cervical scrapes compared with other known detection methods (12). Nevertheless, the laborious DNA extraction of samples is necessary, making the PCR not suitable for mass screening programs. As a consequence, for screening purposes in our laboratory, the PCR has previously been used only to confirm HPV positivity in FISH-positive and doubtful scrapes and scrapes with cytomorphological abnormalities (16). Using this FISH/PCR procedure not all scrapes have been tested by the sensitive PCR and only sequenced HPV genotypes have been studied. In this study, the PCR was made applicable to all cervical scrapes to determine HPV positivity in a simple test by direct amplification of HPV sequences in crude cervical cell suspensions, omitting the laborious DNA isolation step. General primer-mediated PCR (GP-PCR; 15, 17) in combination with type-specific PCR (TS-PCR) were used for detection and typing of sequenced and still unsequenced HPV types. This new PCR strategy has been applied to cervical scrapes derived from women attending a gyneco-
*
MATERIALS AND METHODS Study group and sample preparation. Cervical scrapes were derived from 459 women attending the Outpatient department of Gynecology, Free University Hospital, Amsterdam, The Netherlands, for a wide spectrum of gynecological complaints. The first smear was made for routine cytological examination. For HPV detection, the remaining material from the first spatula (Cervex brush; International Medical Products, Zutphen, The Netherlands) and an additional scrape were put in 5 ml of phosphate-buffered saline with 0.05% Merthiolate. The scrapes were vigorously vortexed, and the suspension was centrifuged for 10 min at 3,000 x g. The cells were resuspended in 1.0 ml of phosphate-buffered saline, of which 0.5 ml was used for DNA extraction (9). The DNA was finally suspended in 60 ,ul of 10 mM Tris hydrochloride-1 mM EDTA. Of the remaining cell suspension, 0.4 ml was used for the modified FISH, whereas 0.1 ml was reserved for direct PCR. HPV detection by direct PCR. To optimize the use of PCR directly on crude cell suspensions for HPV detection, several pretreatment methods were attempted. Briefly, cells were subjected to proteinase K incubation (8, 10), alkaline denaturation followed by neutralization (5, 11), or common protein fixation methods such as buffered Formalin (14), paraformaldehyde, ethanol, and acetone (13). The optimal protocol used cell suspensions that had been pelleted and resuspended in phosphate-buffered saline and then frozen at -40°C. After thawing, the cells were vortexed vigorously. Subsequently, 10 ,ul of the homogeneous cell suspension was
Corresponding author. 2739
2740
VAN DEN BRULE ET AL.
J. CLIN. MICROBIOL.
TABLE 1. Sequences of general primers, type-specific primers, and probes Primer or probe
Sequence
General primers GP .................. GP 6 ...................
+ 5' TTTGTTACTGTGGTAGATAC 3' -
Type-specific primers' 6.1 ................... + 6.2 ................... 11.1 ................... + 11.2 ................... 16.1 ................... + 16.2 ................... 18.1 ................... + 18.2 ................... 31.1 ................... + 31.2 ................... 33.1 ....................+ 33.2 ................... -
Type-specific oligonucleotide probes' HPV 6 ................. HPV HPV HPV HPV HPV
+ 11 ................. + 16 ..................+ 18 ................. + 31 .................+ 33 .................+
a Data from
