Subdominant hierarchical ovarian follicles are needed for steroidogenesis and ovulation in laying hens (Gallus domesticus).

G Model

ARTICLE IN PRESS

ANIREP-4963; No. of Pages 10

Animal Reproduction Science xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci

Subdominant hierarchical ovarian follicles are needed for steroidogenesis and ovulation in laying hens (Gallus domesticus) P.L. Rangel a,∗ , A. Rodríguez a , K. Gutiérrez a , P.J. Sharp b , C.G. Gutierrez a a Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia, Av. Universidad 3000, Col. UNAM, CU. CP 04510, Mexico City, Mexico b The Roslin Institute, Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9PS, UK

a r t i c l e

i n f o

Article history: Received 23 January 2014 Received in revised form 5 April 2014 Accepted 25 April 2014 Available online xxx

Keywords: LH StAR 3␤-HSD Testosterone Progesterone Granulosa

a b s t r a c t Ovarian follicle development in avian species is characterized by a strict hierarchical arrangement. The hierarchical follicles secrete progesterone, which induces the LH surge, but the capacity to produce other steroids decreases with development. Our aim was to evaluate the complementary action of subdominant follicles (F4–F6) on ovulation and steroidogenesis of the preovulatory follicles (F1–F3) in domestic laying hens. The first study included four groups: control (C); sham-operated (SO); large hierarchical follicles (LHF) from which F4–F6 follicles were extracted; and subdominant hierarchical follicles (SHF) from which F1–F3 follicles were extracted. Blood samples were collected every 2 h from 12 h before estimated ovoposition until 2 h after ovoposition. Egg laying continued at the same rates in C and SO hens, with normal preovulatory surges of oestradiol, testosterone, progesterone and LH. In contrast, in LHF and SHF groups, ovoposition was blocked; oestradiol concentrations were not affected; but no preovulatory surges of testosterone, progesterone or LH were seen. Further, the testosterone surge was required for the occurrence of progesterone and LH surges. In the second study StAR and steroidogenic enzyme mRNA expression was evaluated within F1–F3 follicles from a LHF group and C-14 and C-8 controls groups, in which follicles were collected 14 h and 8 h before expected ovoposition, respectively. Extraction of F4–F6 follicles caused a significant reduction in StAR and 3␤-HSD expressions within theca, but not in granulosa cells. In conclusion, subdominant hierarchical follicles (F4–F6) are required for the preovulatory release of testosterone, progesterone and LH, which are highly inter-correlated. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Although avian production for human consumption is an ancient industry, some reproductive physiological conditions in birds are poorly understood. Avian species

∗ Corresponding author. Tel.: +52 5556225860; fax: +52 56225935. E-mail address: [email protected] (P.L. Rangel).

have a particular follicular development, with a special arrangement of hierarchical and prehierarchical follicles (Johnson et al., 1993). However, the role of subdominant follicles within the follicular hierarchical preovulatory follicle growth, maturation and ovulation is not completely known, although their steroid production is believed to be complementary in the ovulatory process. In laying hens the largest ovarian follicles, hierarchical follicles (F1–F7), have sizes between 9 and 35 mm

http://dx.doi.org/10.1016/j.anireprosci.2014.04.011 0378-4320/© 2014 Elsevier B.V. All rights reserved.

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014), http://dx.doi.org/10.1016/j.anireprosci.2014.04.011

G Model ANIREP-4963; No. of Pages 10

2

ARTICLE IN PRESS P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxx–xxx

in diameter, with the largest follicle ovulating each day (Gilbert et al., 1983; Johnson, 1996). Further, the patterns of steroidogenic profiles in the maturing ovarian follicle are well known (Bahr et al., 1983; Porter et al., 1989). Oestradiol is secreted by the outer theca layer, and its concentrations are highest in the smaller yellow yolky follicles and progressively decrease to low values in the mature F1 preovulatory follicle (Armstrong, 1984; Porter et al., 1989). Testosterone is mainly released by the inner theca layer in all the yellow yolky follicles and is lowest in the F1 preovulatory mature follicle (Porter et al., 1989; Hernández-Vértiz et al., 1993). Progesterone is produced in the granulosa layer, with lowest concentrations in the smaller yellow yolky follicles and highest in the F1 and F2 follicles (Tilly et al., 1991; Yu et al., 1992). Steroid hormones produced by the ovary are related to the ovulatory process in the domestic hen, as ovulation is preceded by simultaneous surges of progesterone and LH (Johnson, 1990; Williams and Sharp, 1978; Johnson and van Tienhoven, 1980), with a positive feedback between both hormones (Etches and Cunningham, 1976; Imai and Nalbandov, 1978; Johnson et al., 1985), in which progesterone induces the LH peak by stimulating GnRH-I release (Sterling et al., 1984; Sharp et al., 1989; Fraser and Sharp, 1978). In addition, prior to the progesterone and LH surges, a preovulatory release of oestradiol occurs (Johnson and van Tienhoven, 1980; Etches and Cheng, 1981), and is further preceded by a well-defined testosterone surge (Williams and Sharp, 1978; Robinson and Etches, 1986; Robinson et al., 1988). Oestradiol “primes” the hypothalamus and enhances the progesterone stimulation of LH release (Wilson and Sharp, 1976; Etches, 1990), while testosterone plays a major role in the ovulatory process, as testosterone immunization or the use of specific testosterone antagonist blocks ovulation in hens without affecting follicular development and blunts the preovulatory surges of progesterone and LH (Rangel et al., 2005, 2006). Additionally, testosterone at physiological or greater concentrations, even in absence of LH, stimulates granulosa cell progesterone production in preovulatory and the three largest follicles in Japanese quails (Sasanami and Mori, 1999) and hens (Rangel et al., 2006). Further, testosterone increases StAR, P450scc, and LH receptor mRNA expression in hen granulosa cells cultured in vitro (Rangel et al., 2009). Unlike in mammals, in which the preovulatory follicles produce all steroids required for ovulation, in avian species oestradiol and testosterone production is lower in larger follicles (Johnson, 1990), despite being needed for the ovulatory process (Wilson and Sharp, 1976; Etches, 1990; Rangel et al., 2005, 2006). Therefore, to clarify whether follicles are complementary, the present study determined if large hierarchical follicles (28–35 mm, F1–F3) need the secretions of the subdominant hierarchical follicles (10–25 mm, F4–F6) to trigger steroidogenesis and ovulation of the largest follicle in the laying hen. Two different studies were done. In the first, we hypothesized that the removal of subdominant hierarchical follicles, and hence the absence of their endocrine contribution (E2 and T), prevents ovulation and preovulatory surges of progesterone and LH. In the second study, the hypothesis was that

the removal of subdominant hierarchical follicles affects larger follicles progesterone production by a decreased mRNA expression of steroidogenic acute regulatory protein (StAR), P450 cholesterol side-chain cleavage enzyme (P450scc) and 3-beta-hydroxysteroid dehydrogenase (3␤HSD); and testosterone secretion by a reduction in mRNA expression of 17-alfa-hydroxylase (17␣-OH). Further, the replacement of testosterone, oestradiol or both can restore gene expression by granulosa and theca cells. 2. Material and methods 2.1. Animals The Ethics and Animal Welfare Committee of the Facultad de Medicina Veterinaria y Zootecnia, UNAM approved the animal procedures. Hy-line laying hens (Gallus domesticus) in the middle of their first laying cycle (40 weeks old) were used for both studies. Animals were housed in individual cages under a 16 h light:8 h dark schedule and had free access to drinking water and food. Laying was recorded daily in order to estimate time of ovulation, assuming that ovulation occurs 15–60 min after ovoposition (Etches, 1996). 2.2. Surgical procedure Animals were anesthetized with halothane (Pollock et al., 2005) at 4% for induction and 3% for maintenance. Ovarian follicles were removed through a left lateral celiotomy after lateral and ventral retraction of the proventriculus (Bennett and Harrison, 1994). All hens (including controls) were fasted for 6 h before the first scheduled surgery, and food was provided again until the last surgery was finished (14 h of fasting in total). 2.3. First study: evaluation of the complementarity of steroid production between hierarchical follicles in laying hens Hens were randomly divided into four groups (Fig. 1): (a) control group (C, n = 6), hens without surgery; (b) shamoperated group (SO, n = 7) hens anesthetized and subjected to an exploratory laparotomy, during which counting and manipulation of the ovarian follicles was performed to simulate the time taken and manipulation made in the oophorectomised groups; (c) large hierarchical follicles group (LHF, n = 6) hens in which the three largest follicles (F1–F3) remained and follicles F4–F6 were removed; and (d) subdominant hierarchical follicles group (SHF, n = 8) hens with the F4–F6 largest follicles and excision of the F1–F3 follicles. After removal of follicles according to the assigned group (Fig. 1), animals were cannulated in the radial vein for blood sampling according to our method previously described (Rangel et al., 2005). All surgeries were performed 14 h before the estimated time of ovoposition. Blood samples were taken at 2 h interval, starting 12 h before the estimated laying time and finishing 2 h after ovoposition. Samples were drawn using 3 mL vacuum tubes containing sodium heparin. Plasma was separated by




3

Fig. 1. Schematic representation of the first study, treatments and sample collection. Animal groups: C = control; SO = sham-operated; LHF = large hierarchical follicles; and SHF = subdominant hierarchical follicles.

centrifugation at 1500 rpm, and blood cells were resuspended in 2.5 mL of sterile saline physiological solution with 0.5 mg/mL of gentamicine (Bruluart, Tultitlan, Mexico) and stored at 4 ◦ C, until returned to the hens immediately after the following blood sample was taken. Catheters were kept patent by flushing with 0.5 mL saline solution containing 50 UI/mL of heparin (PISA, Guadalajara, Mexico). 2.3.1. Hormonal assays Progesterone and testosterone concentrations were determined by radioimmunoassay (Coat-a-Count, Diagnostic Products Corporation, Los Angeles, CA, USA). Sensitivities of the assays were 0.05 ng and 0.06 ng for testosterone and progesterone, respectively; the intraassay coefficients of variation were 5.1% and 6.54%. Oestradiol was measured by ELISA (International ImmunoDiagnostics, CA. USA), with an assay sensitivity of 5.98 pg and an intra-assay coefficient of variation of 6.21%. LH was measured by RIA in 60% of samples as previously described by Sharp et al. (1987) with an assay sensitivity of 0.036 ng/mL and an intra-assay coefficient of variation of 7.6%. All samples were measured in a single assay for each hormone. 2.4. Second study: evaluation of F4–F6 follicular excision and exogenous testosterone or oestradiol treatment on steroidogenic enzymes and StAR protein mRNA expression Hens were randomly assigned to one of the three groups (Fig. 2): (a) large hierarchical follicles (LHF, n = 20) hens in which the three largest follicles (F1–F3) remain until slaughter (8 h before next expected ovoposition) and follicles F4–F6 were removed at surgery (14 h before next expected ovoposition); (b) immature follicles (C-14, n = 23), hens in which follicles F1–F3 were extracted by surgery 14 h before next expected ovoposition, and were used to