reference 15. b Data from reference 16. HPV 31-specific primers direct for the amplification of 514-base pairs nucleotides 3371 to 3400. taken with a disposable pipette (Microman, Gilson, France), denatured at 100°C for 10 min, cooled on ice, and centrifuged for 1 min at 3,000 x g. Different primers were used in the PCR for HPV detection. The general primers GP 5 and 6 (15), which were highly homologous to the Li region of a broad spectrum of HPV genotypes, were used in the GP-PCR. In the TS-PCR, a mixture of HPV 6-, 11-, 16-, 18-, 31, and 33-specific cloning site-flanking primers (16) were used. Primer sequences are shown in Table 1, and oligonucleotides were synthesized on a Pharmacia LKB Gene Assembler Plus. The GP-PCR was performed in 50 ,ul of PCR solution containing 50 mM KCl, 3.5 mM MgCl2, 0.01% gelatin, 200 ,uM each deoxynucleoside triphosphate, 25 pmol of each general primer, 1 U of thermostable DNA polymerase (Amplitaq; Cetus), and 10 ,ul of denaturated cell suspension. The mixture was overlaid with several drops of paraffin oil to prevent evaporation and was incubated for 5 min at 95°C for DNA denaturation. Forty cycles of amplification were performed by using a PCR processor (Biomed, Theres, Federal Republic of Germany). Each cycle consisted of a denaturation step at 95°C for 1 min, followed by a primer annealing step at 40°C for 2 min and a chain elongation step at 72°C for 1.5 min. Finally, 10 ,ul of the amplification product was analyzed by 1.5% agarose gel electrophoresis. The TS-PCR was performed as described for the GP-PCR, except that 1.5 mM MgCl2, 25 pmol of each cloning siteflanking primer, and an annealing temperature of 55°C were used. Southern blot analysis of PCR products. For the analysis of the amplification products of GP-PCR, the DNA was transferred from the gel to a nylon membrane (Biotrace, Gelman Sciences) by diffusion blotting in 0.5 N NaOH-1.5 M NaCl overnight. Thereafter the membrane was saturated with 2x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and incubated for 2 h at 55°C in a prehybridization solution
5' GAAAAATAAACTGTAAATCA 3' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5'
TAGTGGGCCTATGGCTCGTC TCCATTAGCCTCCACGGGTG GGAATACATGCGCCATGTGG CGAGCAGACGTCCGTCCTCG TGCTAGTGCTTATGCAGCAA ATTTACTGCAACATTGGTAC AAGGATGCTGCACCGGCTGA CACGCACACGCTTGGCAGGT
3' 3' 3' 3' 3' 3' 3' 3' ATGGTGATGTACACAACACC 3' GTAGTTGCAGGACAACTGAC 3'
5'ATGATAGATGATGTAACGCC3' 5' GCACACTCCATGCGTATCAG 3'
5'CATTAACGCAGGGGCGCCTGAAATTGTGCC3' 5'CGCCTCCACCAAATGGTACACTGGAGGATA3' 5'GCAAACCACCTATAGGGGAACACTGGGGCA3' 5'TGGTTCAGGCTGGATTGCGTCGCAAGCCCA3' 5'ACCTGCGCCTTGGGCACCAGTGAAGGTGTG3' 5'CAAATGCAGGCACAGACTCTAGATGGCCAT3'
(nucleotides 3057 to 3570); the HPV 31 probe is localized at
(0.5 M sodium phosphate [pH 7.4], 7% sodium dodecyl sulfate, 1 mM EDTA). Hybridization under low-stringency conditions (T,,, - 33°C) with [ot-32P]dCTP random primerlabeled probe mixture was performed at 55°C for 16 h. The probe consisted of a mixture of the GP-PCR products of cloned HPV 6, 11, 16, 18, 31, and 33, which were electrophoretically separated in low-melting-point agarose (BioRad Laboratories) excised from the gel and labeled directly by the random primer method (Pharmacia, Uppsala, Sweden). After hybridization, washes were performed at low stringency (Tm - 33°C) by using 3 x SSC-0.5% sodium dodecyl sulfate at 55°C. Autoradiography was performed overnight at -80°C with Kodak Royal X-Omat film and intensifying screens. For the analysis of the HPV TS-PCR products, hybridization was performed with HPV 6, 16, and 33 and HPV 11-, 18-, and 31-specific [r-32P]end-labeled internal oligonucleotides (Table 1) as described above. Washes were performed by using 3x SSC-0.5% sodium dodecyl sulfate at 55°C. HPV detection by FISH/TS-PCR. The modified FISH procedure was performed as previously described (11). Briefly, cell suspensions were lysed and DNA was denatured directly in 0.4 N NaOH at 65°C for 10 min. After neutralization with 10 N ammonium acetate (pH 5.6) at 4°C, the specimens were spotted in duplicate on two different nylon membranes (Biotrace, Gelman Sciences) by using a Cito-spot apparatus (Spikker BV, Zevenaar, The Netherlands). Hybridization of the first membrane was performed under high-stringency conditions with an HPV 6- and 11-specific [oL-32P]dCTP random primer-labeled probe, autoradiographed, and subsequently hybridized with an HPV 18-specific probe. The second membrane was subsequently hybridized with an HPV 16- and HPV 31- and 33-specific probe. Autoradiography was performed for 3 days at -80°C with intensifying screens.