compare the effect of time on mRNA expression; and (c) control (C-8, n = 3) hens that were slaughtered 8 h before next expected ovoposition, to collect the largest hierarchical follicles, which were considered more mature at that time point, because the proximity to the ovulatory process. Immediately after surgery, hens from the LHF group were subdivided and received a single dose of one of the four steroid treatments: (a) placebo (subgroup P) hens received 400 ␮l of physiological saline solution (n = 3), (b) testosterone (subgroup T) animals received 600 ng of testosterone (Sigma T1500) (n = 6), (c) oestradiol (subgroup E) animals were treated with 360 ng of 17-␤-estradiol (Sigma E8875) (n = 6) and (d) testosterone + oestradiol (subgroup T + E) hens were injected with both testosterone and oestradiol at the doses indicated above (n = 5), to evaluate the effect of steroid replacement. Steroids were purchased from Sigma–Aldrich (California), diluted in physiological saline solution, in a final volume of 400 ␮l per hen, and were applied by intramuscular injection. Six hours after surgery, all animals were slaughtered by cervical dislocation, and remaining hierarchical follicles were collected to assess follicular StAR protein and steroidogenic enzyme expression. 2.4.1. mRNA isolation and quantification Follicles collected, either after surgery or after slaughter, were immediately processed in the laboratory. Granulosa and theca cells were isolated from each F1, F2 and F3. We used 10–15 mg of each sample to extract total RNA, with the UltraClean tissue and an RNA isolation Kit (MoBio). RNA concentration and purity were calculated using the AmpliQuant AQ07 spectro-photometer. A retrotranscription (RT) was performed in 5 ␮g of total RNA, using Oligo (dT) primer and RT, as recommended by the manufacturer (SuperScript First-Strand Kit, Invitrogen). Steroidogenic acute regulatory protein (StAR), P450 cholesterol side-chain cleavage enzyme (P450scc), 3-beta-hydroxysteroid dehydrogenase


G Model

ARTICLE IN PRESS

ANIREP-4963; No. of Pages 10

P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxx–xxx

4

Fig. 2. Schematic representation of the second study treatments and follicle collection. Treatment groups: C-14 = F1–F3 control follicles collected 14 h before expected ovulation; C-8 = F1–F3 control follicles collected 8 h before expected ovulation; and LHF = F1–F3 follicles collected 6 h after follicular extraction of the subdominant follicles. Animals in LHF group were further divided into four subgroups that received: P = SSF as a placebo, T = testosterone, E = oestradiol, and T + E = testosterone plus oestradiol.

(3␤-HSD), and 17-alfa-hydroxylase (17␣-OH) cDNA were quantified by real-time PCR using 8.58 ng of total cDNA and the primers manufactured by Applied Biosystems, which are shown in Table 1. Amplification cycles were 50.8 ◦ C for 2 min, 95.8 ◦ C for 10 min and then 45 cycles were performed at 95.8 ◦ C for 15 s, and 60.8 ◦ C for 1 min using TaqMan Universal PCR Master Mix. The amounts of StAR, P450scc, 3␤-HSD, and 17␣-OH mRNAs expressed in granulosa or theca cells were estimated from standard cDNA curves prepared for each gene. Briefly, 1 ␮l of each total cDNA sample was taken and amplified in a PCR reaction using the same primers as for the real time PCR, at 94 ◦ C for 5 min and then for 40 cycles at 94 ◦ C for 15 s and 60 ◦ C for 1 min. The amplification products were isolated by electrophoresis in a 2.5% agarose low-melting point gel and identified using a transilluminator. The amplification products were extracted from the gels using the QIAquick gel extraction Kit (Qiagen), and quantified densitometrically using a spectrophotometer. Total cDNA copies were calculated as described by Tricarico et al. (2002). The relationship between quantitative PCR (Ct) values and cDNA copies in 1 ␮g RNA were determined by regression analyses, which were found to be linear. The number of cDNA

copies for the unknown samples was calculated from the regression equation. Each standard curve had a range of 1 × 105 –1 × 1011 copies. 2.5. Statistical analyses 2.5.1. First study Laying percentage was evaluated by Fischer exact test, to establish differences between groups. The pretreatment period considered the 10 days prior to and until the day after surgery, while the post-treatment period included 5 days starting on the day of the expected ovoposition (two days after surgery). The acute effect of treatment on ovulation was evaluated on the day after oophorectomy (day 0), approximately 24 h after the expected time for ovulation (Etches, 1990). Differences in the reinitiation of laying were estimated by Kruskal–Wallis one-way analysis of variance. The effect of surgery on ovoposition and on the occurrence of steroid and LH surges was evaluated comparing the control and sham-operated groups. The occurrence of each hormone surge was analyzed by Chi-square, defining a surge as an increase of two standard deviations over the mean concentration of the preceding 4 h.

Table 1 Primers used for the detection of the mRNA by real-time RT-PCR assay. TaqMan gene expression assays: StAR (Gg03338457 g1) and CYP17A1 (Gg03346131 g1). Primer sequence (5 →3 )

TaqMan probe (5 →3 )

Size (pb)

GenBank identification

StAR

Data not available

ACGGTGGCGGACAACGGAGACAAAG

90

NM 204686.1

P450scc-chicken

For: ACCGTGACTACCGCAACAAG Rev: AGGCCTCCCCTGTCTTGA

CCTACGGCGTGCTCC

53

NM 001001756

3␤-HSD chicken

For: TCAGCAGGGAGGCACTCT Rev: CCCTTCTAGGATTTTCACCTCAGT

ACTTGCCAAAGCTCC

67

D46763.1

CYP17A1 (17␣-OH)

Data not available

GCTGACACCAGCATCGGTGAGTACT

85

NM 001001901.1

Target




5

Table 2 Presence of hormonal surges in control (C), sham-operated (SO) and hens from which follicles were removed (large hierarchical follicles, LHF, and subdominant hierarchical follicles, SHF). Values within the same hormone that differ are indicated by different letters (P < 0.01). Group

Surge incidence percentage E2

C (n = 6) SO (n = 7) LHF (n = 6) SHF (n = 8) Fig. 3. Laying percentage in hens from control (C, n = 6), sham-operated (SO, n = 7), large hierarchical follicles (LHF, n = 6) and small hierarchical follicles (SHF, n = 8) groups, during the pre-treatment period ( = 10 days including the day of surgery), 2 days after surgery ( = day 0) and the post-treatment period ( = 5 days including day 0). (*) and (+) indicate difference vs the control group the day after surgery and during the posttreatment period respectively (P < 0.001).

Hormonal data were analyzed by ANOVA for repeated measurements, considering treatment, hen nested within treatment, time and the interaction between time and treatment as independent variables. Finally, endocrine complementation of the follicles was analyzed by Chisquare to evaluate for independence in the occurrence of every pair of hormone surges. 2.5.2. Second study StAR protein and enzyme mRNA expression were evaluated by REML analysis, considering as random variables the hen, the follicle nested within the hen, and the membrane nested within the follicle, nested within the hen. 3. Results 3.1. First study: complementarity of steroid production between hierarchical follicles in laying hens 3.1.1. Effect of oophorectomy on ovoposition Pretreatment laying percentage (Fig. 3) was similar (P = 0.68) between groups, with an average of 88%. Ovoposition was not affected by the surgical procedure, as laying percentage 2 days after surgery was similar between C and SO groups (100 vs 86, respectively; P = 0.82). In contrast, in hens in which follicles were removed (LHF and SHF groups), ovoposition stopped (P < 0.001) 2 days after

T

100a 71a 67a 75a

100a 100a 17b 0b

P4

LH

100a 86a 33b 0b

100a 100a 33b 0b

surgery. Further, in both oophorectomised groups, ovoposition remained lower than in C and SO groups throughout the post-treatment period (P < 0.001). Ovoposition continued normally throughout the study in hens from C and SO groups. In contrast, animals from the LHF and SHF groups took 3.3 and 3.5 days, respectively, to restart ovoposition (P < 0.001). Moreover, 3 out of the 8 hens from the SHF group had not resumed laying by day 4, when recording of ovoposition concluded, showing a greater time to reset for this group.

3.1.2. Effect of oophorectomy on endocrine surges The frequency of occurrence of hormonal surges (Table 2) did not differ between C and SO hens (P > 0.05), further hens showed surges of all studied hormones. Additionally, oestradiol surge frequency was similar between all groups (P > 0.05). In contrast, testosterone, progesterone and LH surge occurrence were significantly reduced by follicular removal (P < 0.01). In the LHF group two animals presented testosterone, progesterone or LH surges, however, they were of lesser magnitude than those of C and SO groups, and did not stimulate ovulation in the hens.

3.1.3. Endocrine complementation Complementarities of hormone production between hierarchical follicles showed that surges of testosterone, progesterone and LH were independent of the oestradiol surge (P > 0.05). In contrast, surges of progesterone and LH were dependent on the testosterone surge (P < 0.001). Finally, the LH surge was highly dependent on the progesterone surge (P < 0.001) (Table 3).

Table 3 Matrix of occurrence of the preovulatory hormone surges and their interdependency in ovulation of laying hens. Hormone

Surge occurrence

Oestradiol

Yes (n = 22) No (n = 5)

Testosterone

Yes (n = 13) No (n = 14)

Progesterone

Yes (n = 14) No (n = 13)

Hormone surge dependency

Testosterone (%)

Progesterone (%)

LH (%)

50 40 P = 0.686

55 40 P = 0.557

59 40 P = 0.438

92 14 P < 0.001

100 14 P < 0.001 100 8 P < 0.001



6


Fig. 4. Effect of small hierarchical follicle oophorectomy and hormonal treatment on P450scc, StAR and 3␤-HSD mRNA expression in granulosa (Left panel) and theca cells (Right panel). Where C-14 = large follicles collected 14 h before the expected ovulation; C-8 = large follicles extracted 8 h before the expected ovulation and 6 h after oophorectomy without treatment; P = large follicles collected 6 h after oophorectomy of the small follicles, which received SSF as a placebo, and TX = large follicles collected 6 h after oophorectomy of the small follicles, with a single administration of testosterone, oestradiol or both hormones immediately after surgery. Values are means of the logarithm of mRNA copies by microgram of cDNA. Expression differs between cell layers. Differences between groups in the same panel are indicated by different letters (P = 0.04).

3.2. Second study: evaluation of follicular excision and exogenous testosterone and oestradiol treatments on steroidogenic enzymes and StAR protein mRNA expression StAR and all enzyme mRNA expressions were similar for F1, F2 and F3 follicles (P > 0.05). Therefore, data from these follicles was pooled for analysis. Six hours of follicle maturation (groups C-14 vs C-8) caused a decrease on 3␤-HSD expressions in granulosa and theca cells, while no effect was observed on P450scc and StAR mRNA expression (Fig. 4). When oophorectomy of the small hierarchical follicles was performed, granulosa cell 3␤-HSD concentrations remained unaltered in this 6 h period (group C-8 vs group P). However,

StAR and 3␤-HSD mRNA expression decreased in theca cells (Fig. 4). No differences were found in mRNA expression of any steroidogenic enzyme or StAR protein between oophorectomized animals with (T, E and T + E groups) or without (group P) hormonal administration. Therefore, data from all hormonal treatment groups were pooled, analyzed and defined as treatment group (TX) (Figs. 4 and 5). Expression of mRNA for steroidogenic enzymes and StAR protein differed between granulosa and theca cells. P450scc, StAR and 3␤-HSD were significantly higher in granulosa than in theca cells (P = 0.043 for P450scc; P < 0.001 for StAR and 3␤-HSD) (Fig. 4). Six hours of follicle maturation (group C-14 vs C-8) caused a decrease on




Fig. 5. Effect of small hierarchical follicle oophorectomy and hormonal treatment on 17␣-OH mRNA expression in theca cells. Where C-14 = large follicles collected 14 h before the expected ovulation; C-8 = large follicles extracted 8 h before the expected ovulation and 6 h after oophorectomy without treatment; P = large follicles collected 6 h after oophorectomy of the small follicles, which received SSF as a placebo and TX = large follicles collected 6 h after oophorectomy of the small follicles, which received testosterone, oestradiol or both hormones. Values are means of logarithm of number of mRNA copies by microgram of cDNA. Differences between groups are indicated by different letters (P = 0.04).

17␣-OH mRNA expression in theca cells, while concentrations remained unaltered when oophorectomy of the small hierarchical follicles was performed (Fig. 5).