All scrapes with abnormal cytology and a selected group
RAPID DETECTION OF HPV IN CERVICAL SCRAPES BY PCR
VOL. 28, 1990 direct GP-PCR:
2741
direct TS-PCR:
*
c
2 11 13 16 17 19 20 22 23 25 34 38 3940 M
(bp) 1632 396 220 154
D
280 152
E 514
B
218
a
-140
l"
a
b
l i I i I I I I I 1I 31 X - 16 - X X 1616 X 6 18 - 16
HPV
-140
FIG. 1. Detection of HPV genotypes in cervical scrapes by direct PCR. (A) Crude cell suspensions of scrapes 1 to 40 were tested by GP-PCR. In addition, a positive control (Si; 103 SiHa cells which contain 1 to 10 copies of HPV 16 per genome) and a negative control (BI; distilled water) were analyzed. GP-PCR products are shown after electrophoresis on a 1.5% agarose gel and staining with ethidium bromide. (B) Southern blot analysis of GP-PCR products under weakly stringent hybridization conditions with labeled GP-PCR products derived from cloned sequenced HPV types 6, 11, 16, 18, 31, and 33. Washes were also performed under conditions of low stringency. (C) GP-PCR-positive and doubtful scrapes were subjected to TS-PCR using a mixture of HPV 6-, 11-, 16-, 18-, 31-, and 33-specific primers. TS-PCR products are shown after electrophoresis on a 1.5% agaîose gel and staining with ethidium bromide. (D) Southern blot analysis of TS-PCR products with labeled HPV type 6-, 16-, and 33-specific oligonucleotides. (E) Southern blot analysis with labeled HPV type 11-, 18-, and 31-specific oligonucleotides. M, pBR322 DNA digested with HinfI.
of FISH-positive or doubtful scrapes with normal cytology subjected to TS-PCR. After extraction of DNA from the remaining cells, TS-PCR was performed as described above by using 1 ,ul of DNA. were
RESULTS AND DISCUSSION Much evidence has been collected that support a role of HPV in the development of cervical cancer (1, 19). Detection of HPV in cervical scrapes may therefore be the preferred method to identify cervical cells having oncogenic potential. To make PCR suitable for large HPV-screening programs, it is necessary to apply PCR directly on cervical scrapes, omitting the laborious DNA purification step. Therefore, different pretreatments of the cells were investigated and tested on cervical cells previously found to contain HPV 16, 18, and 33 by PCR performed on extracted DNA. Previous studies already reported the performance of PCR directly on single cells (8) and cell suspensions (6, 10). These and other methods used (see Materials and Methods) were not reproducible in our hands. However, a pretreatment that con-
sisted of a freeze-thaw step followed by boiling the cells before the PCR mixture was added consistently resulted in successful amplification of HPV target sequences. The efficiency of amplification was similar to PCR performed on purified DNA. Reduced PCR efficiency was not noted by using direct PCR when cervical scrapes containing blood were analyzed, probably because the serum components were lost during an initial pelleting of the cells. Although the direct PCR was performed in the presence of cellular components, a detection level of about 10 to 100 copies of HPV in a given sample was found as determined with a serial dilution of SiHa cells (1 to 10 copies of HPV per genome) in 105 human fibroblast cells (data not shown). The observed sensitivity was similar to previous findings (15, 16). Direct PCR was applied to all cervical scrapes as a screening method by using general primers known to permit the detection of sequenced and still unsequenced HPV types, followed by nonstringent hybridization (Fig. 1A and B). With this single assay, a simple selection can be achieved between HPV-positive and HPV-negative cervical scrapes.