4. Discussion The present study shows that subdominant hierarchical follicles are indispensable for the occurrence of the preovulatory surges of testosterone, progesterone and LH, but not of oestradiol, in laying hens. Similarly, the testosterone surge is necessary for progesterone and LH surges to occur. In addition, subdominant preovulatory follicles affect the endocrine activity of larger preovulatory follicles. Higher concentrations of P450scc, StAR and 3␤-HSD were found in granulosa cells from the larger follicles. This was expected, because granulosa cell steroidogenic capacity increases with steroid production (Porter et al., 1989; Nitta et al., 1993), and they are the main source of progesterone production (Huang et al., 1979; Porter et al., 1989). Similarly, the highest concentrations of these enzymes were expected in the F1 follicle, since it produces the preovulatory surge of progesterone (Yu et al., 1992; Nakamura et al., 1991). However, in our study mRNA concentrations for StAR and steroidogenic enzymes did not differ between the three largest follicles. The absence of differences may be due to the time of follicle collection (8 h before expected ovulation), as the preovulatory surge of progesterone normally occurs 6–4 h before ovulation (Johnson and van Tienhoven, 1980) and thus it could have been missed. Further, it is now known that StAR expression is regulated by circadian clock genes, involved in the timing of the preovulatory release of progesterone (Nakao et al., 2007). Hence, the detailed characterization of steroidogenic enzyme expression in the follicle as it matures for ovulation will need to consider the relationship with the expression of clock genes during the day.

7

The high dependence found between testosterone and progesterone preovulatory surges agrees with our previous studies (Rangel et al., 2006), which have shown that blunting the testosterone preovulatory surge, using a specific testosterone antagonist, acutely blocks ovulation and the preovulatory progesterone and LH surges in laying hens (Rangel et al., 2006). Additionally, a local action of testosterone at the follicular level stimulated progesterone production by granulosa cells of the largest preovulatory follicle (F1) in vitro (Rangel et al., 2007). Our present results suggest that the preovulatory rise of testosterone occurs by endocrine complementation between hierarchical follicles. As the progesterone and LH preovulatory surges have a positive feedback (Lagüe et al., 1975), the dependence between testosterone and LH surges seen could be indirect, due to the lack of progesterone caused by the absence of testosterone. As follicular extraction caused a decrease of testosterone and progesterone production in the first study, we expected a reduction on StAR protein, P450scc and 3␤HSD expressions in granulosa cells by the same treatment. Nonetheless, treatment only produced lower expression of P450scc and 3␤-HSD within theca cells. These results suggest that small hierarchical follicles impact larger follicles progesterone production, through their testosterone production. It has been previously stated that F2–F4 follicles, and more specifically the F3 follicle, are the main sources of testosterone in the avian ovary (Robinson and Etches, 1986; Johnson and van Tienhoven, 1981; Sechman et al., 2006). However, a preovulatory increase in testosterone concentrations was not observed in hens in which small or large hierarchical follicles were removed (F1–F3 and F4–F6 groups). The lack of testosterone surge in hens in which F4–F6 follicles were removed could indicate that these follicles are responsible for producing testosterone (Robinson and Etches, 1986). Alternatively, F4–F6 follicles could stimulate F1–F3 follicles to produce testosterone and progesterone. We have previously shown that testosterone stimulates hen granulosa cell progesterone production in vitro alone or in combination with LH (Rangel et al., 2007), and that this stimulatory action of testosterone is higher when follicles are closer to ovulation (Rangel et al., 2009). Further, testosterone increased StAR, P450scc and LH receptor mRNA expression in hen granulosa cells (Rangel et al., 2009). We now suggest that all hierarchical follicles are needed for the testosterone preovulatory increase and that the rise in testosterone concentrations is not only dependent on the F3 follicle. Seventeen-alfa-hydroxylase is an important enzyme for testosterone production, and its activity decreases in the F1 follicle (Nitta et al., 1991). We did not find differences in 17␣-OH mRNA expression between follicle sizes, but we observed a decrease with time of follicle maturation at the time when the preovulatory surge of testosterone normally occurs, which probably caused a depletion of the enzyme. In addition, this reduction was observed when small hierarchical follicles were removed and the preovulatory surge of testosterone did not occur. The lack of dependence between the oestradiol surge and ovulation shown in this work is in agreement with the



8


study of Lagüe et al. (1975) in which ovulation in laying hens occurred independent of the presence of the oestradiol preovulatory surge. The preovulatory oestradiol surge did not depend solely on subdominant hierarchical follicles (F4–F6), as only 61.11% hens from the F4–F6 follicle group showed a preovulatory increase in oestradiol concentration. This could be related to the results of Armstrong (1984) and Porter et al. (1989), who found that 50% of aromatase activity and 85% of oestradiol production is concentrated in ovarian stroma and prehierarchical follicles (Johnson, 1990). Further, it has been proposed that oestradiol production decreases proportionally with follicle growth and is null in the preovulatory follicle (Armstrong, 1984). In addition, Kawashima et al. (1987) found that oestradiol acts as an inducer of progesterone receptors at the hypothalamic level. Taken together, this evidence suggests that oestradiol has a longer lasting effect on the hypothalamus for its ability to respond to progesterone. In contrast, the surges of testosterone, progesterone and LH occurred only when subdominant hierarchical follicles were present, suggesting that secretions of subdominant follicles are necessary for follicular development and ovulation. Previous studies have demonstrated the secretion of activin A, inhibin A and IGF-I, with paracrine and autocrine actions on follicular development and recruitment. For instance, activin A has a role in keeping hierarchical follicle viability and follicular recruitment (Lovell et al., 1998, 2003), since it increases inhibin A secretion by the F1 follicle and enhances LH and FSH-stimulated secretion of inhibin A and progesterone (Lovell et al., 2002a). Additionally, inhibin A has a role in the maintenance of tonic secretion of FSH (Lovell et al., 2000), and active immunization against inhibin ␣ subunit caused an increase in the number of hierarchical follicles (8–9.9 mm) and double ovulations, regulating the entry of follicles to the preovulatory hierarchy (Lovell et al., 2001). Finally, IGF-I increases the stimulatory action of LH and FSH on progesterone and inhibin A production by preovulatory follicles (Lovell et al., 2002b), and follicular recruitment from the prehierarchical follicle pool into the hierarchical category (Hertelendy et al., 1982). Hence, the absence of subdominant hierarchical follicles and their secretions could have caused regression of the large hierarchical follicles and, consequently, the lack of testosterone, progesterone and LH surges in our study. The lack of post-treatment egg laying in LHF group suggests that follicular atresia could have occurred in response to the absence of the subdominant hierarchical follicles. This is supported by the fact that the average time to resume egg laying was similar to the reported period for the rapid follicular growth phase (Johnson, 1990). We suggest that large hierarchical follicles need the endocrine complementation of subdominant hierarchical follicles to continue their development up to ovulation. The follicular regression that might have occurred in hens with follicle removal may be compared with induction of moulting in the domestic chicken, in which hierarchical follicle regression is due to a reduction in plasma levels of LH and sex steroids (Oguike et al., 2005), a hormonal environment similar to that found in oophorectomised hens in this study.

We considered the possibility that anaesthesia and surgical procedures could have a negative effect on follicle development or endocrine secretions, and therefore included a sham-operated group in the study design. Our results ruled out any adverse effect of anaesthesia as in sham-operated hens only one out of eight hens stopped laying eggs for 4 days while the rest continued laying. The same could be said for the effect of the food restriction, performed in preparation for the surgical procedure. In laying hens, food restriction is commonly used to halt egg laying and induce moulting (Scott et al., 1999; Sgavioli et al., 2013). In our study, fasting lasted for 14 h, and although we did not measure food intake, we recorded that all hens resumed feeding. Hence, the differences in egg laying after surgery were not affected by fasting as the control and sham operated hens were subjected to the same fasting period and did not show the reduction in laying as the oophorectomised hens. Finally, treatment with testosterone, oestradiol or both did not affect expression of any of the mRNA studied. It is possible that no effect was observed because the time of follicle collection (8 h before ovulation) did not coincide with the preovulatory surge of progesterone, or that hormonal doses were ineffective. 5. Conclusions We conclude that prehierarchical follicles contribute to the preovulatory increase of oestradiol. In addition, subdominant hierarchical follicles are necessary to support large hierarchical follicle development. Finally, we propose that, for proper production of testosterone, progesterone and LH, the entire hierarchical follicle range must be present in the hen ovary, and that the testosterone preovulatory surge is needed for ovulation. Conflict of interest None of the authors has any financial or personal relationships that could inappropriately influence or bias the content of the paper. Acknowledgements This work was supported by CONACyT, México, project number CB-82846 and by the Women Academic Support Program (PFAMU) of UNAM (grant number PI200906). Dr. P.J. Sharp thanks Roslin Institute for access to research facilities. Part of this data was presented as a requirement to obtain a bachelor’s degree by Gutierrez K. References Armstrong, D.G., 1984. Ovarian aromatase activity in the domestic fowl (Gallus domesticus). J. Endocrinol. 100, 81–86. Bahr, J.M., Wang, S.C., Huang, M.Y., Calvo, F.O., 1983. Steroid concentrations in isolated theca and granulosa layers of preovulatory follicles during the ovulatory cycle of the domestic hen. Biol. Reprod. 29, 326–334. Bennett, R.A., Harrison, G.J., 1994. Soft tissue surgery. In: Ranson, W., Harrison, G.J., Harrison, L.R. (Eds.), Avian Medicine: Principles and Applications. , 3rd ed. Wingers Publishing, Florida, pp. 1096–1136.