2742
J. CLIN. MICROBIOL.
VAN DEN BRU LE ET AL.
TABLE 2. Comparison of FISH/PCR and direct PCR strategies for the detection of HPV in cervical scrapes Direct GP/TS-PCR
FISH/TS-PCR Cytology
n
No. HPV
No. ( HPV
nega- positive tive
411 394 Normal (Pap t, 11) 37 17 Mild dysplasia (Pap Illa) 2 7 Severe dysplasia (Pap lIlb) 1 4 CIS (Pap IV)
No. of HPV-positive scrapes
Double
19/38b 19 (51) 5 (71) 3 (75)
16/33 6/16
6
11
1 1
16
18
17 10 3 2
2 1
31
1 5
1
33
No. (%) HPV positive
No. of HPV-positive scrapes
Double
6
il 16 18 31 33
58 (14) 6/16/31, 16/31 1 1 30C (81) 16/33 (2x) 6 (86) 6/16 4 (100)
23 1 11 2 3 1 2
3 5 1
X" 28 9 1 1
'HPV X, Yet unsequenced HPV types, determined by low-stringent hybridization, which revealed strong hybridization signals. "PCR only performed on FISH-positive and doubtful scrapes. 'Two scrapes scored positive by direct PCR and not by PCR performed on purified DNA, namely, one HPV 16-positive and one HPV 16/33-positive scrape.
Different general or consensus primers localized in the El region (4, 17) and the Li region (10, 15) have been described. The L1-specific primer set GP 5 and 6 was preferred in this study because of its superior matching with the sequenced genital HPV types and the short length of the amplified segment, which might be advantageous in less efficient amplification conditions such as crude cell suspensions. Scrapes, strongly positive (Fig. 1B, lanes 2, 11, 16, 19, 20, 22, 23, 25, 34, and 40) and weakly positive (Fig. lB, lanes 13, 17, 38, and 39) by GP-PCR, were subjected to TS-PCR for the identification of sequenced HPV types (Fig. 1C). In this gynecological outpatient population, up to 20% of the scrapes were positive by GP-PCR and had to be tested by TS-PCR. Additional hybridization with type-specific internal oligonucleotide probes confirmed the HPV typing based on fragment size (16), as shown for HPV types 6, 16, 18, and 31 (Fig. 1D and E). Scrapes that were positive by GP-PCR but negative by TS-PCR were suspected to contain unsequenced HPV genotypes (HPV X in Fig. 1, lanes 11, 19, 20, and 25; Table 2). In this study, only HPV X giving hybridization signals equal or stronger than about 100 SiHa cells in GP-PCR was taken into account. False-positivity in detection of these HPV X genotypes due to contamination or cellular cross-hybridization is excluded by dot blot hybridization of the PCR products with cloned unsequenced HPV types and the loss of hybridization signals after additional washes under high-stringency conditions as previously demonstrated (17). Preliminary sequence analyses of several HPV X-assigned PCR products revealed strong homology with known HPV types and were not found in a data bank of known eucaryotic sequences (GenBank, release 61, Beckman). In addition, sequenced HPV X clones were used as probes in Southern blot experiments, which showed that these types were partially present among the other HPV X-containing scrapes, thereby arguing against false-positivity. However, samples with weaker signals than 100 SiHa cells after GP-PCR analysis (Fig. 1B, lanes 13, 17, and 39) and negative TS-PCR are considered HPV negative at this moment. Whether these signals originate from cellular crosshybridization or distantly related HPV genotypes is under investigation.