Etches, R.J., 1990. The ovulatory cycle of the hen. Crit. Rev. Poult. Biol. 2, 293–313. Etches, R.J., 1996. Reproduction in Poultry. CAB International, Cambridge, pp. 318–319. Etches, R.J., Cheng, K.W., 1981. Changes in plasma concentrations of luteinizing hormone, progesterone, oestradiol and testosterone and in the binding of follicle stimulating hormone to the theca of follicles during the ovulation cycle of the hen (Gallus domesticus). J. Endocrinol. 91, 11–22. Etches, R.J., Cunningham, F.J., 1976. The interrelationship between progesterone and luteinizing hormone during the ovulatory cycle of the hen (Gallus domesticus). J. Endocrinol. 71, 51–58. Fraser, H.M., Sharp, P.J., 1978. Prevention of positive feedback in the hen by antibodies to luteinizing hormone releasing hormone. J. Endocrinol. 76, 181–182. Gilbert, A.B., Perry, M.M., Waddington, D., Hardie, M.A., 1983. Role of atresia in establishing the follicular hierarchy in the ovary of the domestic hen (Gallus domesticus). J. Reprod. Fertil. 69, 221–227. Hernández-Vértiz, A., González del Pliego, M., Velázquez, P., Pedernera, M., 1993. Morphological changes in the thecal layer during the maturation of the preovulatory ovarian of the domestic fowl (Gallus domesticus). Gen. Comp. Endocr. 92, 80–87. Hertelendy, F., Linter, F., Asem, E.K., Raab, B., 1982. Synergistic effect of gonadotropin releasing hormone on LH-stimulated progesterone production in granulosa cells of the domestic fowl (Gallus domesticus). Gen. Comp. Endocr. 48, 117–122. Huang, E.S., Kao, K.J., Nalbandov, A.V., 1979. Synthesis of sex steroids by cellular components of chicken follicles. Biol. Reprod. 20, 454–461. Imai, K., Nalbandov, A.V., 1978. Plasma and follicular steroid levels of laying hens after the administration of gonadotropins. Biol. Reprod. 19, 779–784. Johnson, A.L., 1996. The avian ovarian hierarchy: a balance between follicle differentiation and atresia. Poult. Avian Biol. Rev. 7, 99–110. Johnson, A.L., 1990. Steroidogenesis and actions of steroids in the hen ovary. Crit. Rev. Poult. Biol. 2, 319–346. Johnson, P.A., Shu-Yin, W., Brooks, C., 1993. Characterization of source and levels of plasma immunoreactive inhibin during the ovulatory cycle of the domestic hen. Biol. Reprod. 48, 262–267. Johnson, A.L., van Tienhoven, A., 1980. Plasma concentrations of six steroids and LH during the ovulatory cycle of the hen, Gallus domesticus. Biol. Reprod. 23, 386–393. Johnson, A.L., van Tienhoven, A., 1981. Hypophyseal sensitivity to hormones in the hen. II. Plasma concentration of LH, progesterone, and testosterone. Biol. Reprod. 25, 153–161. Johnson, P.A., Johnson, A.L., van Tienhoven, A., 1985. Evidence for a positive feedback interaction between progesterone and luteinizing hormone in the induction of ovulation in the hen, Gallus domesticus. Gen. Comp. Endocr. 58, 478–485. Kawashima, M., Kamiyoshi, M., Tanaka, K., 1987. Presence of estrogen receptors in the hen hypothalamus and pituitary. Endocrinology 120, 582–588. Lagüe, P.C., van Tienhoven, A., Cunningham, F.J., 1975. Concentration of estrogens, progesterone and LH during the ovulatory cycle of the laying chicken (Gallus domesticus). Biol. Reprod. 12, 590–598. Lovell, T.M., Gladwell, R.T., Cunningham, F.J., Groome, N.P., Knight, P.G., 1998. Differential changes in inhibin a, activin a, and total a subunit levels in granulosa and theca layers of developing preovulatory follicles in the chicken. Endocrinology 139, 1164–1171. Lovell, T.M., Gladwell, R.T., Groome, N.P., Knight, P.G., 2002a. Modulatory effects of gonadotropin-induced secretion of inhibin A and progesterone by granulosa cells from preovulatory (F1–F3) chicken follicles. Reproduction 124, 649–657. Lovell, T.M., Gladwell, R.T., Groome, N.P., Knight, P.G., 2002b. Differential effect of activin A on basal and gonadotropins and insulin-like growth factor on the secretion of inhibin A and progesterone by granulosa cells from chicken preovulatory (F1–F3) follicles. Reproduction 123, 291–300. Lovell, T.M., Gladwell, R.T., Groome, N.P., Knight, P.G., 2003. Ovarian follicle development in the laying hen is accompanied by divergent changes in inhibin A, inhibin B, activin A and follistatin production in granulosa and theca layer. J. Endocrinol. 177, 45–55. Lovell, T.M., Knight, P.G., Groome, N.P., Gladwell, R.T., 2001. Changes in plasma inhibin A during sexual maturation in the female chicken and the effects of active immunization against inhibin ␣ subunit on reproductive hormone profiles and ovarian function. Biol. Reprod. 64, 188–196. Lovell, T.M., Vanmonfort, D., Bruggeman, V., Decuypere, E., Groome, N.P., Knight, P.G., Gladwell, R.T., 2000. Circulating concentrations of inhibin-related proteins during the ovulatory cycle of the domestic

9

fowl (Gallus domesticus) and after induced cessation of egg laying. J. Reprod. Fertil. 119, 323–328. Nakamura, T., Funabashi, M., Tanabe, Y., 1991. In vitro studies on steroidogenesis in the presence of pregnenolone as precursors by the follicular tissue of the domestic fowl (Gallus domésticus). J. Steroid Biochem. Mol. Biol. 38, 105–110. Nakao, N., Yasuo, S., Nishimura, A., Yamamura, T., Watanabe, T., Anraku, T., Okano, T., Fukada, Y., Sharp, P.J., Ebihara, S., Yoshimura, T., 2007. Circadian clock gene regulation of steroidogenic acute regulatory protein gene expression in preovulatory ovarian follicles. Endocrinology 148, 3031–3038. Nitta, H., Osawa, Y., Bahr, J., 1991. Multiple steroidogenic cell populations in the thecal layer of preovulatory follicles of the chicken ovary. Endocrinology 129, 2033–2040. Nitta, H., Manson, J.I., Bahr, J.M., 1993. Localization of 3␤-hydroxysteroid dehydrogenase in the chicken ovarian follicle shifts from the theca layer to granulosa layer with follicular maturation. Biol. Reprod. 48, 110–116. Oguike, M.A., Igboeli, G., Ibe, S.N., Ironkwe, M.O., 2005. Physiological and endocrinological mechanisms associated with ovulatory cycle and induced-moulting in the domestic chicken – a review. World Poult. Sci. 61, 625–632. Pollock, C., Carpenter, J.W., Antinoff, N., 2005. Birds. In: Carpenter, J.W. (Ed.), Exotic Animal Formulary. Elsevier Saunders, Saint Louis, MO, pp. 199–212. Porter, F.E., Hargis, B.M., Silsby, J.L., Halawani, M.E., 1989. Differential steroid production between theca interna and theca externa cells: a three-cell model for follicular steroidogenesis in avian species. Endocrinology 125, 109–116. Rangel, P.L., Lassala, A., Gutiérrez, C.G., 2005. Testosterone immunization blocks the ovulatory process in laying hens without affecting ovarian follicular development. Anim. Reprod. Sci. 86, 143–151. Rangel, P.L., Rodríguez, A., Gutierrez, C.G., 2007. Testosterone directly induces progesterone production and interacts with physiological concentrations of LH to increase granulosa cell progesterone production in laying hens (Gallus domesticus). Anim. Reprod. Sci. 102, 56–65. Rangel, P.L., Rodríguez, A., Rojas, S., Sharp, P.J., Gutierrez, C.G., 2009. Testosterone stimulates progesterone production and STAR, P450 cholesterol side-chain cleavage and LH receptor mRNAs expression in hen (Gallus domesticus) granulosa cells. Reproduction 138, 961–969. Rangel, P.L., Sharp, P.J., Gutierrez, C.G., 2006. Testosterone antagonist (flutamide) blocks ovulation and preovulatory surges of progesterone, luteinizing hormone and oestradiol in laying hens. Reproduction 131, 1109–1114. Robinson, F.E., Etches, R.J., 1986. Ovarian steroidogenesis during follicular maturation in the domestic fowl (Gallus domesticus). Biol. Reprod. 35, 1096–1105. Robinson, F.E., Etches, R.J., Anderson-Langmuir, C.E., Burke, W.H., Cheng, K.W., Cunningham, F.J., Ishii, S., Sharp, P.J., Talbot, R.T., 1988. Steroidogenic relationships of gonadotrophins hormones in the ovary of the hen (Gallus domesticus). Gen. Comp. Endocrinol. 69, 455–466. Sasanami, T., Mori, M., 1999. Effects of oestradiol-17␤ and testosterone on progesterone production in the cultured granulosa cells of Japanese quail. Brit. Poult. Sci. 40, 536–540. Scott, T.A., Silversides, D., Swift, M.L., 1999. Effect of feed form, formulation, and restriction on the performance of laying hens. Can. J. Anim. Sci. 79, 171–178. Sechman, A., Lakota, P., Wojtysiak, D., Hrabia, A., Mika, M., Lisowski, M., Czekalski, R.J., Kapkowska, E., Bednarczyk, M., 2006. Sex steroids level in blood plasma and ovarian follicles of the chimeric chicken. J. Vet. Med. A: Physiol. Pathol. Clin. Med. 10, 501–508. Sgavioli, S., Filardi, R.S., Praes, M.F., Domingues, C.H., Pileggi, J., Andrade, P.C., Boleli, I.C., Junqueira, O.M., 2013. Dietary fiber inclusion as an alternative to Feed Fasting to induce molting in commercial layers. Rev. Bras. Cienc. Avic. 15, 365–370. Sharp, P.J., Dunn, I.C., Talbot, R.T., 1987. Sex differences in the LH responses to chicken LHRH-I and II in the domestic fowl. J. Endocrinol. 115, 323–331. Sharp, P.J., Talbot, R.T., Macnamee, M.C., 1989. Evidence for the involvement of dopamine and 5-hydroxytryptamine in the regulation of the preovulatory release of luteinizing hormone in the domestic hen. Gen. Comp. Endocr. 76, 205–213. Sterling, R.J., Gasc, J.M., Sharp, P.J., Tuohimaa, P., Baulieu, E.E., 1984. Absence of nuclear progesterone receptor in LH releasing hormone neurones in laying hens. J. Endocrinol. 102, R5–R7. Tilly, J.L., Kowalski, K.I., Johnson, A.L., 1991. Cytochrome P450 side-chain cleavage (P450scc) in the hen ovary. II. P450scc messenger RNA, immunoreactive protein, and enzyme activity in developing granulosa cells. Biol. Reprod. 45, 474–967.