To study the
use
of the direct PCR
strategy for HPV in cervical scrapes,
as a new screening a comparison was
made with HPV detection by FISH/TS-PCR. The HPV prevalence rates found by both approaches in cervical scrapes of a gynecological outpatient population are summarized in Table 2. The increased HPV prevalence rates determined by the direct PCR in both scrapes with normal and abnormal cytology emphasize the strength of this new strategy. This increase can be explained since all scrapes with normal cytology were now screened by the sensitive
PCR and yet unsequenced HPV genotypes were detected as well. Furthermore, the same HPV genotypes were found in a given sample by the different methods used. In addition, some scrapes were HPV positive by direct TS-PCR and not after TS-PCR performed on purified DNA (Table 2), possibly due to trapping of DNA in the phenol interface during DNA extraction. The results presented herein show that the direct GP/TS-PCR strategy is superior to the FISH/PCR procedure. More women can be easily monitored in a single test for the presence or absence of a broad spectrum of HPV genotypes. The direct PCR is also fast; 120 samples can be processed for PCR within 2 h. In this way, one technician can routinely screen 500 samples of a patient population per week for HPV using the whole procedure. Rapidity is not restricted by sample pretreatment and can be enhanced by shortening of hybridization and autoradiography. Application of nonradioactive detection of PCR products and automation will further increase the use of direct PCR in routine HPV screening of cervical scrapes. Besides reduced falsenegativity in comparison with FISH/PCR, the direct PCR strategy is less sensitive to false-positive results due to contamination (2, 17), since DNA has not to be extracted. In conclusion, the described PCR procedure using crude cell suspensions is a simple, rapid, sensitive, and specific detection method, which is suitable for large HPV-screening programs, necessary to evaluate epidemiological aspects (20) as well as the clinical relevance of an HPV infection. The outcome of these studies may also be important for the eventual replacement of cytological screening (7) by HPV detection in population-based screening programs for cervical cancer. ACKNOWLEDGMENTS We thank E. Risse for cooperation in screening the cervical scrapes cytologically and P. Snijders for critically reading the
manuscript. This work was supported by grant 28-1502 from the Prevention Fund, The Netherlands. LITERATURE CITED 1. Campion, H. J., J. Cuzick, D. J. McCance, and A. Singer. 1986. Progressive potential of mild cervical atypia: prospective cytological, colposcopic and virological study. Lancet ii:237-240. 2. Clewly, J. P. 1989. The polymerase chain reaction, a review of the practical limitations for human immunodeficiency virus diagnosis. J. Virol. Methods 25:179-188. 3. Gissmann, L., and A. Schneider. 1986. The role of human papillomavirus in genital cancer, p. 15-25. In G. De Palo, F. Rilke, and H. zur Hausen (ed.), Herpes and papilloma viruses. New York Serzona Symposia Publications, Raven Press, New York. 4. Gregoire, L., M. Arella, J. Campione-Piccardo, and W. D.
VOL. 28, 1990
5.
6. 7.
8.
9. 10.
11.
12.
13.
RAPID DETECTION OF HPV IN CERVICAL SCRAPES BY PCR
Lancaster. 1989. Amplification of human papillomavirus DNA sequences by using conserved primers. J. Clin. Microbiol. 27:2660-2665. Jiwa, N. M., G. W. van Gemert, A. K. Raap, F. M. RUke, A. Mulder, P. F. Lens, M. M. M. Salimans, F. E. Zwaan, W. van Dorp, and M. van der Ploeg. 1989. Rapid detection of human cytomegalovirus DNA in peripheral blood leucocytes of viremic transplant recipients by the polymerase chain reaction. Transplantation 48:72-76. Kogan, S. C., M. Doherty, and J. Gitschier. 1987. An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences. N. Engl. J. Med. 317:985-990. Koss, L. G. 1989. The Papanicolaou test for cervical cancer detection: a triumph and a tragedy. J. Am. Med. Assoc. 261:737-743. Li, H., U. B. Gyllensten, X. Cui, R. K. Saiki, H. A. Erlich, and N. Arnheim. 1988. Amplification and analysis of DNA sequences in single human sperm and diploid cells. Nature (London) 335:414-417. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Manos, M. M., Y. Ting, D. K. Wright, A. J. Lewis, T. R. Broker, and S. M. Wolinsky. 1989. Use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells 7:209-214. Melchers, W. J. G., P. Herbrink, J. M. M. Walboomers, C. J. L. M. Meyer, H. van de Drift, and W. G. V. Quint. 1989. Optimization of human papillomavirus genotype detection in cervical scrapes by a modified filter in situ hybridization test. J. Clin. Microbiol. 27:106-110. Melchers, W., A. van den Brule, J. Walboomers, M. de Bruin, P. Herbrink, C. Meijer, J. Lindeman, and W. Quint. 1989. Increased detection rate of human papillomavirus in cervical scrapes by the polymerase chain reaction as compared to modified FISH and Southern blot analysis. J. Med. Virol. 27:329-335. Muliink, H., J. M. M. Walboomers, T. M. Tadema, D. J. Jansen, and C. J. L. M. MeiJer. 1989. Combined immuno- and non-
14. 15.
16.
17.
18.
19. 20. 21.
2743
radioactive hybridocytochemistry on cells and tissue sections: influence of fixation, enzyme pretreatment, and choice of chromogen on detection of antigen and DNA sequences. J. Histochem. Cytochem. 37:603-609. Shibata, D. K., N. Arnheim, and W. J. Martin. 1988. Detection of human papillomavirus in paraffin-embedded tissue using the polymerase chain reaction. J. Exp. Med. 167:225-230. Snijders, P. J. F., A. J. C. van den Brule, H. F. J. Schrinemakers, G. Snow, C. J. L. M. Meijer, and J. M. M. Walboomers. 1990. The use of general primers in the polymerase chain reaction permits the detection of a broad spectrum of human papillomavirus genotypes. J. Gen. Virol. 71:173-181. Van den Brule, A. J. C., H. C. J. Claas, M. du Maine, W. J. G. Melchers, T. Helmerhorst, W. G. V. Quint, J. Lindeman, C. J. L. M. Meijer, and J. M. M. Walboomers. 1989. Use of anti-contamination primers in the polymerase chain reaction for the detection of human papillomavirus genotypes in cervical scrapes and biopsies. J. Med. Virol. 29:20-27. Van den Brule, A. J. C., P. J. F. Sniyders, R. L. J. Gordijn, O. P. Bleker, C. J. L. M. Mejer, and J. M. M. Walboomers. 1990. General primer mediated polymerase chain reaction permits the detection of both sequenced and still unsequenced human papillomavirus genotypes in cervical scrapes and carcinomas. Int. J. Cancer 45:644-649. Wagner, D., H. Ikenberg, N. Boehm, and L. Gissmann. 1984. Identification of human papillomavirus in cervical swabs by deoxyribonucleic acid in situ hybridization. Obstet. Gynecol. 64:767-772. Zur Hausen, H. 1989. Papillomaviruses in anogenital cancer as a model to understand the role of viruses in human cancers. Cancer Res. 49:4677-4681. Zur Hausen, H. 1989. Papillomavirus in anogenital cancer: the dilemma of epidemiologic approaches. J. Natl. Cancer Inst. 81:1680-1682. Zur Hausen, H., and A. Schneider. 1987. The role of papillomaviruses in human anogenital cancer, p. 245-263. In N. P. Salzman and P. M. Howley (ed.), The papovaviridae-the papillomavirus. Plenum Publishing Corp., New York.