10


Tricarico, A., Pinzani, P., Bianchi, S., Paglierani, M., Distante, V., Pazzaglia, M., Bustin, S.A., Orlando, C., 2002. Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies. Anal. Biochem. 309, 293–300. Williams, J.B., Sharp, P.J., 1978. Control of the preovulatory surge of luteinizing hormone in the hen (Gallus domesticus): the role of progesterone and androgens. J. Endocrinol. 77, 57–65.

Wilson, S.C., Sharp, P.J., 1976. Effects of androgens, oestrogens and deoxycorticosterone acetate on plasma concentrations of luteinizing hormone in laying hens. J. Endocrinol. 69, 93– 102. Yu, M.W., Robinson, F.E., Etches, R.J., 1992. Quantification of ovarian steroidogenesis in the domestic fowl by incubation of intact large follicles. Poult. Sci. 71, 346–351.


Discrimination of group members by laying hens Gallus domesticus.

Early Life in a Barren Environment Adversely Affects Spatial Cognition in Laying Hens (Gallus gallus domesticus).

Relationship between plasma and tissue corticosterone in laying hens (Gallus gallus domesticus): implications for stress physiology and animal welfare.

Functional and structural relationships in steroidogenesis in vitro by human ovarian follicles during maturation and ovulation.

Follicle stimulating hormone increases serum oestradiol-17 beta concentrations, number of growing follicles and yolk deposition in aging hens (Gallus gallus domesticus) with decreased egg production.

Production and fates of unique organelles (transosomes) in ovarian follicles of Gallus domesticus under various conditions. II.

Plasma concentrations of progesterone and corticosterone during the ovulation cycle of the hen (Gallus domesticus).

The effects of progesterone on oviposition and ovulation in the domestic fowl (Gallus domesticus).

Arachidonic acid stimulates steroidogenesis in goldfish preovulatory ovarian follicles.

Dietary sodium for laying hens.

Congenital cerebellar dysplasia in White Leghorn chickens (Gallus gallus domesticus).

Ontogeny of brain temperature regulation in chicks (Gallus gallus domesticus).

Gallus gallus domesticus: paratenic host of Angiostrongylus vasorum.

Cytochemical studies of acid phosphatase in ovarian follicles: a suggested role for lysosomes in steroidogenesis.

Discovery of prognostic factors for diagnosis and treatment of epithelial-derived ovarian cancer from laying hens.

Susceptibility of chickens (Gallus gallus domesticus) to Trichinella patagoniensis.

Effects of Methadone on the Minimum Anesthetic Concentration of Isoflurane, and Its Effects on Heart Rate, Blood Pressure and Ventilation during Isoflurane Anesthesia in Hens (Gallus gallus domesticus).

Effect of metyrapone on the timing of oviposition and ovarian steroidogenesis in the laying hen.

Backyard laying hens--a comment.

Leptin receptor signaling inhibits ovarian follicle development and egg laying in chicken hens.

Proteomic comparison by iTRAQ combined with mass spectrometry of egg white proteins in laying hens (Gallus gallus) fed with soybean meal and cottonseed meal.

Experimental novelty and tonic immobility in chickens (Gallus domesticus ).

The chromosome number of Gallus domesticus.

Prostaglandin E2 (EP) receptors mediate PGE2-specific events in ovulation and luteinization within primate ovarian follicles.